Next Article in Journal
Massive Bird Nest Losses: A Neglected Threat for Passerine Birds in Atlantic Forest Fragments from the Pernambuco Endemism Center
Previous Article in Journal
Ecological Traits and Socio-Economic Impacts of the Alien Invader Weed Parthenium hysterophorus L. in South Africa’s Rangeland Ecosystems: A Review
Previous Article in Special Issue
Genetic Variation among Aeluropus lagopoides Populations Growing in Different Saline Regions
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 16
Issue 4
10.3390/d16040206
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Joint Identification and Application of Microsatellite Markers in Genetic Diversity Study of Closely Related Species Teucrium montanum, T. capitatum and Their Natural Hybrid

by
Filip Varga
1,2,
Zlatko Liber
1,3,*,
Ante Turudić
1,
Jernej Jakše
4,
Lea Juzbašić
3,
Nina Jeran
2,
Martina Grdiša
1,2,
Miloš Zbiljić
5 and
Zlatko Šatović
1,2
1
Centre of Excellence for Biodiversity and Molecular Plant Breeding (CoE CroP-BioDiv), Svetošimunska Cesta 25, 10000 Zagreb, Croatia
2
Faculty of Agriculture, University of Zagreb, Svetošimunska Cesta 25, 10000 Zagreb, Croatia
3
Faculty of Science, University of Zagreb, Marulićev Trg 9a, 10000 Zagreb, Croatia
4
Biotechnical Faculty, University of Ljubljana, Jamnikarjeva 101, 1000 Ljubljana, Slovenia
5
Department of Botany, Faculty of Pharmacy, University of Belgrade, Vojvode Stepe 450, 11060 Belgrade, Serbia
*
Author to whom correspondence should be addressed.
Diversity 2024, 16(4), 206; https://doi.org/10.3390/d16040206
Submission received: 10 March 2024 / Revised: 26 March 2024 / Accepted: 27 March 2024 / Published: 28 March 2024
(This article belongs to the Special Issue Population Genetics of Animals and Plants)
Browse Figures
Versions Notes

Abstract

:
Teucrium montanum L. and T. capitatum L. are two plant species with overlapping distribution in the Balkan Peninsula, especially in Croatia, where several occurrences of their putative hybrid species T. × rohlenae have been recorded. Next-generation sequencing of both species and de novo assembly was carried out resulting in 120 contigs for T. montanum and 1685 contigs for T. capitatum assembled. The Dig-up primers pipeline was used for SSR mining of both assemblies, applying different criteria that resulted in 112 SSR candidates for testing. A subset of 41 SSRs was selected and after two rounds of testing, twelve SSRs were developed and characterized. A total of 232 alleles were detected with 5 to 29 alleles per locus, based on the test sample. The genetic diversity analysis of three Teucrium taxa from a single location revealed a higher level of diversity in T. montanum than in T. capitatum with intermediate values for the hybrid species. The NeighborNet diagram and genetic structure analysis grouped the taxa into two separate clusters, the first of which consisted exclusively of T. montanum, while the other was composed of intermixed T. capitatum and T. × rohlenae individuals. The availability of SSR markers for two Teucrium taxa will allow in-depth analysis of genetic diversity and structure, as well as molecular identification of their putative hybrids in the future.

1. Introduction

The genus Teucrium L., belonging to the family Lamiaceae, comprises a large (more than 250 species) and diverse group of herbaceous plants and shrubs distributed in different regions of the world [1]. Most Teucrium species are native to Europe and Central Asia, where they thrive in diverse habitats ranging from meadows and grasslands to rocky slopes and forests [2].
In Croatia, the genus Teucrium L. is well represented in the country’s botanical diversity and in diverse landscapes, including coastal areas, mountainous regions and inland areas. It provides suitable conditions for 12 Teucrium species. Among these species, T. montanum L. and T. capitatum L., two Steno-Mediterranean taxa have the largest distribution area in Croatia. They can be found in karst habitats within the coastal and peri-coastal regions of the country [3], as can be seen in Figure 1. In certain areas where both species occur sympatrically, a naturally occurring species of hybridogenous origin, T. × rohlenae K. Malý, has recently been recorded based on morphological analysis and biochemical profile [4]. T. capitatum and T. polium L. were until recently considered to be the same species [5,6], namely T. capitatum was treated as a synonym of T. polium subsp. capitatum (L.) Arcang.
The consumption of T. montanum and/or T. capitatum for the treatment of different medical conditions such as gastrointestinal and liver ailments, inflammation of the respiratory tract, and strengthening of the immune system has been well documented in the Balkan region [1,7,8,9,10]. Most of the research on T. montanum and T. capitatum has focused on investigating their phytochemical composition and potential pharmacological applications. Analysis of the essential oil extracted from the aerial parts of T. montanum and T. capitatum revealed a similar chemical profile [11], with sesquiterpenes such as β-caryophyllene and β-pinene being the dominant compounds [4]. The essential oil of T. capitatum has also been investigated for its antinociceptive potential by performing the twitch test in mice with positive results [12]. The antimicrobial activity of T. capitatum has also been thoroughly investigated, especially against Klebsiella pneumoniae [13] and Salmonella typhimurium [14]. The essential oils of T. montanum and T. capitatum have also been studied for their antiphytoviral activity against cucumber mosaic virus (CMV) in quinoa, which is due to the high content of β-caryophyllene (52% in T. capitatum) and germacrene D (17.2%), β-pinene (12.3%) and limonene (4.6%) in the case of T. montanum [11]. In the majority of the research papers cited here that investigated the biochemical composition of the essential oil T. capitatum and its pharmacological potential, the species was referred to as T. polium or T. polium subsp. capitatum. From the authors’ statements on the origin of the plant material (Balkan Peninsula, Iran) and the known distribution areas of T. polium and T. capitatum [15], we can conclude that they indeed refer to T. capitatum.
Compared to research on the molecular diversity and phylogenetics of T. montanum and T. capitatum, there is a larger number of studies on biochemical diversity. In other Teucrium species, there is a considerable amount of research on population genetics using different marker systems, such as the combination of chloroplast (rpL32-trnL and trnL-trnF) and nuclear regions (ITS) in T. flavum L. [16] and T. scorodonia L. [17], AFLP markers in T. arduini L. [18] or ISSR markers in T. stocksianum Boiss. [19]. There are only a handful of molecular studies on T. capitatum, which usually focus on the systematics of the Teucrium section Polium [20], an entire Teucrium genus [6] as a starting point for conservation [21]. A single molecular study investigated the genetic differences between T. polium and T. capitatum (referred to in the paper as T. polium subsp. Capitatum) [22]. A review of the literature revealed no studies addressing the molecular diversity of T. montanum.
Currently, no microsatellite markers for T. montanum or T. capitatum have been developed. Microsatellite markers (widely known as simple sequence repeats or SSRs) consist of a large number of copies of a nucleotide motif [23]. As a marker system, they are codominant and highly informative, making them ideal for population genetics, conservation genetics and phylogenetic studies [24,25]. Microsatellite markers are usually species-specific, i.e., they must be developed de novo for each species, which limits interspecies transfer in plants [26]. Another advantage of microsatellite markers lies in their potential to identify hybrid individuals in plant species with high levels of hybridization [27], especially when combined with increasingly new open-source statistical tools for the analysis of hybrid species [28,29].
The traditional approach to microsatellite marker development is both time-consuming and expensive. With the emergence of NGS sequencing, [30] this process has been significantly shortened and has become much more affordable. Additionally, SSRs developed in-silico exhibit a high level of polymorphism, especially in species of hybridogenous origin making them ideal for the identification of hybrid individuals on a molecular level [31]. Wide-range availability of NGS coupled with various pipelines for the rapid and effective development of highly polymorphic microsatellite markers [31,32] has led in recent years to the identification and research of hybrids in a variety of plant species such as silverleaf sunflower (Helianthus argophyllus Torr. & A.Gray) [33], bur-reed (Sparganium L.) [34] and cherries (Prunus × yedoensis Matsum.) [35] to name a few.
The aim of this research was: (a) to develop SSR markers for T. montanum and T. capitatum using the combination of NGS and a recently developed pipeline for SSR identification in related species, (b) to characterize the developed SSRs, and (c) to analyze their suitability for genetic diversity studies and the identification of putative hybrids.

2. Materials and Methods

2.1. Plant Material and DNA Isolation

All samples were collected in June 2021 in the central Adriatic hinterland, near Vojnić Sinjski where both T. montanum and T. capitatum as well as their hybrid T. × rohlenae are naturally distributed. In total, 34 individuals of T. montanum, 30 individuals of T. capitatum and 18 individuals of T. × rohlenae were sampled.
High molecular weight genomic DNA for NGS sequencing was extracted from fresh leaf tissue (500 mg) of one individual of each parental species using the CTAB isolation procedure [36] with some modifications. Immediately before extraction, 1% 2-mercaptoethanol, 1% polyvinylpyrrolidone (PVP) and 1% Rnase A (100 mg/mL) were added to the genomic lysis buffer. The isopropanol precipitation was replaced by precipitation with 2.5 volumes of cold ethanol. The precipitated DNA was not centrifuged but fished out with the curved tip of a micropipette and transferred twice to 2 mL of 70% ethanol for washing. The isolated DNA was checked for concentration and purity using the NanoPhotometer P300 (Implen, Munich, Germany) and the Qubit™ fluorometer (Invitrogen, Carlsbad, CA, USA). The extracted DNA samples are stored at the Laboratory of Genetic Diversity, Phylogeny and Molecular Systematics of Plants, Faculty of Science, University of Zagreb, under accession numbers ZAGR 51322 (T. montanum) and ZAGR 51323 (T. capitatum).
Total genomic DNA of T. montanum and T. capitatum used for testing and characterization of the developed microsatellites, as well as from both parental species and the hybrids used in the genetic diversity study, was isolated from 25 mg of silica gel-dried leaf tissue. Prior to DNA isolation, the leaf tissue was ground to a fine powder using the TissueLyser II (Qiagen, Hilden, Germany). The DNeasy® Plant Mini Kit (Qiagen, Hilden, Germany) was used for DNA isolation, and the concentration and purity of the isolated DNA were measured with the NanoPhotometer P300 (Implen, Munich, Germany).

2.2. Next-Generation Sequencing, DNA Assembly and SSR Mining

The PacBio HiFi library was prepared using the SMRTbell™ Template Prep Kit 1.0 (Pacific Biosciences of California, Inc, San Diego, CA, USA). The library was sequenced using the PacBio 8M SMRT cell and the PacBio Sequel II System (Pacific Biosciences of California, Inc, San Diego, CA, USA) in the DNA Link Sequencing lab (DNA Link Inc., Seoul, Republic of Korea). The FastQC tool was used to check the quality of the raw sequences and the possible presence of the sequence adapters [37]. De novo assembly was performed using the de novo Assembly algorithm of the CLC Genomics Server ver.20.0.2 (Qiagen Bioinformatics, Aarhus, Denmark) with default parameters and high similarity fraction (0.95) and mapping option ON.
For SSR mining, the recently developed Dig-up Primers pipeline was utilized [31] in Python version 3 with the Biopython module [38]. The assemblies of T. montanum (Assembly A) and T. capitatum (Assembly B) were used as input in FASTA format. The pipeline consists of six steps and uses several external software: MISA [39] (https://mybiosoftware.com/misa-microsatellite-identification-tool.html), RepeatMasker 4.1.6 [40], Primer3 4.1.0 [41] and BLAST 2.15.0 [42]. In the first step, SSRs were identified using MISA. SSR motifs with the length of two and three nucleotides were searched for, whereby a minimum repeat length was defined (2: 10; 3: 7). In the second step, the SSR regions were analyzed and SSRs were filtered out based on several criteria: simplicity (composite SSRs were excluded), proximity to other SSRs, and proximity to the end of the contigs (a default value of 200 bp was used for the last two criteria). In the third step, primers were designed with Primer3 using the default settings for primer properties [31]. The fourth step included a low complexity and proximity to coding regions check with RepeatMasker. The SSR markers from both assemblies were amplified in silico with BLAST in the fifth step. In the final step, the markers were selected for testing if they were amplified once in both assemblies, the difference in the length of the amplified regions was due to polymorphism in the SSR length, and the amplified regions contained SSRs with the same motif as that for which the primers were designed.

2.3. Testing and Characterization of Developed SSR Markers

For initial testing, a subset of markers was selected that showed polymorphisms in the number of repeat motifs between two parental species. The selected SSR loci were first tested on five genotypes of each parental species to determine amplification success and polymorphisms. Amplification was performed in the ProflexTM PCR System (Thermo Fisher Scientific Inc., Waltham, MA, USA) using a two-step PCR protocol with an initial touchdown cycle: 94 °C for 5 min, followed by five cycles of 45 s at 94 °C, 30 s at 60 °C, 10 lowered by 1 °C in each cycle, 1 min 30 s at 72 °C, followed by 25 cycles of 45 s at 94 °C, 30 s at 55 °C, 1 min 30 s at 72 °C, and ending with an 8-min extension step at 72 °C. PCR products were run on an ABI 12 3730XL analyzer using a commercial fragment analysis service (Macrogen Inc., Amsterdam, The Netherlands). The results were analyzed using GeneMapper 5.0 software (Thermo Fisher Scientific Inc).
Loci that were successfully amplified and determined to be polymorphic in initial testing were further tested in the same way, but with 28 T. montanum, 24 T. capitatum, and 18 hybrid individuals (according to their morphology).
For each developed SSR, the number of alleles (Na), polymorphic information content (PIC) and probability of identity (PI) were determined using Cervus v. 3.0 [43]. All loci were checked for scoring errors, allelic dropout and the presence of null alleles using Micro-Checker v. 2.2.3 [44] and null allele frequencies were estimated in FreeNA [45] using the expectation-maximization algorithm.

2.4. Teucrium Diversity Analysis

The genetic diversity of T. montanum, T. capitatum and hybrid species (T. × rohlenae) was assessed by calculating the observed heterozygosity (HO), expected heterozygosity (HE) and inbreeding coefficient (FIS) in Genepop v. 4.7 [46]. Deviations from Hardy–Weinberg equilibrium were determined in Genepop and significance levels were adjusted using the Bonferroni correction for multiple testing in SAS v. 9.4 [47]. The allelic richness (Nar) of each taxon was estimated using HP-Rare v. 1.0 [48].
Pairwise genetic distances based on the proportion of shared alleles (Dpsa [49]) between all individuals were calculated using MICROSAT [50] and used to construct a NeighborNet diagram using SplitsTree 4 [51]. Population differentiation was determined using pairwise FST estimates in FSTAT v. 2.9.3.2 [52], with p-values calculated after 1000 random permutations.
The genetic structure of the three Teucrium species was assessed using STRUCTURE v2.3.4 [53] with two approaches. The first approach included the standard analysis with a number of clusters of K = 1–6 to assess the overall structure. In the second analysis, the individuals belonging to the parental species (T. montanum and T. capitatum) were assigned a priori to their predefined clusters (POPFLAG = 1), while the unflagged individuals (POPFLAG = 0) were the hybrids (T. × rohlenae). Allele frequency estimation was thus based solely on the parental species (option PFROMPOPFLAGONLY) and the number of clusters was set to K = 2. The calculations were performed on the Isabella computer cluster at the University of Zagreb (Croatia), University Computing Center (SRCE). Thirty runs per K were performed, with each run including a burn-in period of 200,000 steps followed by 1,000,000 MCMC replicates using the Admixture model with correlated allele frequencies. In the first approach, the optimal number of clusters was determined by calculating ΔK [54] using the web-based software StructureSelector [55], which also allows clustering and merging of the resulting runs according to the CLUMPAK method described in Kopelman et al. [56]. An individual was assigned to a cluster if an arbitrary value of 75% of its genome was estimated to belong to that genetic cluster [57], while the individuals with a membership probability Q < 75% for all clusters were considered ‘admixed’.

3. Results and Discussion

3.1. DNA Assembly and SSR Mining

Next-generation sequencing of T. montanum yielded a total of 1,564,267 high-quality reads, which were assembled into 120 contigs. The total length of the contigs was 387.6 Mbp and the length of the longest contig was 14,167,793 bp. The assembly had a mean GC content of 37.19% and an N50 value of 5,151,942 bp. A similar GC content was previously observed in T. montanum and other Teucrium species [58]. Next-generation sequencing of T. capitatum yielded a total of 1,962,544 high-quality reads assembled into 1685 contigs. The total length of the contigs was 816.4 Mbp and the length of the longest contig was 7,799,184. The assembly had an N50 value of 1,030,709 bp and a mean GC content of 32.88%, which is significantly lower than in other Teucrium taxa [58].
The assembly of T. montanum was used as Assembly A in the Dig-up Primers pipeline, as it is more suitable for initial SSR mining due to its lower number of contigs (the first four steps of the pipeline). The T. capitatum assembly was used as Assembly B in the last two steps of the pipeline (Figure 2). We identified a total of 11,820 SSRs in Assembly A, most of which were dinucleotides (79%), which is consistent with other species in the Lamiaceae family such as Ocimum basilicum L. [59] and Tectona grandis L. [60]. After the second step of the pipeline (analysis of SSR regions), the number of SSRs was reduced to 10,601 based on the selection criteria. The number of eligible SSRs was further reduced to 5275 in the third step based on the selected primer design parameters. In the fourth step, regions with low complexity or close to the coding regions were excluded, leaving 2631 SSRs that were used in the fifth step (in silico PCR on both assemblies). In T. montanum 2095 SSRs were amplified, while in T. capitatum 219 SSRs were amplified. The number of SSRs that were amplified only once in both assemblies and were polymorphic was 112. Complex filtering criteria have already been used to successfully develop SSRs for several species with larger and more complex genomes than that of Teucrium taxa [61,62].

3.2. Testing and Characterisation of Developed Markers

Of the 112 SSRs, 41 were selected on the basis of polymorphisms in the number of repeat motifs between two parental species for initial testing on five samples of each species. Eighteen loci were polymorphic, while 23 of them were either monomorphic or did not amplify at all. Further tests on individuals of T. montanum (28) and T. capitatum (24) and their hybrids (18) revealed twelve amplified loci in all individuals examined. Six of the original loci occurred in the form of so-called stuttering peaks, which were very difficult to analyze, with more than two amplified fragments in the same individual, or no amplification occurred in more than 25% of the individuals examined. The sequences of the newly developed SSRs were deposited in GenBank under accession numbers PP001804–PP001829 (Table 1).
A total of 232 alleles ranging from 5 (TmUZ43/TpcUZ43) to 29 (TmUZ08/TpcUZ08) were detected with an average of 19.33 alleles per locus. The probability of identity ranged from 0.006 (TmUZ08/TpcUZ08 and TmUZ31/TpcUZ31) to 0.209 (TmUZ44/TpcUZ44) with a combined probability of identity for all loci of 1.04 × 10−17. On the basis of polymorphic information content (PIC), nine of the twelve SSRs were classified as highly informative (PIC > 0.70) and the other three as moderately polymorphic with a PIC higher than 0.44 [63].

3.3. Teucrium Genetic Diversity in Vojnić Sinjski

The genetic parameters used to analyze three Teucrium taxa at the Vojnić Sinjski locality showed similar patterns. In T. montanum, the highest values were obtained for allelic richness (13.17), observed (0.807) and expected heterozygosity (0.873). In contrast, T. capitatum showed the lowest values of allelic richness (10.27), observed (0.656) and expected heterozygosity (0.713). The values of the genetic parameters in the putative hybrid species T. × rohlenae were intermediate (Table 2). A significant deviation from Hardy–Weinberg equilibrium was observed in all three taxa. Null alleles were found in three of 36 loci × taxa combinations, one in T. montanum (estimated null allele frequency of 0.15 for TmUZ31/TpcUZ31) and two in the putative hybrid species (estimated null frequencies of 0.079 and 0.061 for TmUZ32/TpcUZ32 and TmUZ35/TpcUZ35, respectively). Examination of the shared alleles revealed that of 232 alleles, 36.21% were shared between all three taxa (Figure 3A). A further 13.79% of alleles were shared between T. montanum and the putative hybrid species, while 20.26% of alleles were found only in T. montanum.
The lowest pairwise differentiation between taxa was found for T. capitatum and the putative hybrid species (FST = 0.008) while the highest differentiation was found between the parent taxa (FST = 0.153). The NeighborNet diagram based on the proportion of shared alleles (Dpsa) between all 70 individuals clearly separated T. montanum from T. capitatum. The hybrid species was mostly admixed with T. capitatum, with no evidence of grouping (Figure 3B).
The optimal number of genetic clusters was first determined using standard STRUCTURE analysis, with no prior taxa information considered. The highest ΔK was observed at K = 2 (37.03), while the second best (at K = 3; ΔK = 8.21), as expected, did not group the hybrid individuals as members of the putative third genetic cluster. At K = 2, all but one individual of T. montanum were assigned to cluster A, with the proportion of membership being higher than Q > 0.75. Similarly, all but two individuals of T. capitatum were assigned to cluster B. The hybrid individuals (T. × rohleane) were clearly admixed, as their proportion of membership was lower than Q < 0.75 in both clusters, with the exception of one of 17 individuals.
The second approach, using predefined clusters for individuals belonging to the parental species, produced a similar result. In addition, the gradual transition of hybrids from one species to another was shown, suggesting a long-term introgression between the parental species involving the formation of individuals belonging to different degrees of hybridization, including not only F1 or F2 hybrids but also recurrent backcrosses to the parental genotypes.

4. Conclusions

Our results confirm that the recently developed Dig-up Primers pipeline can be used to mine for SSRs in closely related taxa and selected markers were successfully amplified in individuals used for testing.
The newly developed SSRs for T. montanum and T. capitatum can be successfully used to analyze the genetic diversity of both species and to assess the extent of their hybridization process in situ. Genetic diversity and genetic structure analysis suggested that T. × rohleane is a species of hybridogenous origin, which is in agreement with previous research on the three Teucrium taxa conducted on the morphological and biochemical levels.
The preliminary results, based on a single location where all three taxa occur, are very encouraging for future studies on hybridization between T. montanum and T. capitatum at other locations throughout the distribution range of both species and will allow the elucidation of the complex taxonomy and phylogeography of these closely related species.

Author Contributions

Conceptualization, Z.Š., J.J. and Z.L.; methodology, J.J. and A.T.; validation, Z.L.; formal analysis, Z.Š. and F.V.; investigation, N.J., M.G., L.J., M.Z., F.V., Z.L. and Z.Š.; data curation, Z.L. and A.T.; writing—original draft preparation, F.V., Z.L. and Z.Š.; writing—review and editing, F.V., Z.L. and Z.Š.; visualization, F.V.; supervision, Z.Š. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the project PK.1.1.02.0005, Research and Development of Plant Genetic Resources for Sustainable Agriculture, Centre of Excellence for Biodiversity and Molecular Plant Breeding (CoE CroP-BioDiv), Zagreb, Croatia.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The data that support the findings of this study are openly available in GenBank at the NCBI (https://www.ncbi.nlm.nih.gov (accessed on 28 February 2024)).

Acknowledgments

This work would not be possible without Marija Jug-Dujaković, Tatjana Klepo, Tonka Ninčević Runjić and Frane Strikić who helped with sampling of Teucrium species. Further acknowledgement is needed of Sandro Bogdanović and Dmitar Lakušić whose expertise enabled us to successfully locate T. × rohleane individuals. Final acknowledgement goes to Toni Nikolić, the editor of Flora Croatica Database which we used to plan out our fieldwork.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Dinić, J.; Novaković, M.; Pešić, M. Potential for cancer treatment: Natural products from the Balkans. In Biodiversity and Biomedicine: Our Future; Ozturk, M., Egamberdieva, D., Pešić, M., Eds.; Academic Press: Cambridge, MA, USA, 2020; pp. 137–159. ISBN 9780128195413. [Google Scholar]
  2. Navarro, T.; El Oualidi, J. Synopsis of Teucrium L. (Labiatae) in the Mediterranean region and surrounding areas. Flora Medit. 2000, 10, 349–363. [Google Scholar]
  3. Nikolić, T. (Ed.) Flora Croatica Database. Available online: http://hirc.botanic.hr/fcd (accessed on 14 February 2024).
  4. Zbiljić, M.; Lakušić, B.; Marčetić, M.; Bogdanović, S.; Lakušić, D. Morphological and chemical evidence of Teucrium × rohlenae K. Malý (Lamiaceae), a new hybrid in Croatia. Acta Bot. Croat. 2021, 80, 48–55. [Google Scholar] [CrossRef]
  5. Navarro, T. Teucrium L. In Flora Iberica 12; Morales, R., Quintanar, A., Cabezas, F., Pujadas, A.J., Cirujano, S., Eds.; Real Jardín Botánico, CSIC: Madrid, Spain, 2010; pp. 30–166. [Google Scholar]
  6. Salmaki, Y.; Kattari, S.; Heubl, G.; Bräuchle, C. Phylogeny of non-monophyletic Teucrium (Lamiaceae: Ajugoideae): Implications for character evolution and taxonomy. Taxon 2016, 65, 805–822. [Google Scholar] [CrossRef]
  7. Redzić, S.S. The ecological aspect of ethnobotany and ethnopharmacology of population in Bosnia and Herzegovina. Coll. Antropol. 2007, 31, 869–890. [Google Scholar]
  8. Šarić-Kundalić, B.; Dobeš, C.; Klatte-Asselmeyer, V.; Saukel, J. Ethnobotanical study on medicinal use of wild and cultivated plants in middle, south and west Bosnia and Herzegovina. J. Ethnopharmacol. 2010, 131, 33–55. [Google Scholar] [CrossRef]
  9. Zlatković, B.K.; Bogosavljević, S.S.; Radivojević, A.R.; Pavlović, M.A. Traditional use of the native medicinal plant resource of Mt. Rtanj (Eastern Serbia): Ethnobotanical evaluation and comparison. J. Ethnopharmacol. 2014, 151, 704–713. [Google Scholar] [CrossRef]
  10. Varga, F.; Šolić, I.; Jug Dujaković, M.; Łuczaj, Ł.; Grdiša, M. The first contribution to the ethnobotany of inland Dalmatia: Medicinal and wild food plants of the Knin area, Croatia. Acta Soc. Bot. Pol. 2019, 88, 1–20. [Google Scholar] [CrossRef]
  11. Bezić, N.; Vuko, E.; Dunkić, V.; Ruščić, M.; Blažević, I.; Burčul, F. Antiphytoviral Activity of Sesquiterpene-Rich Essential Oils from Four Croatian Teucrium Species. Molecules 2011, 16, 8119. [Google Scholar] [CrossRef]
  12. Abdollahi, M.; Karimpour, H.; Monsef-Esfehani, H.R. Antinociceptive effects of Teucrium polium L total extract and essential oil in mouse writhing test. Pharmacol. Res. 2003, 48, 31–35. [Google Scholar] [CrossRef]
  13. Raei, F.; Ashoori, N.; Eftekhar, F.; Yousefzadi, M. Chemical composition and antibacterial activity of Teucrium polium essential oil against urinary isolates of Klebsiella pneumoniae. J. Essent. Oil Res. 2014, 26, 65–69. [Google Scholar] [CrossRef]
  14. Mahmoudi, R.; Zare, P.; Nosratpour, S. Application of Teucrium polium Essential Oil and Lactobacillus casei in Yoghurt. J. Essent. Oil Bear. Plants 2015, 18, 477–481. [Google Scholar] [CrossRef]
  15. POWO. Plants of the World Online (POWO). Available online: https://powo.science.kew.org/ (accessed on 10 February 2024).
  16. Djabou, N.; Battesti, M.J.; Allali, H.; Desjobert, J.M.; Varesi, L.; Costa, J.; Muselli, A. Chemical and genetic differentiation of Corsican subspecies of Teucrium flavum L. Phytochemistry 2011, 72, 1390–1399. [Google Scholar] [CrossRef]
  17. Djabou, N.; Allali, H.; Battesti, M.J.; Tabti, B.; Costa, J.; Muselli, A.; Varesi, L. Chemical and genetic differentiation of two Mediterranean subspecies of Teucrium scorodonia L. Phytochemistry 2012, 74, 123–132. [Google Scholar] [CrossRef]
  18. Kremer, D.; Bolarić, S.; Ballian, D.; Bogunić, F.; Stešević, D.; Karlović, K.; Kosalec, I.; Vokurka, A.; Rodríguez, J.V.; Randić, M.; et al. Morphological, genetic and phytochemical variation of the endemic Teucrium arduini L. (Lamiaceae). Phytochemistry 2015, 116, 111–119. [Google Scholar] [CrossRef]
  19. Kamali, M.; Samsampour, D.; Bagheri, A.; Mehrafarin, A.; Homaei, A. Association analysis and evaluation of genetic diversity of Teucrium stocksianum Boiss. populations using ISSR markers. Genet. Resour. Crop Evol. 2023, 70, 691–709. [Google Scholar] [CrossRef]
  20. El Oualidi, J.; Verneau, O.; Puech, S.; Dubuisson, J.Y. Utility of rDNA ITS sequences in the systematics of Teucrium section Polium (Lamiaceae). Plant Syst. Evol. 1999, 215, 49–70. [Google Scholar] [CrossRef]
  21. Marzouk, R.I.; El-Badan, G.E. Research article molecular characterization of Teucrium L. (lamiaceae) as a prerequisite for its conservation. J. Biol. Sci. 2018, 11, 16–23. [Google Scholar]
  22. Djabou, N.; Muselli, A.; Allali, H.; Dib, M.E.A.; Tabti, B.; Varesi, L.; Costa, J. Chemical and genetic diversity of two Mediterranean subspecies of Teucrium polium L. Phytochemistry 2012, 83, 51–62. [Google Scholar] [CrossRef]
  23. Zane, L.; Bargelloni, L.; Patarnello, T. Strategies for microsatellite isolation: A review. Mol. Ecol. 2002, 11, 1–16. [Google Scholar] [CrossRef]
  24. Vieira, M.L.C.; Santini, L.; Diniz, A.L.; Munhoz, C.d.F. Microsatellite markers: What they mean and why they are so useful. Genet. Mol. Biol. 2016, 39, 312. [Google Scholar] [CrossRef]
  25. Kalia, R.K.; Rai, M.K.; Kalia, S.; Singh, R.; Dhawan, A.K. Microsatellite markers: An overview of the recent progress in plants. Euphytica 2010, 177, 309–334. [Google Scholar] [CrossRef]
  26. Barbará, T.; Palma-Silva, C.; Paggi, G.M.; Bered, F.; Fay, M.F.; Lexer, C. Cross-species transfer of nuclear microsatellite markers: Potential and limitations. Mol. Ecol. 2007, 16, 3759–3767. [Google Scholar] [CrossRef]
  27. Kong, S.; Kubatko, L.S. Comparative Performance of Popular Methods for Hybrid Detection using Genomic Data. Syst. Biol. 2021, 70, 891–907. [Google Scholar] [CrossRef]
  28. Goulet, B.E.; Roda, F.; Hopkins, R. Hybridization in Plants: Old Ideas, New Techniques. Plant Physiol. 2017, 173, 65–78. [Google Scholar] [CrossRef]
  29. Neophytou, C. Bayesian clustering analyses for genetic assignment and study of hybridization in oaks: Effects of asymmetric phylogenies and asymmetric sampling schemes. Tree Genet. Genomes 2014, 10, 273–285. [Google Scholar] [CrossRef]
  30. Zalapa, J.E.; Cuevas, H.; Zhu, H.; Steffan, S.; Senalik, D.; Zeldin, E.; McCown, B.; Harbut, R.; Simon, P. Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences. Am. J. Bot. 2012, 99, 193–208. [Google Scholar] [CrossRef]
  31. Turudić, A.; Liber, Z.; Grdiša, M.; Jakše, J.; Varga, F.; Poljak, I.; Šatović, Z. Dig-up Primers: A Pipeline for Identification of Polymorphic Microsatellites Loci within Assemblies of Related Species. Int. J. Mol. Sci. 2024, 25, 3169. [Google Scholar] [CrossRef]
  32. Wang, H.; Gao, S.; Liu, Y.; Wang, P.; Zhang, Z.; Chen, D. A pipeline for effectively developing highly polymorphic simple sequence repeats markers based on multi-sample genomic data. Ecol. Evol. 2022, 12, e8705. [Google Scholar] [CrossRef]
  33. Makarenko, M.S.; Azarin, K.V.; Gavrilova, V.A. Mitogenomic Research of Silverleaf Sunflower (Helianthus argophyllus) and Its Interspecific Hybrids. Curr. Issues Mol. Biol. 2023, 45, 4841–4849. [Google Scholar] [CrossRef]
  34. Belyakov, E.A.; Александрoвич, Б.Е.; Machs, E.M.; Мoдрисoвич, М.Э.; Mikhailova, Y.V.; Владимирoвна, М.Ю.; Rodionov, A.V.; Викеньтьевич, Р.А. The study of hybridization processes within genus Sparganium L. Subgenus Xanthosparganium holmb. Based on data of next generation sequencing (NGS). Ecol. Genet. 2019, 17, 27–35. [Google Scholar] [CrossRef]
  35. Baek, S.; Choi, K.; Kim, G.B.; Yu, H.J.; Cho, A.; Jang, H.; Kim, C.; Kim, H.J.; Chang, K.S.; Kim, J.H.; et al. Draft genome sequence of wild Prunus yedoensis reveals massive inter-specific hybridization between sympatric flowering cherries. Genome Biol. 2018, 19, 127. [Google Scholar] [CrossRef]
  36. Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
  37. Andrews, S. FastQC—A Quality Control Tool for High Throughput Sequence Data. Babraham Bioinforma. 2010. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 10 December 2023).
  38. Cock, P.J.A.; Antao, T.; Chang, J.T.; Chapman, B.A.; Cox, C.J.; Dalke, A.; Friedberg, I.; Hamelryck, T.; Kauff, F.; Wilczynski, B.; et al. Biopython: Freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics 2009, 25, 1422–1423. [Google Scholar] [CrossRef]
  39. Thiel, T.; Michalek, W.; Varshney, R.K.; Graner, A. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor. Appl. Genet. 2003, 106, 411–422. [Google Scholar] [CrossRef]
  40. Smit, A.; Hubley, R.; Green, P. RepeatMasker Open-4.0.6 2013–2015. 2018. Available online: http://www.repeatmasker.org (accessed on 11 November 2023).
  41. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3-new capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
  42. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  43. Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef]
  44. Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef]
  45. Chapuis, M.P.; Estoup, A. Microsatellite null alleles and estimation of population differentiation. Mol. Biol. Evol. 2007, 24, 621–631. [Google Scholar] [CrossRef]
  46. Rousset, F. genepop’007: A complete re-implementation of the genepop software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103–106. [Google Scholar] [CrossRef]
  47. SAS Institute Inc. Base SAS 9.4 Procedures Guide: Statistical Procedures; SAS Institute: Cary, NC, USA, 2011; ISBN 978-1-60764-944-1. [Google Scholar]
  48. Kalinowski, S.T. HP-RARE 1.0: A computer program for performing rarefaction on measures of allelic richness. Mol. Ecol. Notes 2005, 5, 187–189. [Google Scholar] [CrossRef]
  49. Bowcock, A.M.; Ruiz-Linares, A.; Tomfohrde, J.; Minch, E.; Kidd, J.R.; Cavalli-Sforza, L.L. High resolution of human evolutionary trees with polymorphic microsatellites. Nature 1994, 368, 455–457. [Google Scholar] [CrossRef] [PubMed]
  50. Minch, E.; Ruiz-Linares, A.; Goldstein, D.; Feldman, M.; Cavalli-Sforza, L.L. Microsat (Version 1.5b): A Computer Program for Calculating Various Statistics on Microsatellite Allele Data; Stanford University: Stanford, CA, USA, 1997. [Google Scholar]
  51. Huson, D.H.; Bryant, D. Application of Phylogenetic Networks in Evolutionary Studies. Mol. Biol. Evol. 2006, 23, 254–267. [Google Scholar] [CrossRef] [PubMed]
  52. Goudet, J. FSTAT, Version 2.9.4, A Program to Estimate and Test Gene Diversities and Fixation Indices; 2002. Available online: https://www2.unil.ch/popgen/softwares/fstat.htm (accessed on 11 November 2023).
  53. Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [PubMed]
  54. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [PubMed]
  55. Li, Y.L.; Liu, J.X. StructureSelector: A web-based software to select and visualize the optimal number of clusters using multiple methods. Mol. Ecol. Resour. 2018, 18, 176–177. [Google Scholar] [CrossRef] [PubMed]
  56. Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. Clumpak: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef] [PubMed]
  57. Matsuoka, Y.; Vigouroux, Y.; Goodman, M.M.; Sanchez, J.G.; Buckler, E.; Doebley, J. A single domestication for maize shown by multilocus microsatellite genotyping. Proc. Natl. Acad. Sci. USA 2002, 99, 6080–6084. [Google Scholar] [CrossRef] [PubMed]
  58. Šmarda, P.; Knápek, O.; Březinová, A.; Horová, L.; Grulich, V.; Danihelka, J.; Veselý, P.; Šmerda, J.; Rotreklová, O.; Bureš, P. Genome sizes and genomic guanine+cytosine (GC) contents of the Czech vascular flora with new estimates for 1700 species. Preslia 2019, 91, 117–142. [Google Scholar] [CrossRef]
  59. Rastogi, S.; Meena, S.; Bhattacharya, A.; Ghosh, S.; Shukla, R.K.; Sangwan, N.S.; Lal, R.K.; Gupta, M.M.; Lavania, U.C.; Gupta, V.; et al. De novo sequencing and comparative analysis of holy and sweet basil transcriptomes. BMC Genom. 2014, 15, 588. [Google Scholar] [CrossRef]
  60. Yasodha, R.; Vasudeva, R.; Balakrishnan, S.; Sakthi, A.R.; Abel, N.; Binai, N.; Rajashekar, B.; Bachpai, V.K.W.; Pillai, C.; Dev, S.A. Draft genome of a high value tropical timber tree, Teak (Tectona grandis L. f): Insights into SSR diversity, phylogeny and conservation. DNA Res. 2018, 25, 409–419. [Google Scholar] [CrossRef]
  61. Varga, F.; Liber, Z.; Jakše, J.; Turudić, A.; Šatović, Z.; Radosavljević, I.; Jeran, N.; Grdiša, M. Development of Microsatellite Markers for Tanacetum cinerariifolium (Trevis.) Sch. Bip., a Plant with a Large and Highly Repetitive Genome. Plants 2022, 11, 1778. [Google Scholar] [CrossRef]
  62. Ebrahimi, A.; Mathur, S.; Lawson, S.S.; LaBonte, N.R.; Lorch, A.; Coggeshall, M.V.; Woeste, K.E. Microsatellite Borders and Micro-sequence Conservation in Juglans. Sci. Rep. 2019, 9, 3748. [Google Scholar] [CrossRef]
  63. Hildebrand, C.E.; Torney, D.C.; Wagner, R.P. Informativeness of polymorphic DNA markers. Los Alamos Sci. 1992, 20, 100–102. [Google Scholar] [CrossRef]
Diversity 16 00206 g001
Figure 1. Distribution of T. montanum and T. capitatum in Croatia. Areas where the distribution of the two species overlap are marked in blue. Vojnić Sinjski, the sampled location where hybridization between two species was detected is marked with a white circle.
Figure 1. Distribution of T. montanum and T. capitatum in Croatia. Areas where the distribution of the two species overlap are marked in blue. Vojnić Sinjski, the sampled location where hybridization between two species was detected is marked with a white circle.
Diversity 16 00206 g001
Diversity 16 00206 g002
Figure 2. Identification of SSR candidate markers for T. montanum and T. capitatum using the Dig-up Primer pipeline.
Figure 2. Identification of SSR candidate markers for T. montanum and T. capitatum using the Dig-up Primer pipeline.
Diversity 16 00206 g002
Diversity 16 00206 g003
Figure 3. Genetic diversity and structure of three Teucrium taxa (70 individuals) from Vojnić Sinjski, Croatia based on 12 newly developed SSR markers. (A) Venn diagram visualizing the proportion of private and shared alleles between the three taxa. (B) NeighborNet diagram based on the proportion of shared alleles distance (Dpsa). (C) Genetic structure based on the standard STRUCTURE analysis (at K = 2) and using the PFROMPOPFLAGONLY option. Each individual is represented by a column and the probability of membership to each of the two genetic clusters is shown on a scale of 0–100%.
Figure 3. Genetic diversity and structure of three Teucrium taxa (70 individuals) from Vojnić Sinjski, Croatia based on 12 newly developed SSR markers. (A) Venn diagram visualizing the proportion of private and shared alleles between the three taxa. (B) NeighborNet diagram based on the proportion of shared alleles distance (Dpsa). (C) Genetic structure based on the standard STRUCTURE analysis (at K = 2) and using the PFROMPOPFLAGONLY option. Each individual is represented by a column and the probability of membership to each of the two genetic clusters is shown on a scale of 0–100%.
Diversity 16 00206 g003
Table 1. List of twelve newly developed SSRs for T. montanum/T. capitatum and their characterization based on the Vojnić Sinjski population.
Table 1. List of twelve newly developed SSRs for T. montanum/T. capitatum and their characterization based on the Vojnić Sinjski population.
T. montanumT. capitatum
LocusPrimer Sequences (5′–3′)Repeat MotifNo. of RepeatsGeneBank Acc. No.No. of RepeatsGeneBank Acc. No.Size Range (bp)NaPICPI
TmUZ05/TpcUZ05F: GGTAGGTCTTAATCTTGGGCACA
R: TCGACAAACGGCTTCCTCTT		(TC)14PP0018049PP001805196–274250.9250.009
TmUZ08/TpcUZ08F: GCCTAGTTAAAGTGCTTCCAGC
R: GGAAGACTGGCGGTAGTACG		(GA)16PP00180631PP001807188–260290.9400.006
TmUZ09/TpcUZ09F: ACTCAAGTCGTGTTTGGATCCA
R: CCTCCTTCGATCGGTGCTTT		(CT)15PP0018088PP001809140–178180.8570.029
TmUZ11/TpcUZ11F: TTCCTTGCTTAGCCTGGAGC
R: ACCTTGATAAAATGGAGCAGCC		(AG)25PP00181033PP001811142–192240.9360.007
TmUZ14/TpcUZ14F: GGGATTCCATGTGATTTGCCC
R: CCATGAGAAGCACAAGGCCT		(TG)19PP00181222PP00181380–146260.9220.010
TmUZ20/TpcUZ20F: TGTGGAACGGTATGAAGCCT
R: GTCAAGGTGGTGGGGTTGAT		(CT)13PP0018147PP001815127–161130.6240.150
TmUZ26/TpcUZ26F: GGATGTGCAATGTTGTGTCACT
R: TGCAACCAACAGATGTGCTTG		(TC)20PP00181612PP001817232–274180.9120.013
TmUZ31/TpcUZ31F: GAGGAGAAGAGCATCACCCG
R: CTCAATTCCTGAGGACGGCT		(AT)15PP00182017PP001821232–286230.9410.006
TmUZ32/TpcUZ32F: GCGGCTTTTCCTCCCTACAA
R: AGTGACGGATGCCCATTGG		(TC)13PP0018229PP001823243–291220.9060.013
TmUZ35/TpcUZ35F: TCGGGCCAGGATAAGGTGTA
R: TCGATGGTCGAGACTCAGGT		(AG)18PP00182422PP001825170–230230.9290.009
TmUZ43/TpcUZ43F: GACCACTAAACCAGAAGGGCA
R: CAAGCCTCTCTCCAACCGAG		(TAA)7PP0018264PP001827207–22850.6160.162
TmUZ44/TpcUZ44F: CTTCCCCTCACACAAGTCCC
R: GCCTCCTCGCTTTACTTTGC		(GAA)8PP0018284PP001829233–24860.5520.209
Na—number of alleles; PIC—polymorphic information content; PI—probability of identity.
Table 2. Genetic diversity of three Teucrium taxa from Vojnić Sinjski, Croatia, based on twelve SSR markers.
Table 2. Genetic diversity of three Teucrium taxa from Vojnić Sinjski, Croatia, based on twelve SSR markers.
TaxonnNaNarNprHOHEFISp (FIS)
T. montanum2815.41713.166470.8070.8730.076***
T. × rohlenae1812.41712.417180.7590.8050.056**
T. capitatum2411.25010.269140.6560.7130.080***
n—sample size; Na—average number of alleles; Nar—allelic richness; Npr—number of private alleles; HO—observed heterozygosity; HE—expected heterozygosity; FIS—inbreeding coefficient (significance levels: **—significant at p < 0.01; ***—significant at p < 0.001).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Varga, F.; Liber, Z.; Turudić, A.; Jakše, J.; Juzbašić, L.; Jeran, N.; Grdiša, M.; Zbiljić, M.; Šatović, Z. Joint Identification and Application of Microsatellite Markers in Genetic Diversity Study of Closely Related Species Teucrium montanum, T. capitatum and Their Natural Hybrid. Diversity 2024, 16, 206. https://doi.org/10.3390/d16040206

AMA Style

Varga F, Liber Z, Turudić A, Jakše J, Juzbašić L, Jeran N, Grdiša M, Zbiljić M, Šatović Z. Joint Identification and Application of Microsatellite Markers in Genetic Diversity Study of Closely Related Species Teucrium montanum, T. capitatum and Their Natural Hybrid. Diversity. 2024; 16(4):206. https://doi.org/10.3390/d16040206

Chicago/Turabian Style

Varga, Filip, Zlatko Liber, Ante Turudić, Jernej Jakše, Lea Juzbašić, Nina Jeran, Martina Grdiša, Miloš Zbiljić, and Zlatko Šatović. 2024. "Joint Identification and Application of Microsatellite Markers in Genetic Diversity Study of Closely Related Species Teucrium montanum, T. capitatum and Their Natural Hybrid" Diversity 16, no. 4: 206. https://doi.org/10.3390/d16040206

APA Style

Varga, F., Liber, Z., Turudić, A., Jakše, J., Juzbašić, L., Jeran, N., Grdiša, M., Zbiljić, M., & Šatović, Z. (2024). Joint Identification and Application of Microsatellite Markers in Genetic Diversity Study of Closely Related Species Teucrium montanum, T. capitatum and Their Natural Hybrid. Diversity, 16(4), 206. https://doi.org/10.3390/d16040206

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop