RNAi Silencing of the Biomineralization Gene Perlucin Impairs Oyster Ability to Cope with Ocean Acidification
Abstract
:1. Introduction
2. Results
2.1. Perlucin Expression and Transfection Success
2.2. Viability
2.3. Shell Development: Length and Deformities
2.4. Biomineralization
3. Discussion
4. Materials and Methods
4.1. Perlucin Gene Sequence Characterization
4.2. DsiRNA Synthesis
4.3. Animals
4.4. RNAi
4.4.1. Experiment 1
4.4.2. Experiment 2
4.5. Carbonate Chemistry and Larvae Care
4.6. Real-Time PCR
4.7. Assessment of Larva Viability, Growth, Shell Development, and Biomineralization
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Galtsoff, P.S. The American oyster Crassostrea virginica gmelin. Fish. Bull. 1964, 64, 43–45. [Google Scholar]
- Coen, L.D.; Brumbaugh, R.D.; Bushek, D.; Grizzle, R.; Luckenbach, M.W.; Posey, M.H.; Powers, S.P.; Tolley, S.G. Ecosystem services related to oyster restoration. Mar. Ecol. Prog. Ser. 2007, 341, 303–307. [Google Scholar] [CrossRef]
- National Marine Fisheries Services. Fisheries of the United States 2019; Current Fishery Statistics No. 2019; National Marine Fisheries Services: Silver Spring, MD, USA, 2019. [Google Scholar]
- Powell, E.N.; Ashton-Alcox, K.A.; Kraeuter, J.N.; Ford, S.E.; Bushek, D. Long-term trends in oyster population dynamics in Delaware Bay: Regime shifts and response to disease. J. Shellfish Res. 2008, 27, 729–755. [Google Scholar] [CrossRef]
- Hönisch, B.; Ridgwell, A.; Schmidt, D.N.; Thomas, E.; Gibbs, S.J.; Sluijs, A.; Williams, B. The geological record of ocean acidification. Science 2012, 335, 1058–1063. [Google Scholar] [CrossRef] [PubMed]
- Feely, R.A.; Sabine, C.L.; Lee, K.; Berelson, W.; Kleypas, J.; Fabry, V.J.; Millero, F.J. Impacts of anthropogenic CO2 on the CaCO3 system in the oceans. Science 2004, 305, 362–366. [Google Scholar] [CrossRef]
- Wallace, R.B.; Baumann, H.; Grear, J.S.; Aller, R.C.; Gobler, C.J. Coastal ocean acidification: The other eutrophication problem. Estuar. Coast. Shelf Sci. 2014, 148, 1–13. [Google Scholar] [CrossRef]
- Baumann, H.; Wallace, R.B.; Tagliaferri, T.; Gobler, C.J. Large natural pH, CO2 and O2 fluctuations in a temperate tidal salt marsh on diel, seasonal, and interannual time scales. Estuaries Coasts 2015, 38, 220–231. [Google Scholar] [CrossRef]
- Michaelidis, B.; Ouzounis, C.; Paleras, A.; Pörtner, H.O. Effects of long-term moderate hypercapnia on acid-base balance and growth rate in marine mussels Mytilus Galloprovincialis. Mar. Ecol. Prog. Ser. 2005, 293, 109–118. [Google Scholar] [CrossRef]
- Waldbusser, G.G.; Gray, M.W.; Hales, B.; Langdon, C.J.; Haley, B.A.; Gimenez, I.; Smith, S.R.; Brunner, E.L.; Hutchinson, G. Slow shell building, a possible trait for resistance to the effects of acute ocean acidification. Limnol. Oceanogr. 2016, 61, 1969–1983. [Google Scholar] [CrossRef]
- Pousse, E.; Poach, M.E.; Redman, D.H.; Sennefelder, G.; White, L.E.; Lindsay, J.M.; Munroe, D.; Hart, D.; Hennen, D.; Dixon, M.S.; et al. Energetic response of Atlantic surfclam Spisula solidissima to ocean acidification. Mar. Pollut. Bull. 2020, 161, 111740. [Google Scholar] [CrossRef]
- Bailey, A.; De Wit, P.; Thor, P.; Browman, H.I.; Bjelland, R.; Shema, S.; Fields, D.M.; Runge, J.A.; Thompson, C.; Hop, H. Regulation of gene expression is associated with tolerance of the Arctic copepod Calanus glacialis to CO2-acidified sea water. Ecol. Evol. 2017, 7, 7145–7160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goncalves, P.; Thompson, E.L.; Raftos, D.A. Contrasting impacts of ocean acidification and warming on the molecular responses of CO2-resilient oysters. BMC Genom. 2017, 18, 431. [Google Scholar] [CrossRef]
- Scucchia, F.; Malik, A.; Putnam, H.M.; Mass, T. Genetic and physiological traits conferring tolerance to ocean acidification in mesophotic corals. Glob. Chang. Biol. 2021, 27, 5276–5294. [Google Scholar] [CrossRef]
- Kelly, M.W.; Padilla-Gamiño, J.L.; Hofmann, G.E. Natural variation and the capacity to adapt to ocean acidification in the keystone sea urchin Strongylocentrotus purpuratus. Glob. Chang. Biol. 2013, 19, 2536–2546. [Google Scholar] [CrossRef]
- Thomsen, J.; Stapp, L.S.; Haynert, K.; Schade, H.; Danelli, M.; Lannig, G.; Wegner, K.M.; Melzner, F. Naturally acidified habitat selects for ocean acidification–tolerant mussels. Sci. Adv. 2017, 3, e1602411. [Google Scholar] [CrossRef] [PubMed]
- Bitter, M.C.; Kapsenberg, L.; Gattuso, J.P.; Pfister, C.A. Standing genetic variation fuels rapid adaptation to ocean acidification. Nat. Commun. 2019, 10, 5821. [Google Scholar] [CrossRef]
- Metzger, D.C. Characterizing the Effects of Ocean Acidification in Larval and Juvenile Manilla Clam, Ruditapes Philippinarum, Using a Transcriptomic Approach. Master’s Thesis, University of Washington, Washington, DC, USA, 2012. [Google Scholar]
- Maas, A.E.; Lawson, G.; Tarrant, A.M. Transcriptome-wide analysis of the response of the thecosome pteropod Clio pyramidata to short-term CO2 exposure. Comp. Biochem. Physiol. Part D Genom. Proteom. 2015, 16, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Moya, A.; Howes, E.L.; Lacoue-Labarthe, T.; Foret, S.; Hanna, B.; Medina, M.; Munday, P.L.; Ong, J.; Teyssie, J.L.; Torda, G.; et al. Near-future pH conditions severely impact calcification, metabolism and the nervous system in the pteropod Heliconoides inflatus. Glob. Chang. Biol. 2016, 22, 3888–3900. [Google Scholar] [CrossRef]
- Bitter, M.C.; Kapsenberg, L.; Silliman, K.; Gattuso, J.P.; Pfister, C.A. Magnitude and predictability of pH fluctuations shape plastic responses to ocean acidification. Am. Nat. 2021, 197, 486–501. [Google Scholar] [CrossRef]
- Lopez-Landavery, E.A.; Carpizo-Ituarte, E.J.; Perez-Carrasco, L.; Diaz, F.; De le Cruz, F.L.; Garcia-Esquivel, Z.; Hernandez-Ayon, J.M.; Galindo-Sanchez, C.E. Acidification stress effect on umbonate veliger larval development in Panopea globosa. Mar. Poll. Bull. 2021, 163, 111945. [Google Scholar] [CrossRef]
- Schwaner, C.; Farhat, S.; Boutet, I.; Tanguy, A.; Barbosa, M.; Gruzdev, D.; Pales Espinosa, E.; Allam, B. Molecular features associated with oyster (Crassostrea virginica) resilience to experimental ocean acidification. In prep.
- Schwaner, C.; Farhat, S.; Haley, J.; Pales Espinosa, E.; Allam, B. Proteomic and transcriptomic responses enable clams to correc the pH of calcifying fluids and sustain biomineralization in acidified environments. Int. J. Mol. Sci. 2022, 23, 16066. [Google Scholar] [CrossRef]
- Gómez-Chiarri, M.; Warren, W.C.; Guo, X.; Proestou, D. Developing tools for the study of molluscan immunity: The sequencing of the genome of the eastern oyster, Crassostrea virginica. Fish Shellfish Immunol. 2015, 46, 2–4. [Google Scholar] [CrossRef] [PubMed]
- Mann, K.; Weiss, I.M.; Andre, S.; Gabius, H.J.; Fritz, M. The amino-acid sequence of the abalone (Haliotis laevigata) nacre protein perlucin—Detection of a functional C-type lectin domain with galactose/mannose specificity. Eur. J. Biochem. 2000, 267, 5257–5264. [Google Scholar] [CrossRef] [PubMed]
- Weiss, I.M.; Kaufmann, S.; Mann, K.; Fritz, M. Purification and characterization of perlucin and perlustrin, two new proteins from the shell of the mollusc Haliotis laevigata. Biochem. Biophys. Res. Commun. 2000, 267, 17–21. [Google Scholar] [CrossRef]
- Blank, S.; Arnoldi, M.; Khoshnavaz, S.; Treccani, L.; Kuntz, M.; Mann, K.; Grathwohl, G.; Fritz, M. The nacre protein perlucin nucleates growth of calcium carbonate crystals. J. Microsc. 2003, 212, 280–291. [Google Scholar] [CrossRef]
- Gao, P.; Liao, Z.; Wang, X.; Bao, L.; Fan, M.; Li, X.; Wu, C.; Xia, S. Layer by Layer proteomic analysis of Mytilus galloprovincialis shell. PLoS ONE 2015, 10, e0133913. [Google Scholar] [CrossRef] [PubMed]
- Agrawal, N.; Dasaradhi, P.V.N.; Mohammed, A.; Malhotra, P.; Bhatnagar, R.K.; Mukherjee, S.K. RNA interference: Biology, mechanism, and applications. Microbiol. Mol. Biol. Rev. 2003, 67, 657–685. [Google Scholar] [CrossRef]
- Sen, G.L.; Blau, H.M. A brief history of RNAi: The silence of the genes. FASEB J. 2006, 20, 1293–1299. [Google Scholar] [CrossRef]
- Owens, L.; Malham, S. Review of the RNA interference pathway in molluscs including some possibilities for use in bivalves in aquaculture. J. Mar. Sci. 2015, 3, 87–99. [Google Scholar] [CrossRef]
- Fabioux, C.; Corporeau, C.; Quilien, V.; Favrel, P.; Huvet, A. In vivo RNA interference in oyster -- vasa silencing inhibits germ cell development. FEBS J. 2009, 276, 2566–2573. [Google Scholar] [CrossRef] [PubMed]
- Choi, S.H.; Jee, Y.B.; Lee, S.J.; Cho, M.Y.; Lee, S.J.; Kim, J.W.; Jeong, D.H.; Kim, K.H. Effects of RNA interference-mediated knock-down of hypoxia-inducible factor-a on respiratory burst activity of the Pacific oyster Crassostrea gigas hemocytes. Fish Shellfish Immunol. 2013, 35, 476–479. [Google Scholar] [CrossRef]
- Yang, B.; Pu, F.; Li, L.; You, W.; Ke, C.; Feng, D. Functional analysis of a tyrosinase gene involved in early larval shell biogenesis in Crassostrea angulata and its response to ocean acidification. Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 2017, 206, 8–15. [Google Scholar] [CrossRef]
- Pales Espinosa, E.; Allam, B. Reverse genetics demonstrate the role of mucosal C-type lectins in food particle selection in the oyster Crassostrea virginica. J. Exp. Biol. 2018, 221, jeb174094. [Google Scholar] [CrossRef] [PubMed]
- Liang, X.; Chen, K.; Li, Y.F.; Bao, W.Y.; Yoshida, A.; Osatomi, K.; Yang, J.L. An ɑ2-adrenergic receptor is involved in larval metamorphosis in the mussel, Mytilus coruscus. Biofouling 2019, 35, 986–996. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhu, X.; Lian, S.; Li, Y.; Hu, N.; Hu, X.; Bao, Z.; Wang, S. Functional characterization of Cfap206 for bivalve ciliogenesis by RNAi and CRISPR/Cas9 technologies. Front. Mar. Sci. 2022, 392. [Google Scholar] [CrossRef]
- Barreto, F.S.; Schoville, S.D.; Burton, R.S. Reverse genetics in the tide pool: Knock-down of target gene expression via RNA interference in the copepod Tigriopus californicus. Mol. Ecol. Resour. 2015, 15, 868–879. [Google Scholar] [CrossRef]
- Eichner, C.; Nilsen, F.; Grotmol, S.; Dalvin, S. A method for stable gene knock-down by RNA interference in larvae of the salmon louse (Lepeophtheirus salmonis). Exp. Parasitol. 2014, 140, 44–51. [Google Scholar] [CrossRef]
- Snell, T.W.; Shearer, T.L.; Smith, H.A. Exposure to dsRNA elicits RNA interference in Brachionus manjavacas (Rotifera). Mar. Biotechnol. 2011, 13, 264–274. [Google Scholar] [CrossRef]
- Whangbo, J.S.; Hunter, C.P. Environmental RNA interference. Trends Genet. 2008, 24, 297–305. [Google Scholar] [CrossRef]
- Fanelli, E.; Di Vito, M.; Jones, J.T.; De Giorgi, C. Analysis of chitin synthase function in a plant parasitic nematode, Meloidogyne artiellia, using RNAi. Gene 2005, 349, 87–95. [Google Scholar] [CrossRef]
- Dubreuil, G.; Deleury, E.; Magliano, M.; Jaouannet, M.; Abad, P.; Rosso, M.N. Peroxiredoxins from the plant parasitic root-knot nematode, Meloidogyne incognita, are required for successful development within the host. Int. J. Parasitol. 2011, 41, 385–396. [Google Scholar] [CrossRef] [PubMed]
- Wassnig, M.; Southgate, P.C. The effects of stocking density and ration on survival and growth of winged pearl oyster (Pteria penguin) larvae fed commercially available micro-algae concentrates. Aquac. Rep. 2016, 4, 17–21. [Google Scholar] [CrossRef]
- Wang, T.; Li, Q.; Zhang, J.; Yu, R. Effects of salinity, stocking density, and algal density on growth and survival of Iwagaki oyster Crassostrea nippona larvae. Aquac. Int. 2018, 26, 947–958. [Google Scholar] [CrossRef]
- Geldhof, P.; Murray, L.; Couthier, A.; Gilleard, J.S.; McLauchlan, G.; Knox, D.P.; Britton, C. Testing the efficacy of RNA interference in Haemonchus contortus. Int. J. Parasitol. 2006, 36, 801–810. [Google Scholar] [CrossRef] [PubMed]
- Visser, A.; Geldhof, P.; De Maere, V.; Knox, D.P.; Vercruysse, J.; Claerebout, E. Efficacy and specificity of RNA interference in larval life-stages of Ostertagia ostertagi. Parasitology 2006, 133, 777–783. [Google Scholar] [CrossRef] [PubMed]
- Kurihara, H.; Kato, S.; Ishimatsu, A. Effects of increased seawater pCO2 on early development of the oyster Crassostrea gigas. Aquat. Biol. 2007, 1, 91–98. [Google Scholar] [CrossRef]
- Liu, Z.; Zhou, Z.; Zhang, Y.; Wang, L.; Song, X.; Wang, W.; Zheng, Y.; Zong, Y.; Lv, Z.; Song, L. Ocean acidification inhibits initial shell formation of oyster larvae by suppressing the biosynthesis of serotonin and dopamine. Sci. Total Environ. 2020, 735, 139469. [Google Scholar] [CrossRef]
- Gosling, E. Bivalve Molluscs: Biology, Ecology and Culture; Blackwell Science: Oxford, UK, 2003; p. 456. [Google Scholar]
- Zhang, G.; He, L.S.; Wong, Y.H.; Yu, L.; Qian, P.Y. DsiRNA transfection in larvae of the barnacle Amphibalanus amphitrite. J. Exp. Biol. 2015, 218, 2505–2509. [Google Scholar]
- Gobler, C.J.; Talmage, S.C. Physiological response and resilience of early life-stage Eastern oysters (Crassostrea virginica) to past, present and future ocean acidification. Conserv. Physiol. 2014, 2, cou004. [Google Scholar] [CrossRef]
- Timmins-Schiffman, E.; O’Donnell, M.J.; Friedman, C.S.; Roberts, S.B. Elevated pCO2 causes developmental delay in early larval Pacific oysters, Crassostrea gigas. Mar. Biol. 2013, 160, 1973–1982. [Google Scholar] [CrossRef]
- Gazeau, F.; Gattuso, J.P.; Dawber, C.; Pronker, A.E.; Peene, F.; Peene, J.; Heip, C.H.R.; Middelburg, J.J. Effect of ocean acidification on the early life stages of the blue mussel Mytilus edulis. Biogeosciences 2010, 7, 2051–2060. [Google Scholar] [CrossRef]
- Hettinger, A.; Sanford, E.; Hill, T.M.; Hosfelt, J.D.; Russell, A.D.; Gaylord, B. The influence of food supply on the response of Olympia oyster larvae to ocean acidification. Biogeosciences 2013, 10, 6629–6638. [Google Scholar] [CrossRef] [Green Version]
- Watson, S.A.; Southgate, P.C.; Tyler, P.A.; Peck, L.S. Early larval development of the Sydney rock oyster Saccostrea glomerata under near-future predictions of CO2-driven ocean acidification. J. Shellfish Res. 2009, 28, 431–437. [Google Scholar] [CrossRef]
- Bylenga, C.H.; Cummings, V.J.; Ryan, K.G. High resolution microscopy reveals significant impacts of ocean acidification and warming on larval shell development in Laternula elliptica. PLoS ONE 2017, 12, e0175706. [Google Scholar] [CrossRef]
- Wessel, N.; Martin, S.; Badou, A.; Dubois, P.; Huchette, S.; Julia, V.; Flavia, N.; Ewan, H.; Christine, P.; Stephanie, A. Effect of CO2-induced ocean acidification on the early development and shell mineralization of the European abalone (Halitosi tuberculata). J. Exp. Mar. Biol. Ecol. 2018, 508, 52–63. [Google Scholar] [CrossRef]
- Sanders, M.B.; Bean, T.P.; Hutchinson, T.H.; Le Quesne, W.J. Juvenile king scallop, Pecten maximus, is potentially tolerant to low levels of ocean acidification when food is unrestricted. PLoS ONE 2013, 8, e74118. [Google Scholar] [CrossRef]
- Thomsen, J.; Casties, I.; Pansch, C.; Körtzinger, A.; Melzner, F. Food availability outweighs ocean acidification effects in juvenile Mytilus edulis: Laboratory and field experiments. Glob. Chang. Biol. 2013, 19, 1017–1027. [Google Scholar] [CrossRef]
- Ramesh, K.; Yarra, T.; Clark, M.S.; John, U.; Melzner, F. Expression of calcification-related ion transporters during blue mussel larval development. Ecol. Evol. 2019, 9, 7157–7172. [Google Scholar] [CrossRef]
- Wright-LaGreca, M.; Mackenzie, C.; Green, T.J. Ocean acidification alters developmental timing and gene expression of ion transport proteins during larval development in resilient and susceptible lineages of the pacific oyster (Crassostrea gigas). Mar. Biotechnol. 2022, 24, 116–124. [Google Scholar] [CrossRef]
- Weiss, I.M.; Tuross, N.; Addadi, L.; Weiner, S. Mollusc larval shell formation: Amorphous calcium carbonate is a precursor phase for aragonite. J. Exp. Zool. 2002, 293, 478–491. [Google Scholar] [CrossRef]
- Noisette, F.; Comtet, T.; Legrand, E.; Bordeyne, F.; Davoult, D.; Martin, S. Does encapsulation protect embryos from the effects of ocean acidification? The Example of Crepidula fornicata. PLoS ONE 2014, 9, e93021. [Google Scholar] [CrossRef]
- De Wit, P.; Durland, E.; Ventura, A.; Langdon, C.J. Gene expression correlated with delay in shell formation in larval Pacific oysters (Crassostrea gigas) exposed to experimental ocean acidification provides insights into shell formation mechanisms. BMC Genom. 2018, 19, 160. [Google Scholar] [CrossRef]
- Frieder, C.A.; Applebau, S.L.; Pan, T.C.F.; Hedgecock, D.; Manahan, D.T. Metabolic cost of calcification in bivalve larvae under experimental ocean acidification. ICES J. Mar. Sci. 2017, 74, 941–954. [Google Scholar] [CrossRef]
- Dodenhof, T.; Dietz, F.; Franken, S.; Grunwald, I.; Kelm, S. Splice variants of perlucin from Haliotis laevigata modulate the crystallisation of CaCO3. PLoS ONE 2014, 9, e97126. [Google Scholar] [CrossRef]
- Weiss, I.M.; Schonitzer, V. The distribution of chitin in larval shells of the bivalve mollusk Mytilus galloprovincialis. J. Struct. Biol. 2006, 153, 264–277. [Google Scholar] [CrossRef]
- Zhao, X.; Han, Y.; Chen, B.; Xia, B.; Qu, K.; Liu, G. CO2-driven ocean acidification weakens mussel shell defense capacity and induces global molecular compensatory responses. Chemosphere 2020, 243, 125415. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.; Huang, M.; Pu, F.; You, W.; Ke, C. Effects of ocean acidification caused by rising CO2 on the early development of three mollusks. Aquat. Biol. 2015, 23, 147–157. [Google Scholar] [CrossRef]
- Barros, P.; Sobral, P.; Range, P.; Chícharo, L.; Matias, D. Effects of sea-water acidification on fertilization and larval development of the oyster Crassostrea gigas. J. Exp. Mar. Biol. Ecol. 2013, 440, 200–206. [Google Scholar] [CrossRef]
- Talmage, S.C.; Gobler, C.J. Effects of past, present, and future ocean carbon dioxide concentrations on the growth and survival of larval shellfish. Proc. Natl. Acad. Sci. USA 2010, 107, 17246–17251. [Google Scholar] [CrossRef] [PubMed]
- Helm, M.M.; Bourne, N.; Lovatelli, A. Hatchery Culture of Bivalves: A Practical Manual. Food and Agriculture Organization of the United Nationas; Food and Agriculture Organization of the United Nations: Rome, Italy, 2004. [Google Scholar]
- Allen, S.K.; Bushek, D. Large scale production of triploid Crassostrea virginica (Gmelin) using “stripped” gametes. Aquaculture 1992, 103, 241–251. [Google Scholar] [CrossRef]
- Schwaner, C.; Barbosa, M.; Connors, P.; Park, T.J.; de Silva, D.; Griffith, A.; Gobler, C.J.; Pales Espinosa, E.; Allam, B. Experimental acidification increases susceptibility of Mercenaria mercenaria to infection by Vibrio species. Mar. Environ. Res. 2020, 154, 104872. [Google Scholar] [CrossRef] [PubMed]
- Millero, F.J. Carbonate constants for estuarine waters. Mar. Freshw. Res. 2010, 62, 139–142. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to imageJ: 25 years of image analysis. Nat. Methods. 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence (5′–3′) | Tm |
---|---|---|
qRT-PCR primers | ||
18S-Forward | CGCCGGCGACGTATCTTTCAA | 60.1 |
18S-Reverse | CTGATTCCCCGTTACCCGTTA | 56.5 |
Perlucin-Forward | TTAGGTGGATCGGTGGTGAGC | 59.0 |
Perlucin-Reverse | CATTCCACCCGTTAGAGGCTC | 56.9 |
DsiRNAs | ||
DsiRNA-Perlucin 1 Sense | rArGrArUrArGrArCrArArUrArArCrUrGrArArUrArUrGrCAA | |
DsiRNA-Perlucin 1 Antisense | rUrUrGrCrArUrArUrUrCrArGrUrUrArUrUrGrUrCrUrArUrCrUrGrC | |
DsiRNA-Perlucin 2 Sense | rGrArArGrUrArUrUrCrGrCrUrArUrGrUrUrArGrGrUrGrGAT | |
DsiRNA-Perlucin 2 Antisense | rArUrCrCrArCrCrUrArArCrArUrArGrCrGrArArUrArCrUrUrCrUrA | |
DsiRNA-Perlucin 3 Sense | rCrGrGrGrUrGrGrArArUrGrArCrUrUrCrCrCrArUrGrUrUCA | |
DsiRNA-Perlucin 3 Antisense | rUrGrArArCrArUrGrGrGrArArGrUrCrArUrUrCrCrArCrCrCrGrUrU | |
DsiRNA-NC5 Sense | rCrArUrArUrUrGrCrGrCrGrUrArUrArGrUrCrGrCrGrUrUrArG | |
DsiRNA-NC5 Antisense | rUrGrGrUrArUrArArCrGrCrGrCrArUrArUrCrArGrCrGrCrArArUrC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schwaner, C.; Pales Espinosa, E.; Allam, B. RNAi Silencing of the Biomineralization Gene Perlucin Impairs Oyster Ability to Cope with Ocean Acidification. Int. J. Mol. Sci. 2023, 24, 3661. https://doi.org/10.3390/ijms24043661
Schwaner C, Pales Espinosa E, Allam B. RNAi Silencing of the Biomineralization Gene Perlucin Impairs Oyster Ability to Cope with Ocean Acidification. International Journal of Molecular Sciences. 2023; 24(4):3661. https://doi.org/10.3390/ijms24043661
Chicago/Turabian StyleSchwaner, Caroline, Emmanuelle Pales Espinosa, and Bassem Allam. 2023. "RNAi Silencing of the Biomineralization Gene Perlucin Impairs Oyster Ability to Cope with Ocean Acidification" International Journal of Molecular Sciences 24, no. 4: 3661. https://doi.org/10.3390/ijms24043661
APA StyleSchwaner, C., Pales Espinosa, E., & Allam, B. (2023). RNAi Silencing of the Biomineralization Gene Perlucin Impairs Oyster Ability to Cope with Ocean Acidification. International Journal of Molecular Sciences, 24(4), 3661. https://doi.org/10.3390/ijms24043661