Next Article in Journal
In Vivo and In Vitro Studies of Cigarette Smoke Effects on Innate Responses to Influenza Virus: A Matter of Models?
Next Article in Special Issue
Persistent Transmission of HCV among Men Who Have Sex with Men despite Widespread Screening and Treatment with Direct-Acting Antivirals
Previous Article in Journal
A Systematic Review and Meta-Analysis of Serologic Response following Coronavirus Disease 2019 (COVID-19) Vaccination in Solid Organ Transplant Recipients
Previous Article in Special Issue
Characterization of the Intestinal Fungal Microbiome in HIV and HCV Mono-Infected or Co-Infected Patients
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Viruses
Volume 14
Issue 8
10.3390/v14081823
viruses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

CMV and EBV Co-Infection in HIV-Infected Children: Infection Rates and Analysis of Differential Expression of Cytokines in HIV Mono- and HIV–CMV–EBV Co-Infected Groups

by
Fizza Nazim
1,2,
Hammad Afzal Kayani
2,
Apsara Ali Nathwani
3,
Fatima Mir
3 and
Syed Hani Abidi
1,4,*
1
Department of Biological and Biomedical Sciences, Aga Khan University, Karachi 74800, Pakistan
2
Department of Biosciences, Shaheed Zulfikar Ali Bhutto Institute of Science and Technology, Karachi 75600, Pakistan
3
Department of Pediatrics and Child Health, Aga Khan University, Karachi 74800, Pakistan
4
Department of Biomedical Sciences, School of Medicine, Nazarbayev University, Nur-Sultan 010000, Kazakhstan
*
Author to whom correspondence should be addressed.
Viruses 2022, 14(8), 1823; https://doi.org/10.3390/v14081823
Submission received: 15 June 2022 / Revised: 25 July 2022 / Accepted: 13 August 2022 / Published: 19 August 2022
(This article belongs to the Special Issue HIV and Co-infections: Updates and Insights)
Browse Figures
Versions Notes

Abstract

:
(1) Background: CMV and EBV co-infections can affect the HIV disease progression by modulating the immune system. The disease dynamics can differ in HIV-positive adults and children. In Pakistan, HIV is rapidly expanding, especially in children; however, the prevalence of CMV and EBV co-infection and the effect on immune modulation in HIV-positive children are not known. This study aimed to bridge this gap by estimating the rate of active CMV and EBV co-infection in HIV-positive children, followed by the analysis of differential expression of cytokines in HIV mono- and HIV/CMV/EBV co-infected children. (2) Methods: DNA samples from 319 HIV-positive children, previously recruited as part of a study to investigate the HIV outbreak in Larkana, Pakistan, in 2019, were screened for CMV and EBV through qPCR. Subsequently, differences in HIV viral loads and CD4 counts were analyzed between the HIV mono- and HIV/CMV/EBV co-infected groups. The RNA samples were used to determine the differential expression of both pro- and anti-inflammatory cytokines in the mono- and co-infected groups using RT-qPCR, while unpaired T-test and Pearson correlation test were applied to, respectively, analyze the differential cytokine expression and correlation between cytokine in the two groups. (3) Results: Of 319 samples, the rate of active EBV and CMV co-infection in HIV-positive children was observed in 79.9% and 38.9%, respectively. A significant difference was observed in HIV viral load between HIV mono- and co-infected groups. IFN-γ expression was found to be lower in the HIV mono-infected group, while higher in all other three co-infected groups. Meanwhile, mRNA expression of TGF-β1 was found to be lower in HIV mono- and HIV–CMV–EBV co-infected groups, while higher in HIV–CMV and HIV–EBV co-infected groups. IFN-γ and IL-2 exhibited a significant positive correlation in all except HIV–CMV co-infected group. (4) Conclusions: The study suggests that the presence of EBV/CMV co-infection can affect the HIV viral loads and expression of certain cytokines (IFN-γ and TGF-β1), which may affect the HIV disease dynamics in infected children.

1. Introduction

Since the advent of antiretroviral therapy (ART), the span and quality of life of HIV-infected patients has significantly improved. However, HIV-related morbidity and mortality are still high in certain countries, especially in the low- and middle-income countries (LMIC), primarily because of low ART coverage, poor adherence to ART, immune dysfunction, inflammation, and chronic co-infections, such as Epstein–Barr virus (EBV), cytomegalovirus (CMV) infections, etc. [1,2].
The global prevalence of EBV and CMV ranges from 60 to 100%, varying largely between developed and developing countries [3,4,5,6,7]. Immunocompromised, HIV-positive individuals are especially susceptible to infection or activation of these viruses [8,9,10]. Co-infection frequency of CMV and EBV with HIV is high and there is convincing evidence reflecting a significant role of these viruses in HIV disease progression [11]. For example, one study reported that, in HIV-infected individuals with CMV seropositive status, the risk of progression to AIDS was about two times more rapidly than in CMV-seronegative HIV-infected individuals [12]. Similarly, EBV infection has also been identified as a factor associated with morbidities in HIV-infected patients [13]. In HIV-positive patients, factors such as immunological dysfunction, persistent immune activation, and T-cell receptor (TCR) repertoire loss are significantly associated with reactivation of EBV and the development of EBV-associated pathologies, such as B-cell lymphoma [14].
Cytokines, both anti- and proinflammatory, are the key modulators of HIV disease progression [15]. Cytokines known to induce the spread of HIV include TNF-α, TNF-β, IL-1, and IL-6, which promotes viral replication in T cells [16,17,18]. The specific mechanism(s) by which cytokines affect HIV disease progression in the case of CMV/EBV co-infection remains poorly understood. It has previously been documented that secretion of T-helper type 1 (Th 1) cytokines, such as interleukin (IL-2) and interferon-gamma (IFN-γ), is reduced during HIV-1 infection, although production of T helper 2 (Th 2) cytokines, such as IL-4, IL-10, IL-1β, IL-6, tumor necrosis factor (TNF-α), and TGF-β1, is elevated [19,20]. A previous study examining CMV and HIV co-infection found higher IL-1 and -8 levels in co-infected individuals, as compared to only HIV-infected individuals [21]. However, not much is known about the differential expression of these key cytokines in HIV–CMV and/or HIV–EBV co-infections, especially in children.
In Pakistan, HIV exists as a concentrated epidemic in several key population groups, such as people who inject drugs (PWID), men who have sex with men (MSM), etc. [22,23,24]. Unfortunately, very little is known about the HIV epidemic in the pediatric population, and, before the April 2019 outbreak and over 13 years, only 1041 children were registered for HIV treatment [25]. The 2019 HIV outbreak in Larkana exposed a large number of HIV-positive children who acquired HIV through contaminated needles [25,26,27,28,29,30]. However, nothing is known about viral (EBV/CMV) co-infections and associated immunological changes among these children. The aim of this study was, therefore, to investigate the rate of active EBV and CMV infection in the retrospectively collected HIV samples from the 2019 Larkana outbreak, followed by a comparative assessment of the expression of eight key cytokines in HIV mono- and CMV/EBV co-infected groups.

2. Materials and Methods

2.1. Study Design and Samples

This was a retrospective cross-sectional study, conducted on a total of 319 samples previously collected from HIV-positive children from Larkana, Pakistan, between April and July 2019 as part of the 2019 HIV outbreak investigation [25,26,27,29]. The study was conducted after obtaining written informed assent from participants and informed consent from the parents/guardians. This study was approved by the Aga Khan University Ethical Review Committee (ERC# 2021-6809-20076 and 2019-1536-4200). The data relating to HIV viral loads and CD4 counts (performed at the time of sample collection in 2019) were obtained from patients’ medical records. At the time of sample collection, most of the participants (84.4%) were receiving ART, for a median of 41 days, with the treatment regimen comprising nevirapine, lamivudine, and zidovudine, while 15.6% were ART naïve [29]. Prior to sample collection, the HIV status of the participants was unknown.

2.2. Nucleic Acid (DNA and RNA) Extraction and cDNA Synthesis

DNA/RNA were previously extracted from PBMCs using Qiagen’s QIAamp DNA blood mini kit and TRIzol reagent (Gibco, Invitrogen Corporation, Waltham, MA, USA), respectively, as per the manufacturer’s instructions [24]. The DNA and RNA samples were stored at −20 °C and −80 °C, respectively, until further processing. Approximately 500 ng of RNA was reverse transcribed by using OneScript® Plus cDNA Synthesis Kit, ABM, Canada (Cat#G236), as per the manufacturer’s instructions.

2.3. Quantitative PCR for Detection of CMV and EBV

The DNA samples were used to detect CMV and EBV using a q-PCR strategy. For the detection of CMV and EBV, 10 μL reaction mixture was prepared using the following recipe: 1 μL of DNA, 0.3 μL (0.3 μM) of each primer (forward and reverse), 5 μL of BlasTaq™ 2X PCR master mix (ABM, Canada, cat# G891), and Nuclease Free Water to make up the volume. The sequence of forward and reverse primers for EBV were: 5′-GCTTAGCCAGTAACCCAGCACT-3′ and 5′-TGCTTAGAAGGTTGTTGGCATG-3′, respectively, while the sequence of forward and reverse primers for CMV were: 5′-GCGCGTACCGTTGAAAGAAAAGCATAA-3′ and 5′-TGGGCACTCGGGTCTTCATCTCTTTAC-3′, respectively. CFX96™ Real-Time PCR System (BIO-RAD, USA) was used to perform the qPCR reaction, using the following thermal-cycling protocol: 10 min at 95 °C, 40 cycles of 15 s at 95 °C, and 30 s at 58 °C. Melt curve (55–95 °C) analysis was performed at the end of 40 cycles to confirm the specificity of the PCR products. All reactions were run in triplicate. β-actin was used as a housekeeping gene. Additionally, non-template control (NTC) was included on each plate for each primer’s control. The B95.8 (extracted DNA) and known CMV-positive DNA sample served as a positive control for EBV and CMV, respectively.

2.4. Quantitative PCR for Assessment of Cytokine Expression in HIV Mono- and CMV/EBV Co-Infected Samples

Based on EBV and CMV screening, the samples were categorized into four groups: (a) HIV+ (mono-infected), (b) HIV+/CMV+, (c) HIV+/EBV+, and (d) HIV+/CMV+/EBV+ (co-infected). For cytokine analysis, all samples from HIV+/CMV+ and HIV+/CMV+/EBV+ groups were tested, while 50/58 HIV+ and 50/255 HIV+/EBV+ samples were tested based on 18–80% incidence (derived from case incidence in this study), 80% power, and 95% confidence interval, which represents the true population characteristics [31].
For cytokine analysis, 10 μL sample reaction mix was prepared using the following recipe: 5 μL of BlasTaq™ 2X PCR Master Mix (cat# G891, ABM, Canada), 1 μL of primer mix (10 μM forward and reverse primers; Table 1), 1 μL cDNA, and 2 μL of nuclease-free H2O. The qPCR reaction was performed using the following thermal-cycling protocol: 3 min at 95 °C, 40 cycles of 15 s at 95 °C, and 58 °C for 30 s. Melt curve (55–95 °C) analysis was performed at the end of 40 cycles to confirm the specificity of the PCR products. All reactions were run in duplicate. β-actin was used as a housekeeping gene to normalize the expression of cytokines. Additionally, non-template/non-primer control (NTC/NPC) was included on each plate as a negative control for each primer. This strategy has been optimized previously in our laboratory [32,33,34]. The cytokine expression was determined using the ΔCt method [35,36].

2.5. Statistical Analysis

An unpaired T-test was applied to measure the significant difference in the mean HIV viral load, CD4+ cell count, and cytokine gene expression between each of the four groups. Similarly, Pearson correlation was employed to analyze the correlation between cytokine expressions in each group. SPSS version 20 was used for all statistical analyses, where a p < 0.05 was considered to be significant.

3. Results

3.1. Study Subjects and EBV and CMV Status

Out of the 319 subjects, 18% (n = 58) were found to be HIV mono-infected, while 79.9% (n = 255), 38.9% (n = 124), and, out of these, 18.5% (n = 59) were found co-infected with EBV, CMV, and both CMV and EBV, respectively.
The highest mean HIV viral load was observed in the HIV–EBV co-infected group, while the lowest mean HIV viral (341 copies/mL) load was observed in CMV co-infected patients (Table 2). The CD4 count in all four groups ranged from 1094 to 1144 cells/ mm3 (Table 2). The statistical analysis showed no significant difference in CD4 count in all four groups.

3.2. Differential Expression of Cytokines in HIV Mono- and Co-Infected Groups

The overall analysis showed decreased mRNA expression of IL−1β, −4, −6, −10, and TNF−α, while there was increased IL−2 expression in all four groups (Figure 1 and Supplementary File). Analysis of differential cytokine mRNA expression showed IFN−γ to be significantly decreased in the HIV mono-infected group (−0.82 ± 8.12), while it was increased in all other three co-infected groups (HIV+/CMV+ = 1.61 ± 1.25; HIV+/EBV+ = 1.30 ± 1.85; and HIV+/CMV+/EBV+ = 1.25 ± 1.58; Figure 1). Similarly, the expression of TGF-β1 was found to be significantly decreased in HIV mono-infected (−5.65 ± 14.92) and HIV–CMV–EBV co-infected (−2.68 ± 14.59) groups, while it was increased in HIV–CMV (4.32 ± 0.98) and HIV–EBV (4.25 ± 2.37) co-infected groups.
The 2(−ΔΔCt) analysis showed the expression of IFN-γ to be ~5-, ~4-, and ~4-fold higher in HIV/CMV, HIV/EBV, and HIV/CMV/EBV co-infected groups, respectively, as compared to mono-infected groups. Similarly, the TGF-β1 expression was found to be ~1000-, ~956-, and ~8-fold higher in HIV/CMV, HIV/EBV, and HIV/CMV/EBV co-infected groups, respectively, as compared to mono-infected groups (Figure 2).

3.3. Correlation between Differentially Expressed Cytokines in HIV Mono- and Co-Infected Groups

Since IFN-γ and TGF- β1 were found to be differentially expressed in mono- and co-infected groups, in the next step, we determined the correlation between the gene expression of IFN-γ and TGF- β1 and other cytokines in all four groups independently in order to identify the influence (positive or negative) of one cytokine to another [37,38]. In the HIV mono-infected group, a significant positive correlation was observed between IFN-γ and IL-2 (r = 0.37, p = 0.008), and IFN-γ and IL-10 (r = 0.30, p = 0.033). Similarly, expression of TGF-β1 and IL-4 (r = 0.63, p = 0.00), TGF-β1 and IL-10 (r = 0.54, p = 0.00), and TGF-β1 and TNF-α (r = 0.48, p = 0.00) were also positively correlated (Table 3).
In the HIV+/EBV+ group, a significant positive correlation was observed between IFN-γ and IL-1β (r = 0.49, p = 0.00), IFN-γ and IL-2 (r = 0.68, p = 0.00), IFN-γ and IL-10 (r = 0.49, p = 0.00), and IFN-γ and TNF-α (r = 0.535, p = 0.00). Similarly, TGF-β1 and IFN-γ (r = 0.32, p = 0.023), and TGF-β1 and IL-2 (r = 0.37, p = 0.008) were also positively correlated (Table 3).
In the HIV/CMV/EBV triple co-infected group, IFN-γ and IL-2 (r = 0.501, p = 0.00), IFN-γ and IL-4 (r = 0.45, p = 0.00), TGF-β1 and IFN-γ (r = 0.501, p = 0.00), TGF-β and IL-1β (r = 0.37, p = 0.003), TGF-β and IL-4 (r = 0.38, p = 0.002), TGF-β and IL-6 (r = 0.40, p = 0.002), and TGF-β and IL-10 (r = 0.37, p = 0.003) were positively correlated (Table 3). No significant positive or negative correlation was observed in the HIV/CMV group.

4. Discussion

In this study, we investigated the rate of active EBV and CMV infection in the samples collected from HIV-positive children during the 2019 Larkana outbreak. Subsequently, we performed a comparative assessment of cytokine expression in HIV mono-infected and HIV/CMV/EBV co-infected samples.
The majority (80%) of the HIV-positive children were found to be co-infected with EBV, while ~40% with CMV, and, out of these, 18.5% with both EBV and CMV. Variable prevalence of CMV in HIV-positive patients has been reported from different parts of the world, for example, 32.4% (adults; age: 19.5–41.5 years) in India [39], 94% (both children and adults; age: 3–58 years) in Iran [40], 12.1% (infants) in Nigeria [41], 79% (age: 6-week-old infants) in Zimbabwe [42], and 10.3% (neonates) in France [43]; however, contrary to reported prevalence worldwide, we observed a CMV infection rate of about 40% in HIV-positive children from our cohort. Conversely, a high rate (80%) of EBV co-infection was observed in our cohort, which matches the rates reported in North India (62%) [44] and the Netherlands (64%) [45], while it is higher than the rates reported in Kenya (38.6%) [46]. Previous studies from the US and Zimbabwe have reported co-infection of CMV and EBV with HIV separately [47,48]. A research study conducted on Kenyan infants (HIV-infected) observed 93.9% of the infants to be simultaneously co-infected with CMV and EBV, pointing to common transmission risk factors [42]. In Pakistan, few studies have reported HIV prevalence in children [23,25]; however, to the best of our knowledge, no study has reported the rate of active CMV and EBV infection in HIV-positive children. Our study, therefore, is the first report to describe high EBV and CMV infection rates in HIV-infected Pakistani children.
In the next step, we analyzed the differences in HIV viral load and CD4 count between HIV mono- and co-infected groups. The CD4 counts were comparable between the mono- and co-infected groups; however, the HIV viral load was found to be significantly lower (p-value < 0.0001) among HIV–CMV and HIV–CMV–EBV as compared to the HIV mono-infected group. Santos et al. reported a high prevalence of EBV in HIV-seropositive individuals and showed that HIV viral load was a key factor for EBV (type 1 and 2) co-infection [49]. Similarly, another study found HIV viral load to be the risk factor for CMV co-infection [50]. It is speculated that, during herpesvirus/HIV co-infection, CD4 T cell proliferation increases, thereby expanding the target cell type susceptibility to HIV infection, resulting in a high HIV viral load [51,52,53,54].
To date, limited studies have analyzed the differential expression of cytokines in HIV-infected children co-infected with CMV and EBV. Therefore, in this study, we investigated the differential expression of cytokine transcripts (both pro- and anti-inflammatory) in HIV mono-infected and co-infected with CMV and EBV children. We found the expression level of IFN-γ to be significantly decreased in HIV mono-infection groups, while it was increased in HIV co-infected children. It is hypothesized that infants/neonates have reduced IFN-γ-producing cells and IFN-γ levels [55], which, however, increases with age in HIV-infected patients [56]. IFN-γ is essential for the regulation of chronic and latent infection of herpes virus (alpha, beta, and gamma) [57,58,59]. Infection with CMV, in particular, has been shown to induce a significant expression of IFN-γ and other Th1 cytokines by effector CMV-specific effector T cells [60]. Similarly, studies have also shown a correlation between increased IFN-γ levels and EBV reactivation [61,62]. Limited studies have reported the expression of IFN-γ in HIV and CMV/EBV co-infection. The decreased IFN-γ observed in the mono-infected group may be attributed to the acute or early chronic phase of HIV infection [63], while the presence of herpes virus co-infection may lead to increased IFN-γ and Th-1 response, which is also supported by correlation analysis, where IFN-γ expression correlated with IL-2 and TGF- β1.
Interestingly, in the HIV mono- and HIV–CMV–EBV triple co-infection group, TGF-β1 expression levels were significantly lower, but they were higher in HIV–CMV and HIV–EBV co-infection groups. TGF-β1 production in HIV infection has varied kinetics depending on the cell type, which raises the possibility that TGF-β1 might play both positive and deleterious functions during infection. TGF-β1 has shown to be rapidly and systemically generated after acute HIV-1 infection and is maintained at an elevated level [64]. The concentration of TGF-β1 is linked with HIV disease progression; as the disease progresses, the TGF-β1 levels also increase [65,66]. CMV infection increases immunological tolerance in an immunocompromised environment by boosting TGF-1 transcription and release and suppressing cytotoxic Th1 cells [67,68,69]. Similarly, EBV cell lines generate TGF-1 and are resistant to TGF-1-mediated apoptosis and growth inhibition, which aids in the proliferation of EBV-infected cells [70]. It has been reported that other co-infection with HIV causes a significant increase in TGF-β1 levels [71,72]. Our study also showed an increase in TGF-β1 levels in the HIV/CMV/EBV co-infected group, which may enhance the CMV/EBV infection [73].
We identify certain limitations of this study. Firstly, the sample size of HIV/CMV co-infected patients was very low in this cohort. A comparison with a higher number of HIV/CMV samples might affect the outcomes related to the markers of HIV disease progression (CD4 count and viral loads) and/or cytokine expression. Secondly, due to the availability of only DNA and RNA samples (and the absence of serum/plasma samples), serological detection of CMV and EBV could not be performed. Due to the same reason, we could only analyze the mRNA expression of cytokines and not the protein expression. However, it is important to note that numerous studies have investigated changes in cytokine expression at the mRNA levels only and have reported differential cytokine gene expression [74,75].

5. Conclusions

In conclusion, the high co-infection with CMV and EBV in HIV-positive children may affect the HIV viral loads and expression of certain cytokines (IFN-γ and TGF-β1), which may affect the HIV disease dynamics. Further mechanistic understanding of the involvement of herpes viruses in HIV-positive children may provide insights into disease pathogenesis.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/v14081823/s1, Supplementary File.

Author Contributions

Conceptualization, S.H.A.; methodology, F.N., H.A.K., A.A.N. and F.M.; formal analysis, F.N. and S.H.A.; outbreak investigation, A.A.N., F.M. and S.H.A.; writing—original draft preparation, F.N. and H.A.K.; writing—review and editing, S.H.A.; supervision and funding acquisition, S.H.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Higher Education Commission (grant no. 5217/Sindh/NRPU/R&D/HEC/2016), Pakistan Science Foundation (grant no. PSF/Res/S-AKU/Med (488)), and World Health Organization (grant 2019/969219-0).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the Aga Khan University Ethical Review Committee (ERC# 2021-6809-20076 and 2019-1536-4200).

Informed Consent Statement

The study was conducted after obtaining written informed assent from participants and informed consent from the parents/guardians. Written informed consent has been obtained from the patient(s) to publish this paper.

Data Availability Statement

The data are available within the manuscript or its Supplementary Files.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Hunt, P.W. HIV and Inflammation: Mechanisms and Consequences. Curr. HIV/AIDS Rep. 2012, 9, 139–147. [Google Scholar] [CrossRef] [PubMed]
  2. Freeman, M.L.; Lederman, M.M.; Gianella, S. Partners in Crime: The Role of CMV in Immune Dysregulation and Clinical Outcome During HIV Infection. Curr. HIV/AIDS Rep. 2016, 13, 10–19. [Google Scholar] [CrossRef] [PubMed]
  3. Cannon, M.J.; Schmid, D.S.; Hyde, T.B. Review of cytomegalovirus seroprevalence and demographic characteristics associated with infection. Rev. Med Virol. 2010, 20, 202–213. [Google Scholar] [CrossRef] [PubMed]
  4. Zhang, Q.; Gao, Y.; Peng, Y.; Fu, M.; Liu, Y.-Q.; Zhou, Q.-J.; Yu, J.; Zheng, X.-Q. Epidemiological survey of human cytomegalovirus antibody levels in children from Southeastern China. Virol. J. 2014, 11, 123. [Google Scholar] [CrossRef]
  5. Bolis, V.; Karadedos, C.; Chiotis, I.; Chaliasos, N.; Tsabouri, S. Atypical manifestations of Epstein–Barr virus in children: A diagnostic challenge. J. Pediatr. 2016, 92, 113–121. [Google Scholar] [CrossRef]
  6. Adland, E.; Klenerman, P.; Goulder, P.; Matthews, P.C. Ongoing burden of disease and mortality from HIV/CMV coinfection in Africa in the antiretroviral therapy era. Front. Microbiol. 2015, 6, 1016. [Google Scholar] [CrossRef]
  7. de Oliveira, J.L.; Freitas, R.T.; Arcuri, L.J.; Gomes, A.P.; Vitorino, R.R.; Rodrigues, D.C.; de Paula, S.O.; Santana, L.A.; Siqueira-Batista, R. O vírus Epstein-Barr e a mononucleose infecciosa. Rev. Bras. Clin. Med. São Paulo 2012, 10, 535–543. [Google Scholar]
  8. Miller, C.S.; Berger, J.R.; Mootoor, Y.; Avdiushko, S.A.; Zhu, H.; Kryscio, R.J. High prevalence of multiple human herpesviruses in saliva from human immunodeficiency virus-infected persons in the era of highly active antiretroviral therapy. J. Clin. Microbiol. 2006, 44, 2409–2415. [Google Scholar] [CrossRef]
  9. Ammatuna, P.; Campisi, G.; Giovannelli, L.; Giambelluca, D.; Alaimo, C.; Mancuso, S.; Margiotta, V. Presence of Epstein–Barr virus, cytomegalovirus and human papillomavirus in normal oral mucosa of HIV-infected and renal transplant patients. Oral Dis. 2001, 7, 34–40. [Google Scholar]
  10. Wang, X.; Yang, K.; Wei, C.; Huang, Y.; Zhao, D. Coinfection with EBV/CMV and other respiratory agents in children with suspected infectious mononucleosis. Virol. J. 2010, 7, 247. [Google Scholar] [CrossRef]
  11. Patekar, D.; Kheur, S.; More, P.; Hambire, C.; Kheur, M. Prevalence of viral coinfections with EBV and CMV and its correlation with CD4 count in HIV-1 serpositive patients. J. AIDS Clin. Res. 2015, 6, 6–9. [Google Scholar] [CrossRef]
  12. Robain, M.; Boufassa, F.; Hubert, J.-B.; Persoz, A.; Burgard, M.; Meyer, L. Cytomegalovirus seroconversion as a cofactor for progression to AIDS. Aids 2001, 15, 251–256. [Google Scholar] [CrossRef] [PubMed]
  13. Diaz-Mitoma, F.; Ruiz, A.; Flowerdew, G.; Houston, S.; Romanowski, B.; Kovithavongs, T.; Preiksaitis, J.; Tyrrell, D.L. High levels of Epstein-Barr virus in the oropharynx: A predictor of disease progression in human immunodeficiency virus infection. J. Med. Virol. 1990, 31, 69–75. [Google Scholar] [CrossRef] [PubMed]
  14. Hernández, D.M.; Valderrama, S.; Gualtero, S.; Hernández, C.; López, M.; Herrera, M.V.; Solano, J.; Fiorentino, S.; Quijano, S. Loss of T-Cell Multifunctionality and TCR-Vβ Repertoire Against Epstein-Barr Virus Is Associated with Worse Prognosis and Clinical Parameters in HIV+ Patients. Front. Immunol. 2018, 9, 2291. [Google Scholar] [CrossRef] [PubMed]
  15. Breen, E.C. Pro- and anti-inflammatory cytokines in human immunodeficiency virus infection and acquired immunodeficiency syndrome. Pharmacol. Ther. 2002, 95, 295–304. [Google Scholar] [CrossRef]
  16. Osborn, L.; Kunkel, S.; Nabel, G.J. Tumor necrosis factor alpha and interleukin 1 stimulate the human immunodeficiency virus enhancer by activation of the nuclear factor kappa B. Proc. Natl. Acad. Sci. USA 1989, 86, 2336–2340. [Google Scholar] [CrossRef]
  17. Kedzierska, K.; Crowe, S.M. Cytokines and HIV-1: Interactions and Clinical Implications. Antivir. Chem. Chemother. 2001, 12, 133–150. [Google Scholar] [CrossRef]
  18. Poli, G.; Kinter, A.L.; Justement, J.S.; Biswas, P.; Weissman, E.; Fox, L.M.; Goletti, D.; Bressler, P.; Stanley, S.K.; Fauci, A.S. The Chronically Infected Promonocytic Cell Line U1: A Model of HIV Expression Regulated by Cytokines. ImmunoMethods 1993, 3, 50–55. [Google Scholar] [CrossRef]
  19. Kaur, R.; Dhakad, M.S.; Goal, R.; Bhalla, P.; Dewan, R. Study of TH1/TH2 cytokine profiles in HIV/AIDS patients in a tertiary care hospital India. J. Med. Microbiol. Diagn. 2016, 5. [Google Scholar] [CrossRef]
  20. Theron, A.J.; Anderson, R.; Rossouw, T.; Steel, H.C. The Role of Transforming Growth Factor Beta-1 in the Progression of HIV/AIDS and Development of Non-AIDS-Defining Fibrotic Disorders. Front. Immunol. 2017, 8, 1461. [Google Scholar] [CrossRef]
  21. Lurain, N.S.; Robert, E.S.; Xu, J.; Camarca, M.; Landay, A.; Kovacs, A.A.; Reichelderfer, P.S. HIV Type 1 and Cytomegalovirus Coinfection in the Female Genital Tract. J. Infect. Dis. 2004, 190, 619–623. [Google Scholar] [CrossRef] [PubMed]
  22. Baqi, S.; Nabi, N.; Hasan, S.N.; Khan, A.J.; Pasha, O.; Kayani, N.; Haque, R.A.; Haq-IU; Khurshid, M.; Fisher-Hoch, S.; et al. HIV antibody seroprevalence and associated risk factors in sex workers, drug users, and prisoners in Sindh, Pakistan. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. Off. Publ. Int. Retrovirol. Assoc. 1998, 18, 73–79. [Google Scholar] [CrossRef] [PubMed]
  23. Raees, M.A.; Abidi, S.H.; Ali, W.; Khanani, M.R.; Ali, S. HIV among women and children in Pakistan. Trends Microbiol. 2013, 21, 213–214. [Google Scholar] [CrossRef] [PubMed]
  24. Waheed, Y.; Waheed, H.W.Y. Pakistan needs to speed up its human immunodeficiency virus control strategy to achieve targets in fast-track acquired immune deficiency syndrome response. World J. Virol. 2017, 6, 46–48. [Google Scholar] [CrossRef]
  25. Mir, F.; Mahmood, F.; Siddiqui, A.R.; Baqi, S.; Abidi, S.H.; Kazi, A.M.; Nathwani, A.A.; Ladhani, A.; Qamar, F.N.; Soofi, S.B.; et al. HIV infection predominantly affecting children in Sindh, Pakistan, 2019: A cross-sectional study of an outbreak. Lancet Infect. Dis. 2020, 20, 362–370. [Google Scholar] [CrossRef]
  26. Mir, F.; Nathwani, A.A.; Simms, V.; Abidi, S.H.; Siddiqui, A.R.; Hotwani, A.; Memon, S.A.; Shaikh, S.A.; Soomro, J.; Shah, S.A.; et al. Factors associated with HIV infection among children in Larkana District, Pakistan: A matched case-control study. Lancet HIV 2021, 8, e342–e352. [Google Scholar] [CrossRef]
  27. Siddiqui, A.R.; Nathwani, A.A.; Abidi, S.H.; Mahmood, S.F.; Azam, I.; Sawani, S.; Kazi, A.M.; Hotwani, A.; Memon, S.A.; Soomro, J.; et al. Investigation of an extensive outbreak of HIV infection among children in Sindh, Pakistan: Protocol for a matched case–control study. BMJ Open 2020, 10, e036723. [Google Scholar] [CrossRef]
  28. Rizwan-Ul-Hasan, S.; Farrukh, F.; Ahmed, S.; Abidi, S.H. A mathematical modeling approach to measure the probability of HIV-1 transmission for different high-risk groups of Pakistan. J. Infect. Dev. Ctries 2021, 15, 1212–1215. [Google Scholar] [CrossRef]
  29. Abidi, S.H.; Nduva, G.M.; Siddiqui, D.; Rafaqat, W.; Mahmood, S.F.; Siddiqui, A.R.; Nathwani, A.A.; Hotwani, A.; Shah, S.A.; Memon, S.; et al. Phylogenetic and Drug-Resistance Analysis of HIV-1 Sequences From an Extensive Paediatric HIV-1 Outbreak in Larkana, Pakistan. Front. Microbiol. 2021, 12, 2305. [Google Scholar] [CrossRef]
  30. Rizwan, S.; Abdullah, A.; Ahmed, S.; Shah, S.A.; Mir, F.; Abidi, S.H. Research Article Probabilistic measures of HIV-1 transmission in different HIV-1 key population groups of Larkana, Pakistan. J. Pak. Med. Assoc. 2021, 71, 617. [Google Scholar]
  31. Gupta, K.K.; Attri, J.P.; Singh, A.; Kaur, H.; Kaur, G. Basic concepts for sample size calculation: Critical step for any clinical trials! Saudi J. Anaesth. 2016, 10, 328. [Google Scholar] [CrossRef] [PubMed]
  32. Ahmed, M.A.; Anwar, M.F.; Ahmed, K.; Aftab, M.; Nazim, F.; Bari, M.F.; Mustafa, M.; Vohra, F.; Alrahlah, A.; Mughal, N.; et al. Baseline MMP expression in periapical granuloma and its relationship with periapical wound healing after surgical endodontic treatment. BMC Oral Health 2021, 21, 562. [Google Scholar] [CrossRef] [PubMed]
  33. Ahmed, K.; Sheikh, A.; Fatima, S.; Haider, G.; Ghias, K.; Abbas, F.; Mughal, N.; Abidi, S.H. Detection and characterization of latency stage of EBV and histopathological analysis of prostatic adenocarcinoma tissues. Sci. Rep. 2022, 12, 10399. [Google Scholar] [CrossRef] [PubMed]
  34. Ghulam, U.; Nazim, F.; Farooqui, N.; Anwar, M.F.; Jamal, A.; Keyani, H.A.; Mughal, N.; Hussain, A.; Abidi, S.H. Correlation of nasopharyngeal viral load and pro-inflammatory cytokines with COVID-19 disease severity. Res. Sq. 2022. [Google Scholar] [CrossRef]
  35. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  36. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  37. Young, S.; Fenn, J.; Arriero, E.; Lowe, A.; Poulin, B.; MacColl, A.D.; Bradley, J.E. Relationships between immune gene expression and circulating cytokine levels in wild house mice. Ecol. Evol. 2020, 10, 13860–13871. [Google Scholar] [CrossRef]
  38. Galgamuwa, L.S.; Sumanasena, B.; Iddawela, D.; Wickramasinghe, S.; Yatawara, L. Assessment of intralesional cytokine profile of cutaneous leishmaniasis caused by Leishmania donovani in Sri Lanka. BMC Microbiol. 2019, 19, 14. [Google Scholar] [CrossRef]
  39. Mujtaba, S.; Varma, S.; Sehgal, S. Cytomegalovirus co-infection in patients with HIV/AIDS in north India. Indian J. Med Res. 2003, 117, 99–103. [Google Scholar]
  40. Mehrkhani, F.; Jam, S.; Sabzvari, D.; Fattahi, F.; Kourorian, Z.; SeyedAlinaghi, S.; Jabbari, H.; Mohraz, M. Cytomegalovirus co-infection in patients with human immunodeficiency virus in Iran. Acta Med. Iran. 2011, 49, 551–555. [Google Scholar]
  41. Anigilaje, E.A.; Dabit, J.O.; Nweke, N.O.; Agbedeh, A.A. Prevalence and risk factors of cytomegalovirus infection among HIV-infected and HIV-exposed uninfected infants in Nigeria. J. Infect. Dev. Ctries. 2015, 9, 977–987. [Google Scholar] [CrossRef] [PubMed]
  42. Gumbo, H.; Chasekwa, B.; Church, J.A.; Ntozini, R.; Mutasa, K.; Humphrey, J.H.; Prendergast, A.J. Congenital and Postnatal CMV and EBV Acquisition in HIV-Infected Zimbabwean Infants. PLoS ONE 2014, 9, e114870. [Google Scholar] [CrossRef] [PubMed]
  43. Guibert, G.; Warszawski, J.; Le Chenadec, J.; Blanche, S.; Benmebarek, Y.; Mandelbrot, L.; Tubiana, R.; Rouzioux, C.; Leruez-Ville, M.; Cohort, F.P. Decreased Risk of Congenital Cytomegalovirus Infection in Children Born to HIV-1-Infected Mothers in the Era of Highly Active Antiretroviral Therapy. Clin. Infect. Dis. 2009, 48, 1516–1525. [Google Scholar] [CrossRef]
  44. Mujtaba, S.; Varma, S.; Sehgal, S. Coinfection with epstein barr virus in north Indian patients with HIV/AIDS. Indian J. Pathol. Microbiol. 2005, 48, 349–353. [Google Scholar] [PubMed]
  45. Stevens, S.J.; Blank, B.S.N.; Smits, P.H.M.; Meenhorst, P.L.; Middeldorp, J. High Epstein–Barr virus (EBV) DNA loads in HIV-infected patients: Correlation with antiretroviral therapy and quantitative EBV serology. AIDS 2002, 16, 993–1001. [Google Scholar] [CrossRef] [PubMed]
  46. Slyker, J.A.; Casper, C.; Tapia, K.; Richardson, B.; Bunts, L.; Huang, M.-L.; Maleche-Obimbo, E.; Nduati, R.; John-Stewart, G. Clinical and Virologic Manifestations of Primary Epstein-Barr Virus (EBV) Infection in Kenyan Infants Born to HIV-Infected Women. J. Infect. Dis. 2013, 207, 1798–1806. [Google Scholar] [CrossRef]
  47. Gianella, S.; Moser, C.; Vitomirov, A.; McKhann, A.; Layman, L.; Scott, B.; Caballero, G.; Lada, S.; Bosch, R.J.; Hoenigl, M.; et al. Presence of asymptomatic cytomegalovirus and Epstein--Barr virus DNA in blood of persons with HIV starting antiretroviral therapy is associated with non-AIDS clinical events. AIDS 2020, 34, 849–857. [Google Scholar] [CrossRef]
  48. Viljoen, J.; Tuaillon, E.; Nagot, N.; Danaviah, S.; Peries, M.; Padayachee, P.; Foulongne, V.; Bland, R.; Rollins, N.; Newell, M.-L.; et al. Cytomegalovirus, and possibly Epstein–Barr virus, shedding in breast milk is associated with HIV-1 transmission by breastfeeding. AIDS 2015, 29, 145–153. [Google Scholar] [CrossRef]
  49. Santos, L.; Azevedo, K.; Silva, L.; Oliveira, L. Epstein-Barr virus in oral mucosa from human immunodeficiency virus positive patients. Rev. Assoc. Méd. Bras. 2014, 60, 262–269. [Google Scholar] [CrossRef]
  50. Zhao, M.; Zhuo, C.; Li, Q.; Liu, L. Cytomegalovirus (CMV) infection in HIV/AIDS patients and diagnostic values of CMV-DNA detection across different sample types. Ann. Palliat. Med. 2020, 9, 2710–2715. [Google Scholar] [CrossRef]
  51. Piriou, E.; Jansen, C.A.; van Dort, K.; De Cuyper, I.; Nanlohy, N.M.; Lange, J.M.A.; van Oers, M.H.J.; Miedema, F.; van Baarle, D. Reconstitution of EBV Latent but Not Lytic Antigen-Specific CD4+and CD8+T Cells after HIV Treatment with Highly Active Antiretroviral Therapy. J. Immunol. 2005, 175, 2010–2017. [Google Scholar] [CrossRef] [PubMed]
  52. Lusso, P.; De Maria, A.; Malnati, M.; Lori, F.; DeRocco, S.E.; Baseler, M.; Gallo, R.C. Induction of CD4 and susceptibility to HIV-1 infection in human CD8+ T lymphocytes by human herpesvirus 6. Nature 1991, 349, 533–535. [Google Scholar] [CrossRef] [PubMed]
  53. Ensoli, B.; Lusso, P.; Schachter, F.; Josephs, S.; Rappaport, J.; Negro, F.; Gallo, R.; Wong-Staal, F. Human herpes virus-6 increases HIV-1 expression in co-infected T cells via nuclear factors binding to the HIV-1 enhancer. EMBO J. 1989, 8, 3019–3027. [Google Scholar] [CrossRef] [PubMed]
  54. Lusso, P.; Ensoli, B.; Markham, P.D.; Ablashi, D.V.; Salahuddin, S.Z.; Tschachler, E.; Wong-Staal, F.; Gallo, R.C. Productive dual infection of human CD4+ T lymphocytes by HIV-1 and HHV-6. Nature 1989, 337, 370–373. [Google Scholar] [CrossRef] [PubMed]
  55. Wilson, C.B.; Westall, J.; Johnston, L.; Lewis, D.B.; Dower, S.K.; Alpert, A.R. Decreased production of interferon-gamma by human neonatal cells. Intrinsic and regulatory deficiencies. J. Clin. Investig. 1986, 77, 860–867. [Google Scholar] [CrossRef]
  56. Lohman, B.L.; Slyker, J.A.; Richardson, B.A.; Farquhar, C.; Mabuka, J.M.; Crudder, C.; Dong, T.; Obimbo, E.; Mbori-Ngacha, D.; Overbaugh, J.; et al. Longitudinal Assessment of Human Immunodeficiency Virus Type 1 (HIV-1)-Specific Gamma Interferon Responses during the First Year of Life in HIV-1-Infected Infants. J. Virol. 2005, 79, 8121–8130. [Google Scholar] [CrossRef]
  57. Steed, A.L.; Barton, E.S.; Tibbetts, S.A.; Popkin, D.L.; Lutzke, M.L.; Rochford, R.; Virgin, H.W. Gamma Interferon Blocks Gammaherpesvirus Reactivation from Latency. J. Virol. 2006, 80, 192–200. [Google Scholar] [CrossRef]
  58. Presti, R.; Pollock, J.L.; Canto, A.J.D.; O’Guin, A.K.; Iv, H.W.V. Interferon γ Regulates Acute and Latent Murine Cytomegalovirus Infection and Chronic Disease of the Great Vessels. J. Exp. Med. 1998, 188, 577–588. [Google Scholar] [CrossRef]
  59. Minami, M.; Kita, M.; Yan, X.Q.; Yamamoto, T.; Iida, T.; Sekikawa, K.; Iwakura, Y.; Imanishi, J. Role of IFN-γ and tumor necrosis factor-α in herpes simplex virus type 1 infection. J. Interferon Cytokine Res. 2002, 22, 671–676. [Google Scholar] [CrossRef]
  60. La Rosa, C.; Diamond, D.J. The immune response to human CMV. Futur. Virol. 2012, 7, 279–293. [Google Scholar] [CrossRef]
  61. Cárdenas-Mondragón, M.G.; Torres, J.; Sánchez-Zauco, N.; Gómez-Delgado, A.; Camorlinga-Ponce, M.; Maldonado-Bernal, C.; Fuentes-Pananá, E.M. Elevated Levels of Interferon-γ Are Associated with High Levels of Epstein-Barr Virus Reactivation in Patients with the Intestinal Type of Gastric Cancer. J. Immunol. Res. 2017, 2017, 7069242. [Google Scholar] [CrossRef]
  62. Strong, M.; Xu, G.; Coco, J.; Baribault, C.; Vinay, D.S.; Lacey, M.; Strong, A.; Lehman, T.A.; Seddon, M.B.; Lin, Z.; et al. Differences in Gastric Carcinoma Microenvironment Stratify According to EBV Infection Intensity: Implications for Possible Immune Adjuvant Therapy. PLoS Pathog. 2013, 9, e1003341. [Google Scholar] [CrossRef] [PubMed]
  63. Leeansyah, E.; Malone, D.; Anthony, D.D.; Sandberg, J. Soluble biomarkers of HIV transmission, disease progression and comorbidities. Curr. Opin. HIV AIDS 2013, 8, 117–124. [Google Scholar] [CrossRef] [PubMed]
  64. Dickinson, M.; Kliszczak, A.E.; Giannoulatou, E.; Peppa, D.; Pellegrino, P.; Williams, I.; Drakesmith, H.; Borrow, P. Dynamics of Transforming Growth Factor (TGF)-β Superfamily Cytokine Induction During HIV-1 Infection Are Distinct From Other Innate Cytokines. Front. Immunol. 2020, 11, 3044. [Google Scholar] [CrossRef] [PubMed]
  65. Wiercińska-Drapalo, A.; Flisiak, R.; Jaroszewicz, J.; Prokopowicz, D. Increased Plasma Transforming Growth Factor-β1 Is Associated with Disease Progression in HIV-1-Infected Patients. Viral Immunol. 2004, 17, 109–113. [Google Scholar] [CrossRef]
  66. Maina, E.K.; Abana, C.; Bukusi, E.; Sedegah, M.; Lartey, M.; Ampofo, W. Plasma concentrations of transforming growth factor beta 1 in non-progressive HIV-1 infection correlates with markers of disease progression. Cytokine 2016, 81, 109–116. [Google Scholar] [CrossRef]
  67. El Baba, R.; Herbein, G. Immune Landscape of CMV Infection in Cancer Patients: From “Canonical” Diseases Toward Virus-Elicited Oncomodulation. Front. Immunol. 2021, 12, 3659. [Google Scholar] [CrossRef]
  68. Herbein, G. Tumors and Cytomegalovirus: An Intimate Interplay. Viruses 2022, 14, 812. [Google Scholar] [CrossRef]
  69. Michelson, S.; Alcami, J.; Kim, S.J.; Danielpour, D.; Bachelerie, F.; Picard, L.; Bessia, C.; Paya, C.; Virelizier, J.L. Human cytomegalovirus infection induces transcription and secretion of transforming growth factor beta 1. J. Virol. 1994, 68, 5730–5737. [Google Scholar] [CrossRef]
  70. Fukuda, M.; Ikuta, K.; Yanagihara, K.; Tajima, M.; Kuratsune, H.; Kurata, T.; Sairenji, T. Effect of Transforming Growth Factor-β1 on the Cell Growth and Epstein–Barr Virus Reactivation in EBV-Infected Epithelial Cell Lines. Virology 2001, 288, 109–118. [Google Scholar] [CrossRef]
  71. Blackard, J.T.; Pradel, F.; Perret, M.; Sodoyer, M.; Smeaton, L.; Clair, J.B.S.; Chapman, S.; Taylor, L.E.; Paranhos-Baccalà, G.; Chung, R.T. Intrahepatic cytokine expression is downregulated during HCV/HIV co-infection. J. Med Virol. 2006, 78, 202–207. [Google Scholar] [CrossRef] [PubMed]
  72. Lin, W.; Weinberg, E.M.; Tai, A.W.; Peng, L.F.; Brockman, M.A.; Kim, K.A.; Kim, S.S.; Borges, C.B.; Shao, R.-X.; Chung, R.T. HIV Increases HCV Replication in a TGF-β1–Dependent Manner. Gastroenterology 2008, 134, 803–811. [Google Scholar] [CrossRef] [PubMed]
  73. Kossmann, T.; Morganti-Kossmann, C.; Orenstein, J.M.; Britt, W.J.; Wahl, S.M.; Smith, P.D. Cytomegalovirus Production by Infected Astrocytes Correlates with Transforming Growth Factor-β Release. J. Infect. Dis. 2003, 187, 534–541. [Google Scholar] [CrossRef] [PubMed]
  74. El-Meguid, M.A.; Dawood, R.M.; Ibrahim, M.K.; Salum, G.M.; Alla, M.D.A.A.; El Awady, M.K. Reactivation of human cytomegalovirus inhibits expression of liver fibrosis related cytokines in patients chronically infected with hepatitis C virus genotype 4a. Microb. Pathog. 2020, 152, 104596. [Google Scholar] [CrossRef] [PubMed]
  75. Sampey, G.C.; Saifuddin, M.; Schwab, A.; Barclay, R.; Punya, S.; Chung, M.-C.; Hakami, R.M.; Zadeh, M.A.; Lepene, B.; Klase, Z.A.; et al. Exosomes from HIV-1-infected Cells Stimulate Production of Pro-inflammatory Cytokines through Trans-activating Response (TAR) RNA. J. Biol. Chem. 2016, 291, 1251–1266. [Google Scholar] [CrossRef] [PubMed]
Viruses 14 01823 g001 550
Figure 1. Mean ΔCt values of different cytokines in all four groups. The ΔCt values for different pro- and anti-inflammatory cytokines in HIV mono-infected and HIV–CMV, HIV–EBV, and HIV–CMV–EBV co-infected groups are shown. Solid lines above bars indicate a statistically significant difference (p < 0.05).
Figure 1. Mean ΔCt values of different cytokines in all four groups. The ΔCt values for different pro- and anti-inflammatory cytokines in HIV mono-infected and HIV–CMV, HIV–EBV, and HIV–CMV–EBV co-infected groups are shown. Solid lines above bars indicate a statistically significant difference (p < 0.05).
Viruses 14 01823 g001
Viruses 14 01823 g002 550
Figure 2. Fold change 2(−ΔΔCt) analysis of IFN-γ and TGF-β1 in EBV/CMV co-infected groups as compared to HIV mono-infected group.
Figure 2. Fold change 2(−ΔΔCt) analysis of IFN-γ and TGF-β1 in EBV/CMV co-infected groups as compared to HIV mono-infected group.
Viruses 14 01823 g002
Table
Table 1. Name of target genes and respective primer sets used to quantify mRNA levels in qPCR.
Table 1. Name of target genes and respective primer sets used to quantify mRNA levels in qPCR.
GeneForward Primer (5′ to 3′)Reverse Primer (5′ to 3′)
Β-actinGCGCGGCTACAGCTTCACTCCTTAATGTCACGCACGAT
IL-1βATGATGGCTTATTACAGTGGCAAGTCGGAGATTCGTAGCTGGA
IL-2GAAGATCGTCATGGGAAGAAGC CGGGTATTTATAGTGGCATGGG
IL-4CCAACTGCTTCCCCCTCTGTCTGTTACGGTCAACTCGGTG
IL-6ACTCACCTCTTCAGAACGAATTGCCATCTTTGGAAGGTTCAGGTTG
IL-10GACTTTAAGGGTTACCTGGGTTGTCACATGCGCCTTGATGTCTG
IFN-γTCGGTAACTGACTTGAATGTCCATCGCTTCCCTGTTTTAGCTGC
TNF-αGAGGCCAAGCCCTGGTATGCGGGCCGATTGATCTCAGC
TGF-β1CAATTCCTGGCGATACCTCAGGCACAACTCCGGTGACATCAA
Table
Table 2. Virological and clinical features of HIV mono- and HIV/CMV/EBV co-infected groups. The table shows the average Ct values for EBV and CMV in co-infected groups, as well as CD4 count and HIV viral loads in mono- and co-infected groups The p-values are given in the last column, where a significant p-value (p < 0.05) is indicated by *.
Table 2. Virological and clinical features of HIV mono- and HIV/CMV/EBV co-infected groups. The table shows the average Ct values for EBV and CMV in co-infected groups, as well as CD4 count and HIV viral loads in mono- and co-infected groups The p-values are given in the last column, where a significant p-value (p < 0.05) is indicated by *.
VariablesHIV+HIV/CMV/EBV+HIV/CMV+HIV/EBV+p-Value
CMV q-PCR (average Ct)-34.9433.71--
EBV q-PCR (average Ct)-33.37-34.52-
Mean HIV viral load42,396.224,154.30341.25147,030.210.001–0.002 *
Mean CD4 count114411331105.51093.920.6–0.9
Table
Table 3. Correlation of eight cytokines in HIV mono- and co-infected groups. Each column shows the R-value (the coefficient of correlation). Correlations with p < 0.05 are indicated with * and p < 0.01 are indicated with **.
Table 3. Correlation of eight cytokines in HIV mono- and co-infected groups. Each column shows the R-value (the coefficient of correlation). Correlations with p < 0.05 are indicated with * and p < 0.01 are indicated with **.
HIV+ Mono-Infected Group
CytokinesIL-1βIL-2IL-4IL-6IL-10IFN-γTNF-αTGF-β1
IFN-γ0.200.37 **−0.020.140.30 *-0.170.14
TGF-β0.060.110.63 **0.200.54 **0.140.48 **-
HIV+/CMV+ co-infected group
CytokinesIL-1βIL-2IL-4IL-6IL-10IFN-γTNF-αTGF-β1
IFN-γ0.430.71−0.770.430.03-−0.090.43
TGF-β−0.310.14−0.37−0.310.260.43−0.20-
HIV+/EBV+ co-infected group
CytokinesIL-1βIL-2IL-4IL-6IL-10IFN-γTNF-αTGF-β1
IFN-γ0.49 **0.68 **0.220.240.49 **-0.53 **0.32 *
TGF-β10.220.37 **0.030.260.100.32 *0.01-
HIV+/CMV+/EBV+ co-infected group
CytokinesIL-1βIL-2IL-4IL-6IL-10IFN-γTNF-αTGF-β1
IFN-γ0.140.50 **0.45 **0.28 *0.23-−0.200.50 **
TGF-β0.37 **0.180.38 **0.40 **0.37 **0.50 **0.15-
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Nazim, F.; Kayani, H.A.; Ali Nathwani, A.; Mir, F.; Abidi, S.H. CMV and EBV Co-Infection in HIV-Infected Children: Infection Rates and Analysis of Differential Expression of Cytokines in HIV Mono- and HIV–CMV–EBV Co-Infected Groups. Viruses 2022, 14, 1823. https://doi.org/10.3390/v14081823

AMA Style

Nazim F, Kayani HA, Ali Nathwani A, Mir F, Abidi SH. CMV and EBV Co-Infection in HIV-Infected Children: Infection Rates and Analysis of Differential Expression of Cytokines in HIV Mono- and HIV–CMV–EBV Co-Infected Groups. Viruses. 2022; 14(8):1823. https://doi.org/10.3390/v14081823

Chicago/Turabian Style

Nazim, Fizza, Hammad Afzal Kayani, Apsara Ali Nathwani, Fatima Mir, and Syed Hani Abidi. 2022. "CMV and EBV Co-Infection in HIV-Infected Children: Infection Rates and Analysis of Differential Expression of Cytokines in HIV Mono- and HIV–CMV–EBV Co-Infected Groups" Viruses 14, no. 8: 1823. https://doi.org/10.3390/v14081823

APA Style

Nazim, F., Kayani, H. A., Ali Nathwani, A., Mir, F., & Abidi, S. H. (2022). CMV and EBV Co-Infection in HIV-Infected Children: Infection Rates and Analysis of Differential Expression of Cytokines in HIV Mono- and HIV–CMV–EBV Co-Infected Groups. Viruses, 14(8), 1823. https://doi.org/10.3390/v14081823

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop