Next Article in Journal
A Label-Free Optical Flow Cytometry Based-Method for Rapid Assay of Disinfectants’ Bactericidal Activity
Next Article in Special Issue
Rapid and Direct Detection of the Stubby Root Nematode, Paratrichodorus allius, from Soil DNA Extracts Using Recombinase Polymerase Amplification Assay
Previous Article in Journal
Development of an Ex Vivo Functional Assay for Prediction of Irradiation Related Toxicity in Healthy Oral Mucosa Tissue
Previous Article in Special Issue
Identification and Genome Characterization of a Novel Nege-like Virus Isolated from Aphids (Aphis gossypii) in Yunnan Province
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 25
Issue 13
10.3390/ijms25137146
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Assembly and Genome Annotation of Different Strains of Apple Fruit Moth Virus (Cydia pomonella granulovirus)

by
Tatiana N. Lakhova
1,2,*,†,
Aleksandra A. Tsygichko
3,†,
Alexandra I. Klimenko
1,2,4,
Vladimir Y. Ismailov
3,
Gennady V. Vasiliev
1,
Anzhela M. Asaturova
3,‡ and
Sergey A. Lashin
1,4,‡
1
Kurchatov Genomic Centre of Institute of Cytology and Genetics SB RAS, 630090 Novosibirsk, Russia
2
Department of Mathematics and Mechanics, Mathematical Center, Novosibirsk State University, 630090 Novosibirsk, Russia
3
Federal State Budgetary Scientific Institution, Federal Research Center of Biological Plant Protection, 350039 Krasnodar, Russia
4
Faculty of Natural Sciences, Novosibirsk State University, 630090 Novosibirsk, Russia
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
‡
These authors also contributed equally to this work.
Int. J. Mol. Sci. 2024, 25(13), 7146; https://doi.org/10.3390/ijms25137146
Submission received: 15 May 2024 / Revised: 19 June 2024 / Accepted: 20 June 2024 / Published: 28 June 2024
(This article belongs to the Special Issue Advances in the Molecular Diagnostics of Agriculture Pathogens and Pests)
Browse Figures
Versions Notes

Abstract

:
Cydia pomonella granulovirus is a natural pathogen for Cydia pomonella that is used as a biocontrol agent of insect populations. The study of granulovirus virulence is of particular interest since the development of resistance in natural populations of C. pomonella has been observed during the long-term use of the Mexican isolate CpGV. In our study, we present the genomes of 18 CpGV strains endemic to southern Russia and from Kazakhstan, as well as a strain included in the commercial preparation “Madex Twin”, which were sequenced and analyzed. We performed comparative genomic analysis using several tools. From comparisons at the level of genes and protein products that are involved in the infection process of virosis, synonymous and missense substitution variants have been identified. The average nucleotide identity has demonstrated a high similarity with other granulovirus genomes of different geographic origins. Whole-genome alignment of the 18 genomes relative to the reference revealed regions of low similarity. Analysis of gene repertoire variation has shown that BZR GV 4, BZR GV 6, and BZR GV L-7 strains have been the closest in gene content to the commercial “Madex Twin” strain. We have confirmed two deletions using read depth coverage data in regions lacking genes shown by homology analysis for granuloviruses BZR GV L-4 and BZR GV L-6; however, they are not related to the known genes causing viral pathogenicity. Thus, we have isolated novel CpGV strains and analyzed their potential as strains producing highly effective bioinsecticides against C. pomonella.

1. Introduction

Biocontrol methods are an alternative to the use of synthetic pesticides against crop insect pests. These methods include the use of compounds of biological origin, predators, competitors, and pathogens (bacteria, fungi, and baculoviruses) with entomopathogenic properties [1,2]. Biological control is a key component of the “systems approach”, which not only reduces the population of phytophages but also does not disrupt natural biocoenotic relationships in populations [3].
Among biocontrol agents, Cydia pomonella granulosis virus (CpGV) from the Baculoviridae family is considered to be one of the most effective against the target object, with an efficiency of 95–97% [4]. On its basis, there are commercial preparations named “CYD-X”, “Madex Pro”, “Madex Twin”, “Madex Top”, “Carpovirus”, and “Carpovirus Plus” [5,6]. The main properties of CpGV, in addition to high efficacy, are selectivity action, ability to infiltrate into pest populations, and safety for the environment [7].
Since the target insect for CpGV is Cydia pomonella, bioinsecticides based on CpGV are mainly used to protect apple orchards. The area of apple orchards in Europe is about 470 thousand hectares. The major apple-producing countries are Poland, Spain, and France [8,9]. The area of apple orchards in the Russian Federation is about 220 thousand hectares. The south of Russia is a leader in apple production (Kabardino-Balkaria, Stavropol Krai, Volgograd Oblast, and Krasnodar Krai) [10,11,12].
It should be noted that the Mexican isolate, which was one of the first to be isolated, is the most common and serves as the basis for many commercial preparations. Its genome was sequenced and fully assembled into a ring chromosome in 2001 [13]. Nevertheless, in the process of its long-term use, the formation of resistance in natural populations of C. pomonella has been noted [14]. Researchers distinguish three types of resistance to baculovirus depending on inheritance. Type I resistance is determined by the sex Z chromosome, type II by the predominant autosome, and type III is both autosomal and Z-linked [14,15,16,17]. Thus, this indicates a necessity for the constant search and use of new highly effective strains that can overcome the acquired resistance of C. pomonella. That is why it is expedient to isolate and study the properties of new CpGV strains.
To date, several complete assemblies of CpGV genomes from China, Iraq, South Africa, etc., as well as fragmented genomes of varying degrees of completeness, can be found in open sources; however, no data on CpGV viruses from Russia were found in open sources. On the basis of the Federal State Budgetary Scientific Institution’s “Federal Scientific Center for Biological Plant Protection”, a bioresource collection called the “State Collection of Entomoacariphages and Microorganisms” contains a number of CpGV strains with entomopathogenic properties.
The aim of this study is to perform molecular–genetic identification and describe the genome properties of new CpGV strains indigenous to the south of Russia and Kazakhstan using the methods of whole-genome sequencing and comparative genomic analysis for the first time in the Russian Federation. Thus, the assembly and annotation of genomes of new CpGV strains native to southern Russia will allow us to expand the range of promising entomopathogenic agents against C. pomonella, which may become the basis for highly effective bioinsecticides in the future.

2. Results

2.1. Preparation of Samples for Sequencing and Quality Analysis of Libraries of Entomopathogenic Virus Strains

During library preparation, isolation of a DNA fraction of more than 150 bp allowed to cut off impurities of highly degraded host DNA and degraded viral DNA.
It was found that the fraction of 150–400 bp is 4.5–10% of the total DNA, while 50–80% indicated either a high level of virus degradation during prolonged storage as a suspension or a noticeable contamination of the material with degraded host DNA adhering to the surface of viral particles. The concentrations of starting DNA, prepared libraries, their molarities, and individual barcode identifiers are given in the Supplementary Materials (Table S1).
The obtained libraries of 18 genomes of CpGV from the bioresource collection of the Federal Research Center of Biological Plant Protection’s “State Collection of Entomoacariphages and Microorganisms” and the genome of the strain-producing bioinsecticide “Madex Twin” were sequenced by paired-end reads of 2 × 150 bp. The real volumes of the obtained data after quality filtering amounted to more than 20 million paired-end reads for each strain.

2.2. Preparing and Filtering Sequenced Data

Raw data underwent quality control and trimming was performed, followed by mapping to the CpGV reference genome (NC_002816.1). Then, statistics were calculated from the mapped reads to the reference (NC_002816.1). The characteristics are presented in the Supplementary Materials (Table S2). Coverage rates were calculated using the Lander–Waterman formula [18], L*N/G, where L is the number of paired-end reads mapped to the reference genome, N is the length of the reads, and G is the length of the genome.

2.3. CpGV Genome Assembly

Two assemblers were selected to acquire draft assemblies: Spades [19,20] and MinYS [21]. When selecting mapped reads and translating them into fastq files for subsequent assembly, files with paired-end reads and files with single reads that had not had a pair mapped to the genome were obtained. Since MinYS does not handle single reads, paired-end reads were taken before mapping to the reference genome. In this case, the assembler independently mapped the reads to the reference genome.
The Pilon tool was applied to each assembly to reduce possible assembly errors [22] and acquired the corrected assembly. After this step, the quality of the assemblies was also evaluated using Quast tool [23] in order to track for each genome whether the parameters had degraded or not. Then, using the Gfinisher tool [24], we obtained a more complete assembly based on the two existing draft assemblies. The main assembly was Spades and the additional one was MinYS because the Spades one had better assembly quality metrics. Gfinisher reduced the number of resulting contigs in almost all assemblies.
Finally, 18 assemblies were obtained, each of which consisted of 4 contigs on average. The main characteristics of the final assemblies of CpGV genomes—obtained as a result of improving the draft assemblies of Spades and MinYS using Pilon and Gfinisher—are summarized in Table 1.

2.4. Genome Annotation

Genome annotation was performed using the Prokka tool [25]. Table 2 summarizes the genomic annotation of the virus compared to the reference genome NC_002816.1.
Genome assemblies and annotations are deposited at NCBI. Accession numbers of the sequences at NCBI are listed in the Supplementary Materials (Table S3).

Further Annotation and Analysis of Genes and Their Products Involved in the Virosis Infectious Process

When studying genetic variability in different strains of apple moth granulovirus, the genes involved in the infectious process of C. pomonella virosis are of key importance since the differences between them observed in the studied strains, in comparison with each other and the CpGV reference genome may be the cause of changes in the virulence indices of the corresponding strains. The protein products of the corresponding genes and their associated functions are presented in Table 3.
Genes encoding Chitinase and Cathepsin were automatically annotated by Prokka. Pairwise alignment revealed the sequences of genes encoding IAP and MMP in the studied CpGV genomes (identity = from 99.5 to 100%, e-value = 0.0, alignment length of protein (%) = 100).
Structurally, the mmp gene encoding the MMP protein in the studied genomes can be located in two locations relative to the genes encoding the Chitinase, Cathepsin, and IAP proteins (for those variants where all genes are on the same contig). The first case is observed in most of the genomes of the studied strains (BZR GV: 1, 3, 4, 7–9, 13, L-2, and L-7): the mmp gene is located downstream of the chiA gene encoding the Chitinase protein (Figure 1a). In the second case, the mmp gene is upstream of the chiA gene (Figure 1b). This variant is found in the BZR GV genomes: L-4, L-6, and L-8. In the reference genome, these genes are located as depicted in Figure 1b.
MAFFT multiple alignment [32] has revealed mutations in genes—specific substitutions are listed in the Supplementary Materials (Table S4), some of them were synonymous (did not result in an amino acid substitution) and nonsynonymous (resulted in an amino acid substitution). Figure 2 shows the distribution of nonsynonymous substitutions found in proteins relative to each CpGV genome examined.

2.5. Comparative Genomic Analysis

The next step was to perform comparative genomic analysis to identify and evaluate differences in the genomes of the studied CpGV strains from those represented in NCBI Virus. First, we performed average nucleotide identity (ANI) analysis to establish the degree of closeness between strains based on the study of whole-genome homology. Then, whole-genome alignment of the studied genomes to a reference (NC_002816.1) was performed to search for genomic rearrangements. We also analyzed the variation in gene repertoire relative to the two genomes (NC_002816.1 and KM217575).

2.5.1. ANI Analysis

The average nucleotide identity analysis [33] yielded ANI values > 99% for all 18 genomes compared to 14 genomes from NCBI (Figure 3). The obtained values indicate a good proximity of the studied genomes to the genomes represented in the database.

2.5.2. Whole-Genome Alignment of Genomes

Whole-genome alignment was performed using the progressiveMauve program with standard parameters. The obtained results were visualized using the Mauve program [34] (Figure 4).
Whole-genome alignment shows generally close genome similarity, which is consistent with ANI analysis. Large regions with low sequence similarity are shown in the following genomes: BZR GV 2, BZR GV 5, BZR GV 12, BZR GV L-2, BZR GV L-5, and BZR GV L-7. These regions included CDSs with both predicted functions and hypothetical proteins, and CDSs may only partially fall into such regions. We considered regions of 300 bp in size to be large regions.
There appear to be several reasons for this: the effect of fragmented assembly or errors in assembling reads into longer contigs, or accumulated differences contribute to the sequence. Further details are provided for such CDSs in the Supplementary Materials (Table S5). The genes of interest have not fallen within these regions, which is consistent with the analysis of genes and their products involved in the infectious process of virosis.

2.5.3. Gene Repertoire Analysis

The GenAPI tool [35] that allows comparisons of incomplete closely related genomes of microorganisms was used to compare the gene repertoire.
Figure 5 shows the result of comparing the gene repertoire of 18 tested CpGV strains, “Madex Twin”, as well as two references: NC_002816.1 and KM217575.
The absence of genes is defined by the similarity thresholds of the compared sequences. Thus, if a gene sequence has a similarity level of less than 90% with less than 50% coverage, the gene is considered absent in this genome relative to the reference.
The names of genes whose presence varied between strains and their products are presented in Table 4, where gene No 1 is listed according to the designations adopted in annotation NC_002816.1, genes No 2–4 are listed according to the designations adopted in annotation KM217575, genes No 5–10 are the genes predicted by the Prokka program in the tested genomes.
Analysis of the gene repertoire allowed us to identify 10 genes present in only a part of the genomes of the studied strains. Among them, there are two genes absent in most of the analyzed strains—orf6 and IFEMGEHL_00128. At the same time, three strains—BZR GV L-7, BZR GV 6, and BZR GV 4—turned out to be the closest in their gene repertoire to “Madex Twin”, which differs from them by the absence of the orf62 gene. Thus, the results obtained are consistent with the results of the comparative genomic study based on the analysis of average nucleotide identity.

2.5.4. Bioinformatic Verification of Detected Deletions

We verified the reports of possible deletions indicated by the GenAPI results by using additional information on changes in the depth of coverage of the corresponding sites (CNVpytor [36]) and their comparison with regions of reduced homology in the results of the whole-genome alignment (progressiveMauve [34]) of the analyzed genomes of C. pomonella granulovirus strains. In addition, we compared each such region with the reference gene to find out which genes are affected by the deletion. Additionally, we checked the list of genes from Table 4, whose IDs were predicted by the Prokka program in the studied genomes for consistency with the reference NC_002816.1 by pairwise alignment. It turned out that BJOIBEHA_00037 is orf63 bro, BJOIBEHA_00039 is orf64, BJOIBEHA_00040 is orf65, and BJOIBEHA_00041 is orf66 ptp-2. The designations of these genes as in the reference were used in Table 5.
The analysis confirmed that for BZR GV L-4 and BZR GV L-6, there is a deletion (Table 5) that caused the genomes to lack genes shown by GenAPI. No significant deletions or duplications were identified for the remaining genomes.
Next, we decided to see what processes in the virus these genes are responsible for. However, the functional annotation of genes and their products for CpGV has gaps, some of the genes are labeled as homologous to a gene from another baculovirus. For example, ORF64 is similar to XcGV ORF66, or ORF65 similar to AcMNPV ORF79 [13].
Using InterPro [37], we decided to look at the representation of domains in ORF63-ORF66 proteins but only for ORF65 and ORF66 we managed to find domains similar to the known domains in the database. It turned out that ORF65 is characterized by the GIY-YIG endonuclease domain. The literature shows that the GIY-YIG family of nucleases is involved in processes such as mobile element transfer, DNA recombination—including the GIY-YIG domain being associated with DNA repair—and maintenance of genome stability [38,39]. For example, in Bombyx mori nuclear polyhedrosis virus (BmNPV), the Bm65 (ORF65) protein is a member of the GIY-YIG nuclease superfamily and is a very important protein that repairs UV-induced damage, and the absence of Bm65 results in a virus phenotype that is more sensitive to UV radiation [40]. Bm65 has been shown to be homologous to ORF79 (Ac 79) of Autographa californica multiple nucleopolyhedrovirus (AcMNPV). A study [41] showed that Ac79 (to which ORF65 CpGV is homologous) is required for efficient budded virus production.
The orf66 is known as a pro-apoptotic protein gene ptp-2 [13], which corresponds to a protein-tyrosine phosphatase-like domain defined in InterPro that may be involved in post-translational modification. In BmNPV, the ptp-2 gene is known to increase viral transmission [42].
We also found information in the literature that orf63 bro is homologous to ORFs of the baculovirus repeat (bro). The bro genes represent a multigenic family in baculoviruses and are thought to have an important function in gene transcription and genome replication [13]. In [43], the orf64 gene was identified as homologous to ORFs crle59 and phop56, the functions of which have not been reported.

2.5.5. Analysis of the Gene pe38 CpGV

The pe38 gene has previously been shown to be essential for CpGV infectivity and to be a key factor in overcoming resistance to CpGV in the codling moth [44]. Gebhardt et al. found a mutation that represents a 24-nucleotide repeat in pe38, which leads to a mutation in the protein in the form of an 8-amino-acid repeat. This repeat is present in the CpGv-M reference genome and its presence is associated with type I resistance. We decided to analyze pe38 for the presence of such repeats in our genomes.
From the 18 genomes of BZR GV and “Madex Twin”, as well as from the reference genome with this insertion, we selected pe38 gene sequences and performed multiple MAFFT alignment. The alignment showed for the BZR GV genomes L-4, L-5, L-6, and L-8, there was an absence of this repeat. In all other genomes, the repeat is present in the same size as in the reference (Figure 6).
Additionally, for BZR GV L-4, L-5, L-6, and L-8 genomes, the AGCAGCAGCAGTTCGAGCAGCAGGAGA insertion and four SNPs relative to the reference are present in pe38.

2.6. Classification of BZR GV L-4, BZR GV L-5, BZR GV L-6, and BZR GV L-8 into Genomic Groups

Previously, a description of the genetic diversity of CpGV has been proposed in the literature as a division into genomes of four types, A, B, C, and D, with the C genome being the ancestral form and characterized by the absence of the later acquired orf63-orf66 genes observed in the A, B, and D genomes [46]. More recent articles have proposed a division into seven groups—A, B, C, D, E, F, and G—and three types of resistance [47,48,49]. CpGV strains belonging to genotype C are also known to have reduced virulence against viruses compared with genomes of other types [46].
We decided to look at how genomes with complete orf63-orf66 genes or with no repeats in the pe-38 gene are arranged by genomic groups. Phylogenetic analysis is based on complete assemblies of CpGV-M, -I12, -S, -E2, -I07, -ALE, and -JQ genomes, which have already been assigned to the genomic groups A, B, C, D, E, F, and G, and fragmented assemblies of BZR GV L-4, BZR GV L-5, BZR GV L-6, and BZR GV L-8. The complete Cryptophlebia leucotreta granulovirus (CrleGV) assembly has been used as an outgroup. Figure 7 shows the phylogenetic tree constructed in the MAFFT web service [32] and visualized in Phylo.io [50]. The genomes BZR GV L-4, BZR GV L-5, BZR GV L-6, and BZR GV L-8 are clustered together with the Iranian isolate CpGV-I07, which is of genotype C. CpGV-I07 has also been shown to lack the orf63-orf66 genes in paper [46].

3. Discussion

This paper presents the results of genome sequencing, assembly, and comparative genomic analysis of 16 CpGV strains endemic to southern Russia and two strains from Kazakhstan, as well as the strain included in the commercial preparation “Madex Twin”. The genes and protein products involved in the infectious process of virosis have been compared, and synonymous and missense substitution variants have been identified. Average nucleotide identity (ANI) has demonstrated high similarity with other granulovirus genomes of different geographical origins. The analysis of gene repertoire variation has shown that the BZR GV 4, BZR GV 6, and BZR GV L-7 strains are the closest in their gene repertoire to the strain of the commercial formulation “Madex Twin”. Based on the genotype structure of the BZR GV 4, BZR GV 6, and BZR GV L-7 strains and the reference strain, it can be assumed that they will have similar efficacy against the target insect and mechanism of action, which makes them the most promising microbial biocontrol agents [51]. Nevertheless, in the situation where it is known that the population of C. pomonella population is known to have developed resistance to CpGV of genomic group A (in particular, to CpGV-M-based preparations), the strains BZR GV L4, BZR GV L5, BZR GV L6, and BZR GV L8 may be considered as promising, as they carry only one copy of the tandem repeat with the ATGACACAGAGTGG motif in the pe38 gene (as opposed to the three copies characteristic of CpGV-M), which is the signature of CpGV isolates for breaking type I resistance [44,48].
In our study, we have found a viral strain possibly belonging to genotype C (BZR GV L-6), as the orf63-orf66 set is also missing (presumably, genes contained in these loci do not affect virus pathogenicity). However, additional studies are needed to accurately determine whether this genome belongs to genotype C. In terms of the absence of orf63-orf66, the strain of greatest interest is the BZR GV L-4 strain, which could possibly represent a transitional variant between the known C and the rest (A, B, D, E, F, and G) genotypes. While the orf63 and orf64 genes are absent in it, as in the ancestral form, the orf65 and orf66 genes are present, suggesting that the genotype of this strain may be considered as an intermediate in the evolution of CpGV genome types. It should be emphasized that the coevolution of baculovirus strains and host insect immunity is a constant and continuous process that is closely related to the habitat of the latter [52]. Consideration of the frequencies of genotype-specific SNPs and their correlation to resistance types will allow us to identify the most promising virus strains for further study.
It is known from the literature that the use of baculoviruses is possible not only against the target insect but also against closely related species [53,54]. Therefore, the potential of new, previously unknown CpGV strains may be much broader than that of existing cultures, which emphasizes the importance of working with them once again.
In addition to the written above, for the effective use of baculoviruses in the control of phytophagous insects, studies of their compatibility with other bioagents, such as Bacillus thuringiensis or Beauveria bassiana are necessary [55,56]. The combination of insect viruses with chemical pesticides is also important for creating effective integrated defense systems [57].
It should be noted that the use of baculovirus strains is widespread not only in biomethodology but also in medical research. Thus, to obtain proteins of different origins, a vector baculovirus system is used, where an insect host cell acts as a bioreactor. In this safe and effective way, it is possible to obtain the necessary amount of target protein, which will not differ from the natural analog in its properties [58]. In addition, the baculovirus expression system can serve as an additional component of the one-step cloning system necessary for the creation of multigenic expression constructs [59]. A wide range of proteins, including glycoproteins, recombinant viruses, and vaccines obtained in this way can be used for COVID-19 research, which is especially important in the current world situation [60]. Therefore, new cultures of baculovirus strains should be comprehensively studied to unlock their potential in the future.
Thus, this study demonstrates the insecticidal potential of 18 CpGV strains as a basis for the development of bioinsecticides against C. pomonella. The identified similarities/differences in the genetic sequences of the studied samples may be significant in terms of their entomopathogenic activity against the target insect, which requires additional laboratory bioassays using insect populations as well as field trials. It is also necessary to point out some limitations of our study. Although the CpGV genome was sequenced and assembled quite a long time ago [13], the functions of specific genes are still poorly characterized. This includes genes of key importance for the pathogenesis of granulovirus infection and the determination of entomopathogenic properties of specific strains based on the information contained in their genomes. Therefore, in this study, we focused on a number of genes for which there is reliable information on their involvement in pathogenesis, namely genes encoding apoptosis inhibitor (IAP), matrix metalloprotease (MMP), and Chitinase and Cathepsin enzymes. The whole-genome comparisons presented in this work provide a broader picture but do not allow us to judge the underlying mechanisms determining entomopathogenic properties, which require further experimental validation. Further directions of research may be related both to the analysis of the biological efficacy of the presented strains and to the detailed study of the functions of specific CpGV proteins, which are currently poorly characterized. Obtaining new information about this and the integration of knowledge about the course of apple moth granulosis will allow the development of a more systematic approach to the task of biocontrol of this agricultural pest.

4. Materials and Methods

4.1. Virus Samples

Virus samples were obtained from infected Cydia pomonella caterpillars. The caterpillars were collected between 2019 and 2022 in the territories of Kazakhstan and Russia (Krasnodar Krai and Rostov Oblast). The virus strains have shown entomopathogenic properties against the natural population of C. pomonella and laboratory population of Galleria mellonella [61,62].
Each virus sample was stored as an aqueous suspension or wettable powder in the bioresource collection of the Federal Research Center of Biological Plant Protection’s “State Collection of Entomoacariphages and Microorganisms”. In this research, we used the scientific equipment «Technological line for obtaining microbiological plant protection products of a new generation» (https://ckp-rf.ru/catalog/usu/671367/) (accessed on 30 April 2024).
CpGV strains were developed in vitro using G. mellonella by surface inoculation of the diet. Aqueous virus suspensions were obtained by homogenization of infected biomass followed by filtration, centrifugation (Eppendorf 5810 R) at 3000 rpm for 15 min, and resuspension [63,64]. Virus strains were transported in sealed plastic 50 mL tubes.

4.2. DNA Extraction and Sequencing

During the molecular–genetic identification of the CpGV strains under study, total DNA was isolated using the PureLink™ Genomic DNA Mini Kit (Invitrogen, Carlsbad, CA, USA). Ultra-sonic DNA fragmentation was carried out on a Covaris M220 device (Covaris, Woburn, MA, USA) with parameters optimized to obtain a maximum of 300 bp fragments (microTUBE 50 AFA; Duty Factor 10; Peak Power 75 W; Cycles/Burst 200; Duration 90 s). The resulting fragments were purified by adding 1.6 volume of Agencourt AMPure XP (Beckman Coulter, Brea, CA, USA).
Genome library preparation was carried out with 100 mkg of the fragmented DNA using a KAPA Hyper Prep Kit and KAPA Unique Dual-Indexed Adapter Kit according to the manufacturer’s instructions for barcoded libraries. Amplification of libraries was carried out during 9 PCR cycles. The quality and molarity of the resulting libraries were determined using a Bioanalyzer BA2100 with a High Sensitivity DNA Kit (Agilent, Santa Clara, CA, USA). For application, a solution of 18 libraries was prepared in equimolar concentration, the final concentration was 4 nMol. Sequencing of the obtained libraries was carried out on a NextSeq550 device using the NextSeq 550 Mid Output v2 Kit 300 cycles (Illumina, San Diego, CA, USA), with paired-end reads of 2 × 150 bp according to the manufacturer’s protocol with an estimated sequencing volume of 20 million reads per sample.

4.3. Genome Assembly and Annotation

Genome sequencing results were quality checked using the FastQC (v. 0.11.9) program [65] with default settings. Overall, the data quality was satisfactory. Trimming of reads was carried out using the fastp (v. 0.22.0) program [66]. We settled on the following parameters for viral samples: --trim_poly_g, -x, -l 15, -p, -D, and -h, where --trim_poly_g is the minimum length to detect polyG at the end of the read; -x is to enable polyX trimming at the 3’ ends; -l is the option to discard reads with lengths less than 15; -p is to analyze overrepresented sequences; -D is to enable deduplication to exclude duplicated reads/pairs; and -h is to output a report of the work in html format. Trimming of reads allowed overrepresented sequences to be excluded from consideration. In most samples, two GC-composition peaks were present each. We hypothesized that this effect could be due to the presence of host insect DNA.
We filtered for possible contamination of reads with host (Cydia pomonella) sequences by mapping reads to the virus reference genome (NC_002816.1) using the BWA program (v. 0.7.17) [67] with the default settings for paired reeds. Reads mapped to the reference virus genome were selected using Samtools (v. 1.9) [68,69] without considering the quality of mapQ mapping. We proceeded from the assumption that viruses are rapidly variable and the mapQ parameter can be disregarded.
FastQC quality check was performed again. GC-composition of reads corresponded to the theoretical one. Thus, we were convinced of our assumption about the presence of non-viral DNA in the data.
The NC_002816.1 genome [13] from the NCBI RefSeq database was used as a reference genome of the virus. The genome is represented by a ring chromosome and has a size of 123.5 Kb.
Draft assemblies were performed by two assemblers based on de Bruijn graph construction: Spades (v. 3.13.0) [19,20] for de novo assembly and MinYS (v. 1.1) [21] for reference-guided assembly. Spades was used with default settings. Additionally, the following parameters were specified when assembling MinYS virus genomes: -assembly-kmer-size 41, -assembly-abundance-min 4, -min-contig-size 400, and -nb-cores 8, where -assembly-kmer-size refers to the k-mer size used for Minia assembly (built into MinYS), -assembly-abundance-min is the minimum number of k-mer used for assembly, and -min-contig-size is the minimum counting size was used for gap-filling. These numerical parameters were taken from the information provided by the program developers on github (https://github.com/cguyomar/MinYS/blob/master/doc/tutorial.ipynb accessed on 30 April 2024). Other parameters had default values. The Pilon software tool (v. 1.24) [22] was used to reduce the number of erroneous single-nucleotide substitutions and contig gaps for each assembly. The final assembly was assembled using the Gfinisher tool (v. 1.4) [24] with default settings. The primary assembly was the Spades assembly and the secondary assembly was the MinYS assembly. Each of the assemblies was evaluated for quality with the Quast tool (v. 5.2.0) [23].
Genome annotation was performed using Prokka (v. 1.14.6) [25] with standard parameters. The --kingdom parameter responsible for annotation selection was specified as “viruses”. Blastp and blastn from the Blast+ package (version 2.5.0) [70] were used to identify proteins involved in the infection process of virosis and then the genes synthesizing them. The sequences of MMP, IAP, Chitinase, and Cathepsin proteins were downloaded from the UniprotDB database [26]. Multiple alignment was performed using the web version of MAFFT (v. 7) [32] with default settings.

4.4. Comparative Genomic Analysis

For comparative genomic analysis of the studied virus strains, 13 genomes of different CpGV strains of the complete assembly were obtained from the NCBI Virus database (identifiers are given in the Supplementary Materials (Table S6)). Comparison of the obtained genomes with complete virus genome assemblies was performed using FastANI (v. 1.1) [33] to calculate the average nucleotide identity (ANI) across the entire genome without alignment. FastANI was run with the following parameters: --ql, --rl, and --minFrag 35 -output, where -ql is responsible for the list of submitted genomes to be compared, --rl is responsible for the list of genomes we want to compare, and --minFrag means the number of fragments the genome will be split into—the default value is 50. There is also a fragLen parameter, which is responsible for the fragment length (default is 3000). For granulosis viruses, these two parameters were adjusted because the total length of genome sequences is not sufficient for the default parameters. In this case, we left the fragment lengths but reduced their number. The output parameter recorded a text file with genome similarity values. The similarity of genomes was visualized using the gplots library of the R programming language.
The progressiveMauve (v. 2.4.1) [34] whole-genome alignment tool was used to compare with the reference genome for the presence of mutations at the chromosome level and to identify sites of reduced homology. It was used with default settings. GenAPI (v. 1.0) [35] was used with parameters—-p 4, --tree, and –matrix—to compare patterns of gene presence and absence in viral genomes relative to two CpGV granulovirus reference genomes (NC_002816.1 and KM217575). The tool is remarkable in that it can be used even when only fragmented genome assemblies are available. Based on the information about the depth of coverage of the reference genome by reads, CNV analysis was performed using CNVpytor (v. 1.3.1) [36]. In order to use CNVpytor for the CpGV genome (the human genome is the default: hg19 (GRCh37) and hg38 (GRCh38)), we created a GC and mask file following the example of developers on github (https://github.com/abyzovlab/CNVpytor/blob/master/examples/AddReferenceGenome.md accessed on 30 April 2024). After that, we obtained the imported read depth signal from the BAM files obtained by mapping reads to the reference virus genome and predicted CNV regions as described in the developer’s guide on github. We used CNVpytor to confirm the absence of genes listed in GenAPI that arose due to deletions.
For genes that were confirmed by CNVpytor as missing, domains were searched in web-service InterPro [37] to somehow characterize the proteins for possible functions in CpGV.

4.5. Phylogenetic Analysis

To construct the phylogenetic tree, we used complete assemblies of the CpGV-M, -I12, -S, -E2, -I07, -ALE, and -JQ genomes from NCBI Virus (accession numbers are presented in Table S6 of the Supplementary Materials). We also used fragmented genome assemblies of BZR GV L-4, BZR GV L-5, BZR GV L-6, and BZR GV L-8 strains (accession numbers are provided in Table S3 of the Supplementary Materials). Multiple alignments were also performed in the web-service MAFFT (v. 7). For sequence alignment, strains BZR GV L-4, BZR GV L-5, BZR GV L-6, and BZR GV L-8 were reorganized relative to the first ORF in CpGV-M. Genome of the Cryptophlebia leucotreta granulovirus (CrleGV) (NC_005068.1) was used as an outgroup.
The phylogenetic tree was constructed using the Neighbor joining algorithm with the Jukes–Cantor substitution model in the web-service MAFFT (v. 7). Bootstrap support was used. The tree was visualized in the Phylo.io service [50].
The main methods used in this study were described above and the data flow diagram is summarized in the schematic that can be found in the Supplementary Materials (Figure S1).

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms25137146/s1.

Author Contributions

Conceptualization, S.A.L. and A.M.A.; methodology, A.A.T., A.I.K., G.V.V., T.N.L. and S.A.L.; validation, A.A.T., G.V.V. and A.I.K.; formal analysis, T.N.L.; investigation, T.N.L., A.A.T., A.I.K. and G.V.V.; resources, A.A.T., V.Y.I. and G.V.V.; data curation, T.N.L. and A.I.K.; writing—original draft preparation, T.N.L.; writing—review and editing, T.N.L., A.I.K., G.V.V., A.M.A. and S.A.L.; visualization, T.N.L. and A.I.K.; supervision, S.A.L. and A.M.A.; project administration, A.M.A.; funding acquisition, A.M.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Russian Science Foundation, grant number No 23-16-00260, https://rscf.ru/en/project/23-16-00260/ (accessed on 30 April 2024).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Genome assemblies and annotations have been submitted at NCBI. The accession numbers are listed in the Supplementary Materials (Table S3).

Acknowledgments

Genome assembly was performed using computational resources of the “Bioinformatics” Joint Computational Center supported by the budget project No FWNR-2022-0020.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Koller, J.; Sutter, L.; Gonthier, J.; Collatz, J.; Norgrove, L. Entomopathogens and Parasitoids Allied in Biocontrol: A Systematic Review. Pathogens 2023, 12, 957. [Google Scholar] [CrossRef] [PubMed]
  2. Mishra, J.; Tewari, S.; Singh, S.; Arora, N.K. Biopesticides: Where We Stand? In Plant Microbes Symbiosis: Applied Facets; Springer: New Delhi, India, 2015; pp. 37–75. [Google Scholar]
  3. Bale, J.; van Lenteren, J.; Bigler, F. Biological Control and Sustainable Food Production. Philos. Trans. R. Soc. B Biol. Sci. 2008, 363, 761–776. [Google Scholar] [CrossRef] [PubMed]
  4. Dolzhenko, T.V.; Dolzhenko, V.I. Insecticides Based on Entomopathogenic Viruses. Agrochemistry 2017, 4, 26–33. (In Russian) [Google Scholar]
  5. Haase, S.; Sciocco-Cap, A.; Romanowski, V. Baculovirus Insecticides in Latin America: Historical Overview, Current Status and Future Perspectives. Viruses 2015, 7, 2230–2267. [Google Scholar] [CrossRef] [PubMed]
  6. Jornal Andermatt Biocontrol Suisse: Punctum. Available online: https://www.biocontrol.ch/ABCS/Dokumente/Punctum/Punctum-Journal-Andermatt-Biocontrol-Suisse_2023_DE.pdf (accessed on 30 April 2024).
  7. Lacey, L.A.; Thomson, D.; Vincent, C.; Arthurs, S.P. Codling Moth Granulovirus: A Comprehensive Review. Biocontrol Sci. Technol. 2008, 18, 639–663. [Google Scholar] [CrossRef]
  8. Explained. Eurostat Statistics: Agricultural Production—Orchards. Available online: https://ec.europa.eu/eurostat/statistics-explained/index.php?title=Agricultural_production_-_orchards#Apple_trees (accessed on 30 April 2024).
  9. Time for Apples from Europe: Sector. Available online: https://applesfromeurope.eu/sector/ (accessed on 30 April 2024).
  10. ProBusiness72: Apple Market in Russia and the World. Available online: https://www.pbs72.ru/articles/mneniya/rynok-yablok-v-rossii-i-mire/ (accessed on 10 April 2024). (In Russian).
  11. Agroinvestor. Analytics: Margin in Intensive Orchards. Profitability of the Direction Reaches up to 250%. Available online: https://www.agroinvestor.ru/analytics/article/29589-marzha-v-intensivnom-sadu/ (accessed on 10 April 2024). (In Russian).
  12. NIA-Kuban. Economy: In Krasnodar Region Increased the Number of Gardens. Available online: https://www.23rus.org/news/economy/41482.html (accessed on 10 April 2024). (In Russian).
  13. Luque, T.; Finch, R.; Crook, N.; O’Reilly, D.R.; Winstanley, D. The Complete Sequence of the Cydia pomonella Granulovirus Genome. J. Gen. Virol. 2001, 82, 2531–2547. [Google Scholar] [CrossRef]
  14. Sauer, A.J.; Fritsch, E.; Undorf-Spahn, K.; Nguyen, P.; Marec, F.; Heckel, D.G.; Jehle, J.A. Novel Resistance to Cydia pomonella Granulovirus (CpGV) in Codling Moth Shows Autosomal and Dominant Inheritance and Confers Cross-Resistance to Different CpGV Genome Groups. PLoS ONE 2017, 12, e0179157. [Google Scholar] [CrossRef]
  15. Fan, J.; Wennmann, J.; Jehle, J. Partial Loss of Inheritable Type I Resistance of Codling Moth to Cydia pomonella Granulovirus. Viruses 2019, 11, 570. [Google Scholar] [CrossRef] [PubMed]
  16. Asser-Kaiser, S.; Fritsch, E.; Undorf-Spahn, K.; Kienzle, J.; Eberle, K.E.; Gund, N.A.; Reineke, A.; Zebitz, C.P.W.; Heckel, D.G.; Huber, J.; et al. Rapid Emergence of Baculovirus Resistance in Codling Moth Due to Dominant, Sex-Linked Inheritance. Science 2007, 317, 1916–1918. [Google Scholar] [CrossRef] [PubMed]
  17. Zichová, T.; Stará, J.; Kundu, J.K.; Eberle, K.E.; Jehle, J.A. Resistance to Cydia pomonella Granulovirus Follows a Geographically Widely Distributed Inheritance Type within Europe. BioControl 2013, 58, 525–534. [Google Scholar] [CrossRef]
  18. Lander, E.S.; Waterman, M.S. Genomic Mapping by Random Fingerprinting Clones: A Mathematical Analysis. Genomics 1998, 2, 231–239. [Google Scholar] [CrossRef]
  19. Prjibelski, A.; Antipov, D.; Meleshko, D.; Lapidus, A.; Korobeynikov, A. Using SPAdes De Novo Assembler. Curr. Protoc. Bioinforma. 2020, 70, e102. [Google Scholar] [CrossRef]
  20. Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [PubMed]
  21. Guyomar, C.; Delage, W.; Legeai, F.; Mougel, C.; Simon, J.-C.; Lemaitre, C. MinYS: Mine Your Symbiont by Targeted Genome Assembly in Symbiotic Communities. NAR Genom. Bioinform. 2020, 2, lqaa047. [Google Scholar] [CrossRef] [PubMed]
  22. Walker, B.J.; Abeel, T.; Shea, T.; Priest, M.; Abouelliel, A.; Sakthikumar, S.; Cuomo, C.A.; Zeng, Q.; Wortman, J.; Young, S.K.; et al. Pilon: An Integrated Tool for Comprehensive Microbial Variant Detection and Genome Assembly Improvement. PLoS ONE 2014, 9, e112963. [Google Scholar] [CrossRef]
  23. Gurevich, A.; Saveliev, V.; Vyahhi, N.; Tesler, G. QUAST: Quality Assessment Tool for Genome Assemblies. Bioinformatics 2013, 29, 1072–1075. [Google Scholar] [CrossRef]
  24. Guizelini, D.; Raittz, R.T.; Cruz, L.M.; Souza, E.M.; Steffens, M.B.R.; Pedrosa, F.O. GFinisher: A New Strategy to Refine and Finish Bacterial Genome Assemblies. Sci. Rep. 2016, 6, 34963. [Google Scholar] [CrossRef] [PubMed]
  25. Seemann, T. Prokka: Rapid Prokaryotic Genome Annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef]
  26. Bateman, A.; Martin, M.J.; Orchard, S.; Magrane, M.; Agivetova, R.; Ahmad, S.; Alpi, E.; Bowler-Barnett, E.H.; Britto, R.; Bursteinas, B.; et al. UniProt: The Universal Protein Knowledgebase in 2021. Nucleic Acids Res. 2021, 49, D480–D489. [Google Scholar] [CrossRef]
  27. Crook, N.E.; Clem, R.J.; Miller, L.K. An Apoptosis-Inhibiting Baculovirus Gene with a Zinc Finger-like Motif. J. Virol. 1993, 67, 2168–2174. [Google Scholar] [CrossRef]
  28. Miller, D.P.; Luque, T.; Crook, N.E.; Winstanley, D.; O’Reilly, D.R. Expression of the Cydia pomonella Granulovirus Iap3 Gene. Arch. Virol. 2002, 147, 1221–1236. [Google Scholar] [CrossRef]
  29. Ishimwe, E.; Hodgson, J.J.; Passarelli, A.L. Expression of the Cydia pomonella Granulovirus Matrix Metalloprotease Enhances Autographa Californica Multiple Nucleopolyhedrovirus Virulence and Can Partially Substitute for Viral Cathepsin. Virology 2015, 481, 166–178. [Google Scholar] [CrossRef]
  30. Daimon, T.; Katsuma, S.; Kang, W.K.; Shimada, T. Functional Characterization of Chitinase from Cydia pomonella Granulovirus. Arch. Virol. 2007, 152, 1655–1664. [Google Scholar] [CrossRef]
  31. Tristem, M.; O’Reilly, D.R.; Crook, N.E.; Maeda, S.; Kang, W. Identification and Characterization of the Cydia pomonella Granulovirus Cathepsin and Chitinase Genes. J. Gen. Virol. 1998, 79, 2283–2292. [Google Scholar] [CrossRef]
  32. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT Online Service: Multiple Sequence Alignment, Interactive Sequence Choice and Visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef]
  33. Jain, C.; Rodriguez-R, L.M.; Phillippy, A.M.; Konstantinidis, K.T.; Aluru, S. High Throughput ANI Analysis of 90K Prokaryotic Genomes Reveals Clear Species Boundaries. Nat. Commun. 2018, 9, 5114. [Google Scholar] [CrossRef]
  34. Darling, A.E.; Mau, B.; Perna, N.T. ProgressiveMauve: Multiple Genome Alignment with Gene Gain, Loss and Rearrangement. PLoS ONE 2010, 5, e11147. [Google Scholar] [CrossRef]
  35. Gabrielaite, M.; Marvig, R.L. GenAPI: A Tool for Gene Absence-Presence Identification in Fragmented Bacterial Genome Sequences. BMC Bioinform. 2020, 21, 320. [Google Scholar] [CrossRef]
  36. Suvakov, M.; Panda, A.; Diesh, C.; Holmes, I.; Abyzov, A. CNVpytor: A Tool for Copy Number Variation Detection and Analysis from Read Depth and Allele Imbalance in Whole-Genome Sequencing. Gigascience 2021, 10, giab074. [Google Scholar] [CrossRef]
  37. Paysan-Lafosse, T.; Blum, M.; Chuguransky, S.; Grego, T.; Pinto, B.L.; Salazar, G.A.; Bileschi, M.L.; Bork, P.; Bridge, A.; Colwell, L.; et al. InterPro in 2022. Nucleic Acids Res. 2023, 51, D418–D427. [Google Scholar] [CrossRef]
  38. Aravind, L. Conserved Domains in DNA Repair Proteins and Evolution of Repair Systems. Nucleic Acids Res. 1999, 27, 1223–1242. [Google Scholar] [CrossRef]
  39. Dunin-Horkawicz, S.; Feder, M.; Bujnicki, J.M. Phylogenomic Analysis of the GIY-YIG Nuclease Superfamily. BMC Genom. 2006, 7, 98. [Google Scholar] [CrossRef]
  40. Tang, Q.; Liu, Y.; Tang, J.; Chen, F.; Qi, X.; Zhu, F.; Yu, Q.; Chen, H.; Wu, P.; Chen, L.; et al. BmNPV Orf 65 (Bm65) Is Identified as an Endonuclease Directly Facilitating UV-Induced DNA Damage Repair. J. Virol. 2022, 96, e00557-22. [Google Scholar] [CrossRef]
  41. Wu, W.; Passarelli, A.L. The Autographa Californica M Nucleopolyhedrovirus Ac79 Gene Encodes an Early Gene Product with Structural Similarities to UvrC and Intron-Encoded Endonucleases That Is Required for Efficient Budded Virus Production. J. Virol. 2012, 86, 5614–5625. [Google Scholar] [CrossRef]
  42. Kamita, S.G.; Nagasaka, K.; Chua, J.W.; Shimada, T.; Mita, K.; Kobayashi, M.; Maeda, S.; Hammock, B.D. A Baculovirus-Encoded Protein Tyrosine Phosphatase Gene Induces Enhanced Locomotory Activity in a Lepidopteran Host. Proc. Natl. Acad. Sci. USA 2005, 102, 2584–2589. [Google Scholar] [CrossRef]
  43. Lange, M.; Jehle, J.A. The Genome of the Cryptophlebia Leucotreta Granulovirus. Virology 2003, 317, 220–236. [Google Scholar] [CrossRef]
  44. Gebhardt, M.M.; Eberle, K.E.; Radtke, P.; Jehle, J.A. Baculovirus Resistance in Codling Moth Is Virus Isolate-Dependent and the Consequence of a Mutation in Viral Gene Pe38. Proc. Natl. Acad. Sci. USA 2014, 111, 15711–15716. [Google Scholar] [CrossRef]
  45. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  46. Eberle, K.E.; Sayed, S.; Rezapanah, M.; Shojai-Estabragh, S.; Jehle, J.A. Diversity and Evolution of the Cydia pomonella Granulovirus. J. Gen. Virol. 2009, 90, 662–671. [Google Scholar] [CrossRef]
  47. Fan, J.; Wennmann, J.T.; Wang, D.; Jehle, J.A. Single Nucleotide Polymorphism (SNP) Frequencies and Distribution Reveal Complex Genetic Composition of Seven Novel Natural Isolates of Cydia pomonella Granulovirus. Virology 2020, 541, 32–40. [Google Scholar] [CrossRef]
  48. Alletti, G.G.; Sauer, A.J.; Weihrauch, B.; Fritsch, E.; Undorf-Spahn, K.; Wennmann, J.T.; Jehle, J.A. Using next Generation Sequencing to Identify and Quantify the Genetic Composition of Resistance- Breaking Commercial Isolates of Cydia pomonella Granulovirus. Viruses 2017, 9, 250. [Google Scholar] [CrossRef]
  49. Wennmann, J.; Radtke, P.; Eberle, K.; Gueli Alletti, G.; Jehle, J. Deciphering Single Nucleotide Polymorphisms and Evolutionary Trends in Isolates of the Cydia pomonella Granulovirus. Viruses 2017, 9, 227. [Google Scholar] [CrossRef]
  50. Robinson, O.; Dylus, D.; Dessimoz, C. Phylo.Io: Interactive Viewing and Comparison of Large Phylogenetic Trees on the Web. Mol. Biol. Evol. 2016, 33, 2163–2166. [Google Scholar] [CrossRef]
  51. Nikhil Raj, M.; Samal, I.; Paschapur, A.; Subbanna, A.R.N.S. Entomopathogenic Viruses and Their Potential Role in Sustainable Pest Management. In New and Future Developments in Microbial Biotechnology and Bioengineering; Elsevier: Amsterdam, The Netherlands, 2022; pp. 47–72. [Google Scholar]
  52. Thézé, J.; Lopez-Vaamonde, C.; Cory, J.; Herniou, E. Biodiversity, Evolution and Ecological Specialization of Baculoviruses: A Treasure Trove for Future Applied Research. Viruses 2018, 10, 366. [Google Scholar] [CrossRef]
  53. Goto, C.; Mukawa, S.; Mitsunaga, T. Two Year Field Study to Evaluate the Efficacy of Mamestra Brassicae Nucleopolyhedrovirus Combined with Proteins Derived from Xestia C-Nigrum Granulovirus. Viruses 2015, 7, 1062–1078. [Google Scholar] [CrossRef]
  54. Black, J.L.; Lorenz, G.M.; Cato, A.J.; Bateman, N.R.; Seiter, N.J. Efficacy of Helicoverpa Armigera Nucleopolyhedrovirus on Soybean for Control of Helicoverpa Zea (Boddie) (Lepidoptera: Noctuidae) in Arkansas Agriculture. Insects 2022, 13, 91. [Google Scholar] [CrossRef]
  55. Semenova, T.A.; Dunaevsky, Y.E.; Beljakova, G.A.; Belozersky, M.A. Extracellular Peptidases of Insect-Associated Fungi and Their Possible Use in Biological Control Programs and as Pathogenicity Markers. Fungal Biol. 2020, 124, 65–72. [Google Scholar] [CrossRef]
  56. Boncheva, R.; Dukiandjiev, S.; Minkov, I.; de Maagd, R.A.; Naimov, S. Activity of Bacillus Thuringiensis δ-Endotoxins against Codling Moth (Cydia pomonella L.) Larvae. J. Invertebr. Pathol. 2006, 92, 96–99. [Google Scholar] [CrossRef]
  57. Patel, P.; Sisodiya, D.; Raghunandan, B.; Patel, N.; Gohel, V.; Chavada, K. Bio-Efficacy of Entomopathogenic Fungi and Bacteria against Invasive Pest Spodoptera Frugiperda (J.E. Smith) under Laboratory Condition. J. Entomol. Zool. Stud. 2020, 8, 716–720. [Google Scholar]
  58. Khasanov, S.; Sasmakov, S.; Abdurakhmanov, Z.; Ashirov, O.; Asimova, S. Bakulovirus Expression System as a Safe and Effective System for Obtaining Recombinant Proteins. Universum Chem. Biol. 2019, 6, 13–16. (In Russian) [Google Scholar]
  59. Neuhold, J.; Radakovics, K.; Lehner, A.; Weissmann, F.; Garcia, M.Q.; Romero, M.C.; Berrow, N.S.; Stolt-Bergner, P. GoldenBac: A Simple, Highly Efficient, and Widely Applicable System for Construction of Multi-Gene Expression Vectors for Use with the Baculovirus Expression Vector System. BMC Biotechnol. 2020, 20, 26. [Google Scholar] [CrossRef]
  60. Azali, M.A.; Mohamed, S.; Harun, A.; Hussain, F.A.; Shamsuddin, S.; Johan, M.F. Application of Baculovirus Expression Vector System (BEV) for COVID-19 Diagnostics and Therapeutics: A Review. J. Genet. Eng. Biotechnol. 2022, 20, 98. [Google Scholar] [CrossRef] [PubMed]
  61. Tsygichko, A.A.; Asaturova, A.M. Screening of New Strains of Granulosa Virus against the Large Wax Moth Galleria Mellonella. Achiev. Sci. Technol. Agric. 2022, 36, 14–21. (In Russian) [Google Scholar]
  62. Tsygichko, A.A.; Asaturova, A.M.; Lobanov, A.G.; Yu, K.A. Assessment of Entomopathogenic Activity of Granulosa Virus in Relation to Apple Moth. Achiev. Sci. Technol. Agric. 2023, 37, 34–38. (In Russian) [Google Scholar]
  63. Wan, N.-F.; Jiang, J.-X.; Li, B. Effect of Host Plants on the Infectivity of Nucleopolyhedrovirus to Spodoptera Exigua Larvae. J. Appl. Entomol. 2016, 140, 636–644. [Google Scholar] [CrossRef]
  64. Berling, M.; Blachere-Lopez, C.; Soubabere, O.; Lery, X.; Bonhomme, A.; Sauphanor, B.; Lopez-Ferber, M. Cydia pomonella Granulovirus Genotypes Overcome Virus Resistance in the Codling Moth and Improve Virus Efficiency by Selection against Resistant Hosts. Appl. Environ. Microbiol. 2009, 75, 925–930. [Google Scholar] [CrossRef]
  65. FastQC: A Quality Control Tool for High Throughput Sequence Data. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 10 April 2024).
  66. Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An Ultra-Fast All-in-One FASTQ Preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
  67. Li, H. Aligning Sequence Reads, Clone Sequences and Assembly Contigs with BWA-MEM. arXiv 2013, arXiv:1303.3997. [Google Scholar]
  68. Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M.; et al. Twelve Years of SAMtools and BCFtools. Gigascience 2021, 10, giab008. [Google Scholar] [CrossRef]
  69. Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
  70. Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and Applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef] [PubMed]
Ijms 25 07146 g001
Figure 1. Schematic arrangement of genes involved in the infection process in C. pomonella in the CpGV genome: (a) the mmp gene is located downstream relative to the chiA gene on the lagging DNA strand; (b) the mmp gene is located upstream relative to the chiA gene on the lagging DNA strand.
Figure 1. Schematic arrangement of genes involved in the infection process in C. pomonella in the CpGV genome: (a) the mmp gene is located downstream relative to the chiA gene on the lagging DNA strand; (b) the mmp gene is located upstream relative to the chiA gene on the lagging DNA strand.
Ijms 25 07146 g001
Ijms 25 07146 g002
Figure 2. Distribution of the total number of nonsynonymous substitutions in proteins for each CpGV strain, where X-axis shows virus strains, Y-axis shows the number of amino acid substitutions in the corresponding protein. Color-coding by proteins: blue—Chitinase, orange—IAP, gray—MMP, and yellow—Cathepsin.
Figure 2. Distribution of the total number of nonsynonymous substitutions in proteins for each CpGV strain, where X-axis shows virus strains, Y-axis shows the number of amino acid substitutions in the corresponding protein. Color-coding by proteins: blue—Chitinase, orange—IAP, gray—MMP, and yellow—Cathepsin.
Ijms 25 07146 g002
Ijms 25 07146 g003
Figure 3. The heatmap of similarity between genomes based on fastANI result, where genome identifiers from NCBI Virus database are marked at the bottom, and identifiers of the studied genomes are marked at the right side. The color scale is set: light blue to blue—(99, 99.4], blue to green—(99.4, 99.8], green to yellow—(99.8, 99.90] and yellow to orange—(99.90, 100]. These interval values were chosen based on the ANI values obtained.
Figure 3. The heatmap of similarity between genomes based on fastANI result, where genome identifiers from NCBI Virus database are marked at the bottom, and identifiers of the studied genomes are marked at the right side. The color scale is set: light blue to blue—(99, 99.4], blue to green—(99.4, 99.8], green to yellow—(99.8, 99.90] and yellow to orange—(99.90, 100]. These interval values were chosen based on the ANI values obtained.
Ijms 25 07146 g003
Ijms 25 07146 g004
Figure 4. The result of the whole-genome alignment, where colored blocks indicate the height of the similarity profile of the corresponding regions of the genome. The height of the similarity profile corresponds to the average level of conservation in a given genomic sequence region. That is, “dips” in the sequences mean low similarity of this region with respect to the rest of the genome [34]. The first color line shows the reference, from the second to the last—BZR GV 1, BZR GV 2, BZR GV 3, BZR GV 4, BZR GV 5, BZR GV 6, BZR GV 7, BZR GV L-8, BZR GV 9, BZR GV 10, BZR GV 12, BZR GV 13, BZR GV L-2, BZR GV L-4, BZR GV L-5, BZR GV L-6, BZR GV L-7, BZR GV L-8, Madex Twin, respectively. CDS are shown as white boxes under each genome.
Figure 4. The result of the whole-genome alignment, where colored blocks indicate the height of the similarity profile of the corresponding regions of the genome. The height of the similarity profile corresponds to the average level of conservation in a given genomic sequence region. That is, “dips” in the sequences mean low similarity of this region with respect to the rest of the genome [34]. The first color line shows the reference, from the second to the last—BZR GV 1, BZR GV 2, BZR GV 3, BZR GV 4, BZR GV 5, BZR GV 6, BZR GV 7, BZR GV L-8, BZR GV 9, BZR GV 10, BZR GV 12, BZR GV 13, BZR GV L-2, BZR GV L-4, BZR GV L-5, BZR GV L-6, BZR GV L-7, BZR GV L-8, Madex Twin, respectively. CDS are shown as white boxes under each genome.
Ijms 25 07146 g004
Ijms 25 07146 g005
Figure 5. The heatmap of the representation of the gene repertoire of the studied viruses relative to technical and biological references; color indicates gene presence/absence (purple—presence in genomes, yellow—absence in genomes): (a) genes across all studied genomes and two references; (b) portions of genes across all studied genomes and two references.
Figure 5. The heatmap of the representation of the gene repertoire of the studied viruses relative to technical and biological references; color indicates gene presence/absence (purple—presence in genomes, yellow—absence in genomes): (a) genes across all studied genomes and two references; (b) portions of genes across all studied genomes and two references.
Ijms 25 07146 g005
Ijms 25 07146 g006
Figure 6. Part of a multiple alignment related to the repeat in the pe38 gene that results in a DTVD repeat in the PE-38 protein. The nucleotide sequence is shown, with the repeats highlighted in black rectangles. For the BZR GV L-4, BZR GV L-5, BZR GV L-6, and BZR GV L-8 genomes, the absence of repeats is shown with dashed lines on a white background. Multiple alignments are visualized in MEGA 11 [45].
Figure 6. Part of a multiple alignment related to the repeat in the pe38 gene that results in a DTVD repeat in the PE-38 protein. The nucleotide sequence is shown, with the repeats highlighted in black rectangles. For the BZR GV L-4, BZR GV L-5, BZR GV L-6, and BZR GV L-8 genomes, the absence of repeats is shown with dashed lines on a white background. Multiple alignments are visualized in MEGA 11 [45].
Ijms 25 07146 g006
Ijms 25 07146 g007
Figure 7. Phylogenetic analysis of twelve CpGV isolates based on nucleotide sequence alignment of whole genomes. The genomic sequence of CrleGV was selected as an outgroup. A total of 500 bootstrap replicates were used. The Jukes–Cantor substitution model was chosen. CpGV genome groups A–G are shown on the right. BZR GV genomes are highlighted in light green color.
Figure 7. Phylogenetic analysis of twelve CpGV isolates based on nucleotide sequence alignment of whole genomes. The genomic sequence of CrleGV was selected as an outgroup. A total of 500 bootstrap replicates were used. The Jukes–Cantor substitution model was chosen. CpGV genome groups A–G are shown on the right. BZR GV genomes are highlighted in light green color.
Ijms 25 07146 g007
Table 1. Characterization of the final CpGV genome assemblies resulting from improvement of the Spades and MinYS draft assemblies using Pilon and GFinisher tools.
Table 1. Characterization of the final CpGV genome assemblies resulting from improvement of the Spades and MinYS draft assemblies using Pilon and GFinisher tools.
StrainTotal Length (bp)Largest Contig
(bp)		Number of ContigsGC Content (%)Genome Fraction (%)Duplication RatioMisassembliesMismatchesIndelsIndels Length, (bp)
NC_002816.1123,500123,500145.2710010000
BZR GV 1123,848121,196445.2399.7950.999012383495
BZR GV 2133,67833,1162845.2599.4981.047020487588
BZR GV 3122,997122,997145.2399.4990.999012683495
BZR GV 4123,038122,952245.2599.517108278212
BZR GV 5129,21892,474445.0699.7941.0460168102635
BZR GV 6123,19197,631645.2699.499101868168
BZR GV 7123,363121,196245.2399.7950.999012483495
BZR GV 8123,369121,195245.2399.7950.999012483495
BZR GV 9123,364121,196245.2399.7950.999012483495
BZR GV 10123,36269,475345.2399.7940.999012483495
BZR GV 12122,999122,999445.2399.4990.999013784496
BZR GV 13122,929122,843245.2499.5170.999011881457
BZR GV L-2123,126123,004245.2399.4990.999012683495
BZR GV L-4122,210121,216445.4298.5720.99305031691268
BZR GV L-5126,44287,241345.2999.7921.02505251711284
BZR GV L-6120,194120,194145.4497.8050.99315031671266
BZR GV L-7122,862122,776245.2599.5170.99809579388
BZR GV L-8124,273123,670445.2499.7921.00105021681281
Madex Twin123,542123,071445.2799.691101567166
Table 2. Characteristics of genome annotations. The ‘predicted proteins’ column indicates the fraction of predicted proteins, with the remainder annotated as ‘hypothetical proteins’.
Table 2. Characteristics of genome annotations. The ‘predicted proteins’ column indicates the fraction of predicted proteins, with the remainder annotated as ‘hypothetical proteins’.
StrainTotal Length of Assembly (bp)CDSPredicted Proteins
(%)
BZR GV 1123,84813823.9
BZR GV 2133,67814823
BZR GV 3122,99713624.3
BZR GV 4123,03813324.8
BZR GV 5129,21814524.1
BZR GV 6123,19113125.2
BZR GV 7123,36313724.1
BZR GV 8123,36913724.1
BZR GV 9123,36413724.1
BZR GV 10123,36213724.1
BZR GV 12130,80414124.8
BZR GV 13122,92913624.3
BZR GV L-2123,12613624.3
BZR GV L-4122,21012825
BZR GV L-5126,44213424.6
BZR GV L-6120,19412526.4
BZR GV L-7122,86213524.4
BZR GV L-8124,27313424.6
NC_002816.1123,500143
Table 3. Information on NC_002816.1 proteins involved in the infection process, where ID is the protein identifier in the UniprotDB database [26].
Table 3. Information on NC_002816.1 proteins involved in the infection process, where ID is the protein identifier in the UniprotDB database [26].
IDProtein NameLength (aa)FunctionLink to the Study
P41436IAP275apoptosis inhibitor, involved in the realization of cell apoptosis[27,28]
Q91F09MMP (matrix metalloprotease)545family of zinc-dependent endopeptidases that degrade extracellular matrix proteins[29]
O91466Сhitinase594an enzyme that causes the breakdown of the insect’s chitinous covering[30,31]
O91465Cathepsin333a protein involved in the degradation of internal larval tissues[31]
Table 4. The list of genes whose presence differed between the virus strains tested and their products.
Table 4. The list of genes whose presence differed between the virus strains tested and their products.
NoGene NameProduct NameCorresponding Gene Identifiers in Figure 5b
1orf6ORF6gene-CpGVgp006::NC_002816.1:3122-3340
2orf63ORF63gene-orf63:: KM217575.1:51774-51941
3orf62ORF62gene-orf62:: KM217575.1:51067-51636
4orf27ORF27gene-orf27::KM217575.1:20358-21827
5IFEMGEHL_00128hypothetical proteinIFEMGEHL_00128_gene::id=4:120631-120807
6BJOIBEHA_00120hypothetical proteinBJOIBEHA_00120_gene::id=3:53961-54164
7BJOIBEHA_00041hypothetical proteinBJOIBENA_00041_gene::id=2:33044-33265
8BJOIBEHA_00040hypothetical proteinBJOIBEHA_00040_gene::id=2:32650-32889
9BJOIBEHA_00039hypothetical proteinBJOIBEHA_00039_gene::id=2:31860-32552
10BJOIBEHA_00037hypothetical proteinBJOIBEHA_00037_gene::id=2:31118-31273
Table 5. Comparative analysis for missing genes due to deletions. “+” sign means that a gene is absent, “–“ sign means that a gene is present (according to GenAPI and Mauve analyses).
Table 5. Comparative analysis for missing genes due to deletions. “+” sign means that a gene is absent, “–“ sign means that a gene is present (according to GenAPI and Mauve analyses).
StrainCNV TypeCNV RegionCNV SizeList of Genes in the CNV RegionGenAPI AbsenceMauve Absence
BZR GV L-4deletionNC_002816.1:51701-541002400orf63 bro++
orf64++
orf65−−
orf66−−
BZR GV L-6deletionNC_002816.1:51701-541002400orf63 bro++
orf64++
orf65++
orf66++
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lakhova, T.N.; Tsygichko, A.A.; Klimenko, A.I.; Ismailov, V.Y.; Vasiliev, G.V.; Asaturova, A.M.; Lashin, S.A. Assembly and Genome Annotation of Different Strains of Apple Fruit Moth Virus (Cydia pomonella granulovirus). Int. J. Mol. Sci. 2024, 25, 7146. https://doi.org/10.3390/ijms25137146

AMA Style

Lakhova TN, Tsygichko AA, Klimenko AI, Ismailov VY, Vasiliev GV, Asaturova AM, Lashin SA. Assembly and Genome Annotation of Different Strains of Apple Fruit Moth Virus (Cydia pomonella granulovirus). International Journal of Molecular Sciences. 2024; 25(13):7146. https://doi.org/10.3390/ijms25137146

Chicago/Turabian Style

Lakhova, Tatiana N., Aleksandra A. Tsygichko, Alexandra I. Klimenko, Vladimir Y. Ismailov, Gennady V. Vasiliev, Anzhela M. Asaturova, and Sergey A. Lashin. 2024. "Assembly and Genome Annotation of Different Strains of Apple Fruit Moth Virus (Cydia pomonella granulovirus)" International Journal of Molecular Sciences 25, no. 13: 7146. https://doi.org/10.3390/ijms25137146

APA Style

Lakhova, T. N., Tsygichko, A. A., Klimenko, A. I., Ismailov, V. Y., Vasiliev, G. V., Asaturova, A. M., & Lashin, S. A. (2024). Assembly and Genome Annotation of Different Strains of Apple Fruit Moth Virus (Cydia pomonella granulovirus). International Journal of Molecular Sciences, 25(13), 7146. https://doi.org/10.3390/ijms25137146

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop