Osteogenic Potential of Mesenchymal Stem Cells from Adipose Tissue, Bone Marrow and Hair Follicle Outer Root Sheath in a 3D Crosslinked Gelatin-Based Hydrogel
Abstract
:1. Introduction
2. Results
2.1. Isolation, Characterization, and Differentiation of MSCs
2.2. Fabrication of MSC-Encapsulated Osteogel and Immunostaining of CD90
2.3. Osteogenic Differentiation of MSCs in 3D-Osteogel
2.4. Osteogenic Gene Expression in 3D-Osteogel Differentiation
3. Discussion
4. Materials and Methods
4.1. MSC Cell Sources
4.2. Isolation of MSCORS, ADMSC and BMMSC
4.3. Osteogel Fabrication, Cell Encapsulation and Differentiation in 3D Culture
4.4. Porcine Wound Model
4.5. Calcium Assay
4.6. Alkaline Phosphatase(ALP) and DNA Quantification
4.7. Osteogenic Gene Expression by Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
4.8. Immunostaining of Cells within the Osteogel
4.9. Live/Dead Cell Assay
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Campana, V.; Milano, G.; Pagano, E.; Barba, M.; Cicione, C.; Salonna, G.; Lattanzi, W.; Logroscino, G. Bone substitutes in orthopaedic surgery: From basic science to clinical practice. J. Mater. Sci. Mater. Med. 2014, 25, 2445–2461. [Google Scholar] [CrossRef] [PubMed]
- de Grado, G.F.; Keller, L.; Idoux-Gillet, Y.; Wagner, Q.; Musset, A.M.; Benkirane-Jessel, N.; Bornert, F.; Offner, D. Bone substitutes: A review of their characteristics, clinical use, and perspectives for large bone defects management. J. Tissue Eng. 2018, 9. [Google Scholar] [CrossRef] [Green Version]
- Caplan, A.I. Adult mesenchymal stem cells for tissue engineering versus regenerative medicine. J. Cell. Physiol. 2007, 213, 341–347. [Google Scholar] [CrossRef] [PubMed]
- Samsonraj, R.M.; Raghunath, M.; Nurcombe, V.; Hui, J.H.; van Wijnen, A.J.; Cool, S.M. Concise Review: Multifaceted Characterization of Human Mesenchymal Stem Cells for Use in Regenerative Medicine. Stem Cells Transl. Med. 2017, 6, 2173–2185. [Google Scholar] [CrossRef] [Green Version]
- Sheng, G. The developmental basis of mesenchymal stem/stromal cells (MSCs). BMC Dev. Biol. 2015, 15, 44. [Google Scholar]
- Haynesworth, S.; Goshima, J.; Goldberg, V.; Caplan, A. Characterization of cells with osteogenic potential from human marrow. Bone 1992, 13, 81–88. [Google Scholar] [CrossRef]
- Zuk, P.A.; Zhu, M.; Ashjian, P.; de Ugarte, D.A.; Huang, J.I.; Mizuno, H.; Alfonso, Z.C.; Fraser, J.K.; Benhaim, P.; Hedrick, M.H. Human adipose tissue is a source of multipotent stem cells. Mol. Biol. Cell 2002, 13, 4279–4295. [Google Scholar] [CrossRef]
- Fraser, J.K.; Wulur, I.; Alfonso, Z.; Hedrick, M.H. Fat tissue: An underappreciated source of stem cells for biotechnology. Trends Biotechnol. 2006, 24, 150–154. [Google Scholar] [CrossRef]
- Anker, P.S.i.; Scherjon, S.A.; der Keur, C.K.; de Groot-Swings, G.M.; Claas, F.H.; Fibbe, W.E.; Kanhai, H.H. Isolation of mesenchymal stem cells of fetal or maternal origin from human placenta. Stem Cells 2004, 22, 1338–1345. [Google Scholar] [CrossRef]
- Li, H.; Masieri, F.F.; Schneider, M.; Kottek, T.; Hahnel, S.; Yamauchi, K.; Obradović, D.; Seon, J.-K.; Yun, S.J.; Ferrer, R.A.; et al. Autologous, Non-Invasively Available Mesenchymal Stem Cells from the Outer Root Sheath of Hair Follicle Are Obtainable by Migration from Plucked Hair Follicles and Expandable in Scalable Amounts. Cells 2020, 9, 2069. [Google Scholar] [CrossRef]
- Bertram, J.E.; Polevoy, Y.; Cullinane, D.M. Mechanics of avian fibrous periosteum: Tensile and adhesion properties during growth. Bone 1998, 22, 669–675. [Google Scholar] [CrossRef]
- Cho, D.I.; Kim, M.R.; Jeong, H.Y.; Jeong, H.C.; Jeong, M.H.; Yoon, S.H.; Kim, Y.S.; Ahn, Y. Mesenchymal stem cells reciprocally regulate the M1/M2 balance in mouse bone marrow-derived macrophages. Exp. Mol. Med. 2014, 46, e70. [Google Scholar] [CrossRef]
- Romieu-Mourez, R.; François, M.; Boivin, M.N.; Bouchentouf, M.; Spaner, D.E.; Galipeau, J. Cytokine modulation of TLR expression and activation in mesenchymal stromal cells leads to a proinflammatory phenotype. J. Immunol. 2009, 182, 7963–7973. [Google Scholar] [CrossRef] [PubMed]
- Asami, T.; Ishii, M.; Fujii, H. Macrophage TLR7/8-Mediated Cytokine Expression by Mesenchymal Stem Cell-Conditioned Medium. Mediat. Inflamm. 2013, 2013, 264260. [Google Scholar] [CrossRef] [PubMed]
- Ciuffreda, M.C.; Malpasso, G.; Musarò, P.; Turco, V.; Gnecchi, M. Protocols for in vitro Differentiation of Human Mesenchymal Stem Cells into Osteogenic, Chondrogenic and Adipogenic Lineages. Methods Mol. Biol. 2016, 1416, 149–158. [Google Scholar] [PubMed]
- Amini, A.R.; Laurencin, C.T.; Nukavarapu, S.P. Bone tissue engineering: Recent advances and challenges. Crit. Rev. Biomed. Eng. 2012, 40, 363–408. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, T.; Lin, S.; Shao, X.; Zhang, Q.; Xue, C.; Zhang, S.; Lin, Y.; Zhu, B.; Cai, X. Effect of matrix stiffness on osteoblast functionalization. Cell Prolif. 2017, 50, e12338. [Google Scholar] [CrossRef] [Green Version]
- Engler, A.J.; Sen, S.; Sweeney, H.L.; Discher, D.E. Matrix elasticity directs stem cell lineage specification. Cell 2006, 126, 677–689. [Google Scholar] [CrossRef] [Green Version]
- Park, J.S.; Chu, J.S.; Tsou, A.D.; Diop, R.; Tang, Z.; Wang, A.; Li, S. The effect of matrix stiffness on the differentiation of mesenchymal stem cells in response to TGF-beta. Biomaterials 2011, 32, 3921–3930. [Google Scholar] [CrossRef] [Green Version]
- Loth, T.; Hötzel, R.; Kascholke, C.; Anderegg, U.; Schulz-Siegmund, M.; Hacker, M.C. Gelatin-based biomaterial engineering with anhydride-containing oligomeric cross-linkers. Biomacromolecules 2014, 15, 2104–2118. [Google Scholar] [CrossRef]
- Loth, T.; Hennig, R.; Kascholke, C.; Hötzel, R.; Hacker, M.C. Reactive and stimuli-responsive maleic anhydride containing macromers–multi-functional cross-linkers and building blocks for hydrogel fabrication. React. Funct. Polym. 2013, 73, 1480–1492. [Google Scholar] [CrossRef]
- Hosaka, A.; Koyama, H.; Kushibiki, T.; Tabata, Y.; Nishiyama, N.; Miyata, T.; Shigematsu, H.; Takato, T.; Nagawa, H. Gelatin Hydrogel Microspheres Enable Pinpoint Delivery of Basic Fibroblast Growth Factor for the Development of Functional Collateral Vessels. Circulation 2004, 110, 3322–3328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chong, E.J.; Phan, T.T.; Lim, I.J.; Zhang, Y.Z.; Bay, B.H.; Ramakrishna, S.; Lim, C.T. Evaluation of electrospun PCL/gelatin nanofibrous scaffold for wound healing and layered dermal reconstitution. Acta Biomater. 2007, 3, 321–330. [Google Scholar] [CrossRef] [PubMed]
- Echave, M.C.; del Burgo, L.S.; Pedraz, J.L.; Orive, G. Gelatin as Biomaterial for Tissue Engineering. Curr. Pharm. Des. 2017, 23, 3567–3584. [Google Scholar] [CrossRef]
- Nawaz, H.A.; Schröck, K.; Schmid, M.; Krieghoff, J.; Maqsood, I.; Kascholke, C.; Kohn-Polster, C.; Schulz-Siegmund, M.; Hacker, M.C. Injectable oligomer-cross-linked gelatine hydrogels via anhydride–amine-conjugation. J. Mater. Chem. B 2021, 9, 2295–2307. [Google Scholar] [CrossRef]
- Li, H.; Masieri, F.F.; Schneider, M.; Bartella, A.; Gaus, S.; Hahnel, S.; Zimmerer, R.; Sack, U.; Maksimovic-Ivanic, D.; Mijatovic, S.; et al. The Middle Part of the Plucked Hair Follicle Outer Root Sheath Is Identified as an Area Rich in Lineage-Specific Stem Cell Markers. Biomolecules 2021, 11, 154. [Google Scholar] [CrossRef]
- Savkovic, V.; Li, H.; Obradovic, D.; Masieri, F.F.; Bartella, A.K.; Zimmerer, R.; Simon, J.C.; Etz, C.; Lethaus, B. The Angiogenic Potential of Mesenchymal Stem Cells from the Hair Follicle Outer Root Sheath. J. Clin. Med. 2021, 10, 911. [Google Scholar] [CrossRef] [PubMed]
- Dominici, M.; le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.; Krause, D.; Deans, R.; Keating, A.; Prockop, D.; Horwitz, E. Minimal criteria for defining multipotent mesenchymal stromal cells. Int Soc. Cell. Ther. Position Stat. J. Cytother. 2006, 8, 315–317. [Google Scholar]
- Vogel, S.; Arnoldini, S.; Möller, S.; Schnabelrauch, M.; Hempel, U. Sulfated hyaluronan alters fibronectin matrix assembly and promotes osteogenic differentiation of human bone marrow stromal cells. Sci. Rep. 2016, 6, 36418. [Google Scholar] [CrossRef] [Green Version]
- Pittenger, M.F.; Mackay, A.M.; Beck, S.C.; Jaiswal, R.K.; Douglas, R.; Mosca, J.D.; Moorman, M.A.; Simonetti, D.W.; Craig, S.; Marshak, D.R. Multilineage potential of adult human mesenchymal stem cells. Science 1999, 284, 143–147. [Google Scholar] [CrossRef] [Green Version]
- Conget, P.A.; Minguell, J.J. Phenotypical and functional properties of human bone marrow mesenchymal progenitor cells. J. Cell. Physiol. 1999, 181, 67–73. [Google Scholar] [CrossRef]
- Haynesworth, S.; Barer, M.; Caplan, A. Cell surface antigens on human marrow-derived mesenchymal cells are detected by monoclonal antibodies. Bone 1992, 13, 69–80. [Google Scholar] [CrossRef]
- le Blanc, K.; Tammik, C.; Rosendahl, K.; Zetterberg, E.; Ringdén, O. HLA expression and immunologic propertiesof differentiated and undifferentiated mesenchymal stem cells. Exp. Hematol. 2003, 31, 890–896. [Google Scholar] [CrossRef]
- Baksh, D.; Yao, R.; Tuan, R.S. Comparison of proliferative and multilineage differentiation potential of human mesenchymal stem cells derived from umbilical cord and bone marrow. Stem Cells 2007, 25, 1384–1392. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Batsali, A.; Pontikoglou, C.; Kouvidi, E.; Damianaki, A.; Stratigi, A.; Kastrinaki, M.-C.; Papadaki, H.A. Comparative Analysis of Bone Marrow and Wharton’s Jelly Mesenchymal Stem/Stromal Cells. Blood 2013, 122, 1212. [Google Scholar] [CrossRef]
- Bidarra, S.J.; Barrias, C.C.; Barbosa, M.A.; Soares, R.; Amedee, J.; Granja, P.L. Phenotypic and proliferative modulation of human mesenchymal stem cells via crosstalk with endothelial cells. Stem Cell Res. 2011, 7, 186–197. [Google Scholar] [CrossRef] [Green Version]
- Xiao, G.; Gopalakrishnan, R.; Jiang, D.; Reith, E.; Benson, M.D.; Franceschi, R.T. Bone morphogenetic proteins, extracellular matrix, and mitogen-activated protein kinase signaling pathways are required for osteoblast-specific gene expression and differentiation in MC3T3-E1 cells. J. Bone Min. Res. 2002, 17, 101–110. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.; Yang, S.; Shao, J.; Li, Y.P. Signaling and transcriptional regulation in osteoblast commitment and differentiation. Front. Biosci. 2007, 12, 3068–3092. [Google Scholar] [CrossRef] [Green Version]
- An, Q.; Wu, D.; Ma, Y.; Zhou, B.; Liu, Q. Suppression of Evi1 promotes the osteogenic differentiation and inhibits the adipogenic differentiation of bone marrow-derived mesenchymal stem cells in vitro. Int. J. Mol. Med. 2015, 36, 1615–1622. [Google Scholar] [CrossRef]
- Phillips, J.E.; Gersbach, C.A.; Wojtowicz, A.M.; Garcia, A.J. Glucocorticoid-induced osteogenesis is negatively regulated by Runx2/Cbfa1 serine phosphorylation. J. Cell Sci. 2006, 119, 581–591. [Google Scholar] [CrossRef] [Green Version]
- Ding, H.; Chen, S.; Yin, J.H.; Xie, X.T.; Zhu, Z.H.; Gao, Y.S.; Zhang, C.Q. Continuous hypoxia regulates the osteogenic potential of mesenchymal stem cells in a time-dependent manner. Mol. Med. Rep. 2014, 10, 2184–2190. [Google Scholar] [CrossRef] [PubMed]
- Rowlands, A.S.; George, P.A.; Cooper-White, J.J. Directing osteogenic and myogenic differentiation of MSCs: Interplay of stiffness and adhesive ligand presentation. Am. J. Physiol.-Cell Ph. 2008, 295, C1037–C1044. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Evers, E.E.; Zondag, G.C.; Malliri, A.; Price, L.S.; Klooster, J.P.T.; van der Kammen, R.A.; Collard, J.G. Rho family proteins in cell adhesion and cell migration. Eur. J. Cancer 2000, 36, 1269–1274. [Google Scholar] [CrossRef]
- Maharam, E.; Yaport, M.; Villanueva, N.L.; Akinyibi, T.; Laudier, D.; He, Z.; Leong, D.J.; Sun, H.B. Rho/Rock signal transduction pathway is required for MSC tenogenic differentiation. Bone Res. 2015, 3, 15015. [Google Scholar] [CrossRef] [Green Version]
- Yamamoto, T.; Ugawa, Y.; Yamashiro, K.; Shimoe, M.; Tomikawa, K.; Hongo, S.; Kochi, S.; Ideguchi, H.; Maeda, H.; Takashiba, S. Osteogenic differentiation regulated by Rho-kinase in periodontal ligament cells. Differentiation 2014, 88, 33–41. [Google Scholar] [CrossRef]
- Sun, M.; Chi, G.; Li, P.; Lv, S.; Xu, J.; Xu, Z.; Xia, Y.; Tan, Y.; Xu, J.; Li, L.; et al. Effects of Matrix Stiffness on the Morphology, Adhesion, Proliferation and Osteogenic Differentiation of Mesenchymal Stem Cells. Int. J. Med. Sci. 2018, 15, 257–268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- da Violante, G.; Zerrouk, N.; Richard, I.; Provot, G.; Chaumeil, J.C.; Arnaud, P. Evaluation of the cytotoxicity effect of dimethyl sulfoxide (DMSO) on Caco2/TC7 colon tumor cell cultures. Biol. Pharm. Bull. 2002, 25, 1600–1603. [Google Scholar] [CrossRef] [Green Version]
- Still, P.C.; Yi, B.; González-Cestari, T.F.; Pan, L.; Pavlovicz, R.E.; Chai, H.B.; Ninh, T.N.; Li, C.; Soejarto, D.D.; McKay, D.B.; et al. Alkaloids from Microcos paniculata with cytotoxic and nicotinic receptor antagonistic activities. J. Nat. Prod. 2013, 76, 243–249. [Google Scholar] [CrossRef] [Green Version]
- Maisani, M.; Pezzoli, D.; Chassande, O.; Mantovani, D. Cellularizing hydrogel-based scaffolds to repair bone tissue: How to create a physiologically relevant micro-environment? J. Tissue Eng. 2017, 8, 2041731417712073. [Google Scholar] [CrossRef] [Green Version]
- Oswald, J.; Boxberger, S.; Jørgensen, B.; Feldmann, S.; Ehninger, G.; Bornhäuser, M.; Werner, C. Mesenchymal Stem Cells Can Be Differentiated Into Endothelial Cells In Vitro. Stem Cells 2004, 22, 377–384. [Google Scholar] [CrossRef]
- Jacobi, U.; Kaiser, M.; Toll, R.; Mangelsdorf, S.; Audring, H.; Otberg, N.; Sterry, W.; Lademann, J. Porcine ear skin: An in vitro model for human skin. Ski. Res. Technol. 2007, 13, 19–24. [Google Scholar] [CrossRef] [PubMed]
- Hempel, U.; Hefti, T.; Kalbacova, M.; Wolf-Brandstetter, C.; Dieter, P.; Schlottig, F. Response of osteoblast-like SAOS-2 cells to zirconia ceramics with different surface topographies. Clin. Oral Implant. Res. 2010, 21, 174–181. [Google Scholar] [CrossRef] [PubMed]
- Hempel, U.; Möller, S.; Noack, C.; Hintze, V.; Scharnweber, D.; Schnabelrauch, M.; Dieter., P. Sulfated hyaluronan/collagen I matrices enhance the osteogenic differentiation of human mesenchymal stromal cells in vitro even in the absence of dexamethasone. Acta Biomater. 2012, 8, 4064–4072. [Google Scholar] [CrossRef] [PubMed]
- Hempel, U.; Preissler, C.; Vogel, S.; Möller, S.; Hintze, V.; Becher, J.; Schnabelrauch, M.; Rauner, M.; Hofbauer, L.C.; Dieter, P. Artificial extracellular matrices with oversulfated glycosaminoglycan derivatives promote the differentiation of osteoblast-precursor cells and premature osteoblasts. BioMed Res. Int. 2014, 2014, 938368. [Google Scholar] [CrossRef] [PubMed]
Medium | Medium Composition |
---|---|
MSCORS Washing Medium | DMEM (Low Glucose) 100 U/mL Penicillin 100 μg/mL Streptomycin 50 μg/mL Gentamycin 10 μg/mL Amphotericin B |
MSCORS Isolation Medium | DMEM (Low Glucose) 10% Fetal Bovine Serum 1% ITS Premix 10 ng/mL bFGF 20 ng/mL rhEGF 2 mM L-Glutamine 1% Pen/Strep (Penicillin 100 U/mL, Streptomycin 100 μg/mL) |
MSCORS/ADMSC Culture Medium | DMEM (Low Glucose) 10% Fetal Bovine Serum 2 mM L-Glutamine 1% Pen/Strep (Penicillin 100 U/mL, Streptomycin 100 μg/mL) |
MSC Osteogenic Medium | DMEM (Low Glucose) 10% Fetal Bovine Serum 2 mM L-Glutamine 200 nM Dexamethasone 50 ug/mL Ascorbic Acid 10 mM β-glycerophosphate |
Gene | Primer Sequence | |
---|---|---|
Runx2 | for | AATGACACCACCAGGCCAAT |
Runx2 | rev | TGGCCTACAAAGGTGGGTTT |
TNAP | for | AGAACCCCAAAGGCTTCTTC |
TNAP | rev | CTTGGCTTTTCCTTCATGGT |
OCN | for | GGTGCAGCCTTTGTGTCCAAGC |
OCN | rev | GTCAGCCAACTCGTCACAGTCC |
BMP2 | for | GGCATCCTCTCCACAAAAGA |
BMP2 | rev | GTGGCAGTAAAAGGCGTGAT |
PPARG | for | TACTGTCGGTTTCAGAAATGCC |
PPARG | rev | GTCAGCGGACTCTGGATTCAG |
HTRP-1 | for | ACCACCGTGTGTTAGAAAAGT |
HTRP-1 | rev | CTGCTGACAAAGATTCACTGGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, H.; Nawaz, H.A.; Masieri, F.F.; Vogel, S.; Hempel, U.; Bartella, A.K.; Zimmerer, R.; Simon, J.-C.; Schulz-Siegmund, M.; Hacker, M.; et al. Osteogenic Potential of Mesenchymal Stem Cells from Adipose Tissue, Bone Marrow and Hair Follicle Outer Root Sheath in a 3D Crosslinked Gelatin-Based Hydrogel. Int. J. Mol. Sci. 2021, 22, 5404. https://doi.org/10.3390/ijms22105404
Li H, Nawaz HA, Masieri FF, Vogel S, Hempel U, Bartella AK, Zimmerer R, Simon J-C, Schulz-Siegmund M, Hacker M, et al. Osteogenic Potential of Mesenchymal Stem Cells from Adipose Tissue, Bone Marrow and Hair Follicle Outer Root Sheath in a 3D Crosslinked Gelatin-Based Hydrogel. International Journal of Molecular Sciences. 2021; 22(10):5404. https://doi.org/10.3390/ijms22105404
Chicago/Turabian StyleLi, Hanluo, Hafiz Awais Nawaz, Federica Francesca Masieri, Sarah Vogel, Ute Hempel, Alexander K. Bartella, Rüdiger Zimmerer, Jan-Christoph Simon, Michaela Schulz-Siegmund, Michael Hacker, and et al. 2021. "Osteogenic Potential of Mesenchymal Stem Cells from Adipose Tissue, Bone Marrow and Hair Follicle Outer Root Sheath in a 3D Crosslinked Gelatin-Based Hydrogel" International Journal of Molecular Sciences 22, no. 10: 5404. https://doi.org/10.3390/ijms22105404
APA StyleLi, H., Nawaz, H. A., Masieri, F. F., Vogel, S., Hempel, U., Bartella, A. K., Zimmerer, R., Simon, J. -C., Schulz-Siegmund, M., Hacker, M., Lethaus, B., & Savković, V. (2021). Osteogenic Potential of Mesenchymal Stem Cells from Adipose Tissue, Bone Marrow and Hair Follicle Outer Root Sheath in a 3D Crosslinked Gelatin-Based Hydrogel. International Journal of Molecular Sciences, 22(10), 5404. https://doi.org/10.3390/ijms22105404