Next Article in Journal
Pharmacological Effects of Lactobacillus casei ATCC 7469 Fermented Soybean and Green Microalgae, Chlorella vulgaris, on Diabetic Rats
Previous Article in Journal
Multiplex Detection of Antimicrobial Resistance Genes for Rapid Antibiotic Guidance of Urinary Tract Infections
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microbiology Research
Volume 14
Issue 2
10.3390/microbiolres14020042
microbiolres-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Isolation of a Multidrug-Resistant vanA-Positive Enterococcus faecium Strain from a Canine Clinical Sample in Greece

by
Marios Lysitsas
1,
Eleftherios Triantafillou
2,
Ioannis Tzavaras
3,
Panagiota Karamichali
4,
Kiriakos Agathaggelidis
4,
Constantina N. Tsokana
1,
Esmeralda Dushku
5,
Anna Katsiaflaka
6,
Charalambos Billinis
1 and
George Valiakos
1,*
1
Faculty of Veterinary Science, University of Thessaly, 431 00 Karditsa, Greece
2
Vet Analyseis, Private Diagnostic Laboratory, 413 35 Larissa, Greece
3
Laboratory of Microbiology, C’ Military Veterinary Hospital, 570 01 Thessaloniki, Greece
4
Agathaggelidis Veterinary Clinic, 564 30 Thessaloniki, Greece
5
Veterinary Research Institute, ELGO-DIMITRA, 111 45 Athens, Greece
6
Department of Microbiology, General Hospital of Larissa, 412 21 Larissa, Greece
*
Author to whom correspondence should be addressed.
Microbiol. Res. 2023, 14(2), 603-613; https://doi.org/10.3390/microbiolres14020042
Submission received: 10 March 2023 / Revised: 9 April 2023 / Accepted: 28 April 2023 / Published: 30 April 2023
(This article belongs to the Special Issue Advances in Enterococcus Associated with Wildlife)
Browse Figure
Versions Notes

Abstract

:
An Enterococcus faecium strain was obtained from a paraprostatic cyst of a 17-year-old dog in Greece. Antibiotic susceptibility testing (AST) was accomplished by disc diffusion and MIC methods, and the isolate demonstrated a multidrug-resistant (MDR) phenotype against a great variety of antibiotics, such as β-Lactams, Quinolones, Macrolides, Tetracyclines, Rifampin, Nitrofurantoin, and surprisingly, Glycopeptides, Fosfomycin and Gentamicin (high-level). Molecular screening for Vancomycin resistance genes was carried out, and a vanA gene cluster was identified. To our knowledge, this is the first report of a vanA-positive E. faecium strain isolated from a companion animal in Greece. Importantly, this strain was related with the presence of paraprostatic cysts, a pathological condition requiring treatment. The presence of a highly resistant isolate in a canine clinical sample and the consequent need for treatment constitutes a new challenge for veterinarians due to the lack of available treatment options. Our findings indicate the occurrence of respective bacteria in companion animals, which could act as a reservoir of epidemic MDR strains or relevant mobile genetic elements (MGE) in the community, constituting a threat for public health.

1. Introduction

Enterococci are Gram-positive facultative anaerobic cocci that were classified as group D Streptococci until the 1980s [1]. They can be easily obtained from a wide variety of hosts [2]. There are at least 58 recognized species so far, with E. faecium and E. faecalis being more regularly associated with clinical infections [1]. These species are included in ESKAPE organisms (Enterococcus spp., Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter spp.) which, notably, have been demonstrated by World Health Organization (WHO) as a rising threat for public health due to multidrug resistance and the challenging nosocomial infections they cause [3].
Enterococci are commonly isolated from dogs, especially E. faecium and E. faecalis which are usually reported as the predominant species [4,5,6,7,8,9]. They have been associated with cases of canine pathological conditions, mainly urinary tract infections (UTIs) at a notable rate [10]. Furthermore, a matter of concern arises as multidrug-resistant strains are frequently isolated [8,9,10,11,12,13,14].
A variety of factors contribute to the acquisition of resistance in Enterococci. Concerning the antibiotics used in veterinary medicine, the most important aspects are described in Table 1.
Limited data exist on the detection of vancomycin-resistant Enterococci strains of canine origin worldwide. In this study, we report the first case of a vanA-positive E. faecium strain with MDR phenotype obtained from the paraprostatic cyst of a 17-year-old dog in Greece, and we discuss the challenges faced by veterinarians when dealing with MDR strains and rising public health concerns.

2. Materials and Methods

2.1. Origin of the Isolate

A 17-year-old, male mongrel dog was admitted to a veterinary clinic in Thessaloniki, Greece, in January 2023. The dog had an open fracture in the radius as a result of a car accident, which had occurred 25 days earlier (Supplementary File, Figure S1a). In the intervening period, the dog received an antibiotic treatment consisting of marbofloxacin and clindamycin for about 20 days. During the clinical examination, paraprostatic cysts were also detected and demonstrated using diagnostic imaging (Supplementary File, Figure S1b). Drainage of the cysts was carried out, samples were received and sent for investigation. Aerobic and anaerobic cultures were accomplished after inoculation on sheep blood agar and MacConkey agar and a 24 h incubation at 37 °C; Enterococcus spp. were isolated. The strain was initially identified by phenotypic and biochemical tests: Gram-positive cocci with characteristic colonial appearance (small colonies of approximately 1 mm with gamma-hemolysis), oxidase- and catalase-negative, aesculin-hydrolysis positive, no growth on MacConkey agar, and no sorbitol fermentation. Results were confirmed using the VITEK 2 biochemical identification system (Biomerieux, Supplementary File, Figure S2).

2.2. Antibiotic Susceptibility Testing

The disk diffusion method was used to evaluate susceptibility or resistance to a variety of antibiotics routinely tested in clinical samples of companion animals. Briefly, a colony of the strain was added to saline, and the resulting suspension was compared to a McFarland standard tube in order to achieve a 0.5 McFarland turbidity. The suspension was vortexed and, subsequently, a sterile swab was used to inoculate a quantity of it on the surface of Mueller–Hinton agar plates. Susceptibility discs were added, and the plates were incubated at 35 °C for 16–18 h. For the evaluation of Vancomycin zone diameter, a 24 h incubation period was essential. Due to the multidrug-resistant phenotype of the Enterococcus isolate, additional antibacterial agents were added to the antibiotic susceptibility test (AST). Consequently, the minimum inhibitory concentration (MIC) method was also evaluated (VITEK2, Biomerieux), including some antibacterial agents strictly used in human medicine, to confirm the previous results and to identify the isolate’s resistance profile. The contents of the disks, the zone diameter, and the MIC breakpoints, as specified by the CLSI documents [30,31], are available in Table 2.

2.3. Molecular Screening for Vancomycin-Resistance Genes

Whole genomic DNA extraction from the presumptive strain exhibiting Vancomycin resistance was performed using a commercial spin-column kit (NucleoSpin; Macherey-Nagel) according to the manufacturer’s instructions. Multiplex PCR analyses was performed by amplification with primers specific for the vanA, vanB, vanC1-C2, vanD, vanE, vanG, ddl-Enterococcus faecium and ddl-Enterococcus faecalis genes, as previously described (Table 3) [32,33]. Briefly, for the reaction, a 50 μL mix was used containing 5 μL 10× PCR buffer [10 mM Tris-HCl (pH 9.0), 50 mM KCl], 1.5 μL MgCl2 (50 mΜ), 2 μL dNTPs (10 mM, Nucleotide Mix), 2 μL of each of the primer pairs (10 μM), 0.3 μL (5 U/μL) Taq DNA Polymerase (Invitrogen, Carlsbad, CA 92008, USA), 2 μL of sample DNA and 7.2 μL nuclease-free water. For positive controls, Vancomycin-resistant Enterococcus reference strains were used (Institute Pasteur, France). Amplification was carried out in a T100 Thermal Cycler (Biorad, Hercules, CA, USA) under the following thermal cycling conditions: initial denaturation for 3 min at 94 °C and 30 cycles of amplification consisting of 1 min at 94 °C (denaturation), 1 min at 54 °C (annealing), and 1 min at 72 °C (elongation), with 7 min at 72 °C for the final extension. DNA products were identified by electrophoresis in 0.5 Tris-borate-EDTA on a 1.5% agarose gel stained with ethidium bromide solution.

3. Results

3.1. Antibiotic Susceptibility Testing

Results of the AST are presented in Table 4. Relevant images and reports are included in the Supplementary File (Figures S3 and S4). The isolate was multidrug-resistant (MDR). More specifically, it expressed a resistant phenotype against all the β-Lactams tested (Ampicillin, Amoxicillin–Clavulanate, Ampicillin–Sulbactam, Imipenem), Ciprofloxacin, Tetracycline, Doxycycline, Minocycline, Erythromycin, Rifampin, Fosfomycin, Nitrofurantoin, Vancomycin, Teicoplanin and Gentamicin (high-level).
Limited agents were effective in vitro against the E. faecium, such as Phenicols, Linezolid, Streptomycin (high-level), Daptomycin and Quinupristin/Dalfopristin.

3.2. Multiplex PCR

The isolate was identified as E. faecium. Moreover, the vanA gene cluster was detected, confirming the Glycopeptide-resistant phenotype (Figure 1). None of the other antibiotic resistance genes (ARGs) included in the test were identified (vanB, vanC1-C2, vanD, vanE, vanG).

4. Discussion

4.1. The Importance of Glycopeptide Resistance in a Canine Clinical Isolate

There are limited data about Vancomycin-resistant Enterococci in companion animals worldwide. To our knowledge, in Greece, this is:
  • The first report of a VREf isolate from a companion animal.
  • The first report of a VREf isolate causing an infection in any animal.
Additionally, this was the first Enterococcus spp. strain detected by the research team, among approximately 1072 isolates from clinical samples of companion animals, during the last five years, demonstrating Glycopeptide resistance, when tested by disc diffusion method.
Furthermore, the vanA-mediated high-level Glycopeptide-resistance of the strain, requires greater attention due to the co-current phenotypic resistances which were detected. This MDR profile is of major significance for two reasons.
Initially, there was a lack of available agents routinely used in veterinary practice for an effective treatment. For example, the respective CLSI document for veterinary isolates [31], in the breakpoints tables for Enterococcus spp., includes agents against which this isolate is phenotypically resistant (Penicillin, Ampicillin, Erythromycin, Rifampin, Vancomycin, Tetracycline, Doxycycline, Minocycline, Nitrofurantoin), with the exception of Chloramphenicol. Regarding Phenicols, even though they have been used in the past against Vancomycin-resistant Enterococci [34,35], their use is not regular nowadays (especially in human medicine) due to side effects (myellosupression, aplastic anaemia) and emerging resistance [36,37]. The identified high-level Gentamicin resistance is an additional notable aspect, as it is not usually observed in high rates among Enterococci of canine origin, even MDR strains or VRE [6,8,38,39,40,41].
Moreover, the colonization of companion animals with respective MDR strains creates concerns regarding the transmission of these bacteria to their owners due to their accommodation in household environments.
Regarding the current literature, VRE were isolated from canine samples in a number of studies worldwide [4,6,8,11,12,13,14,38,42,43,44,45], but in the majority of these cases, screening of normal faecal samples using specific media was performed in order to obtain the relevant strains, and the references of bacteria originated from clinical samples are undoubtetly limited [11,14,43,44].
These things considered, resistance to Vancomycin was not identified in several other studies including Enterococci populations of canine origin [10,39,40,41,46,47,48,49,50,51]. Even in cases of phenotypic resistance, the relevant genes were not always detected [52]. Furthermore, in some instances, the acquired mechanisms of resistance were not identified among VRE [53,54], as intrinsic resistance (low-level vanC1-mediated resistance) exists in specific species of Enterococci.

4.2. Possible Factors Enhancing the Prevalence of VRE in a Companion Animal

Several causes related to the generic prevalence of such stains in the community, host affecting factors and bacterial adjustment properties could provoke the colonization of a dog by VRE.
The use of the glycopeptide Avoparcin as a growth promoter in food-producing animals, until its prohibition (1997 in EU), was related with the emergence of VRE in animals worldwide [55]. Since more than 25 years have passed though, the effect of its use is hopefully not a significant current factor for the VREf prevalence.
Prior exposure to several antibiotics has been described to provoke VRE colonization of human patients in several studies. Vancomycin, Cephalosporins, Aminoglycosides, Carbapenems, and Antianaerobic Agents, such as clindamycin and metronidazole, are some of the main associated agents [56,57,58,59,60]. Moreover, co-selection of resistance and a genetic linkage between Vancomycin and Macrolides has been identified for E. faecium in livestock animals [61,62]. As Cephalosporines, Aminoglycosides, Macrolides, Metronidazole, and Clindamycin are agents widely used in companion animals, the danger of VRE colonization of dogs through a co-selection reinforced by other antibiotics is significant.
Horizontal transfer of MGE and spread of epidemic clones enhance the prevalence of MDR Enterococci worldwide. The identification of a variety of unique strains is supported by the hypothesis that Vancomycin resistance could have initially emerged more by horizontal spread of MGE carrying the vanA and, perhaps, vanB gene cluster, among enterococci, rather than by transmission of a few major clones [63,64,65]. However, the spread of specific related clones with nosocomial infections has occurred in the last few years, and many of them are well characterized [66,67,68]. Companion animals could become a factor in a circulation of such strains in a community, as is in some cases VRE isolates from dogs demonstrating similar genetic lineages to hospital-acquired infections in humans [11,38,43].
Moreover, Enterococci possess the ability to develop resistance by facilitating survival in the environment of the gastrointestinal track; therefore, through intestinal colonization, the rise and spread of a multidrug-resistant clone among different hosts becomes possible, indicating a serious challenge for public health [69,70].
In accordance with all these, the gastrointestinal colonization of the dog by the VREf isolate in this study is possible, as Enterococci are species commonly detected in canine flora [6,7,10] and the host’s own flora is usually the source of infection in prostatic and paraprostatic tissues [71,72]. The prior long-lasting antibiotic treatment could be a reinforcing factor, as the isolate is resistant to both Quinolones and Clindamycin and, therefore, its prevalence had been possibly enhanced by these agents. Finally, the presence of a mobile genetic element that could mediate an MDR phenotype to additional strains or the spreading of a specific hospital-associated MDR strain, as the animal is colonized, is definitely a matter of concern, indicating the need of surveillance in case of similar events.

4.3. Previous Research and Relevant Data in Greece

In the literature regarding VRE in Greece, data are mainly associated with human medicine and food-producing animals. In studies related to hospital environment, Vancomycin-resistant isolates were mostly identified as E. faecium with vanA-type resistance [73,74,75,76]. Furthermore, a link has been detected between VRE colonization and exposure to agents such as Vancomycin, Piperacillin–Tazobactam, Carbapenems, Antianaerobic Agents and Quinolones [75,77], while the duration of treatment with the respective antibiotics was an additional factor [77].
In reference to livestock animals, a 21.1% resistance rate to Vancomycin was detected in Enterococci isolated from raw pork meat from 2004 to 2007 [78]. Pigs, hospital and urban wastewater were screened for VRE in 2005–2006. VanA-positive E. faecium was dominant among the isolates, and a genetic diversity between Enterococci of different origins was identified [79]. In another study, samples from broilers and poultry slaughterers were collected during 2005–2008, and 130 VRE were recovered. The majority of these isolates were E. faecium harboring vanA gene, whilst no relationship was identified between poultry and the respective human-VREf clinical isolates originated from two hospitals in Greece [33].
Concluding, vanA-positive E. faecium seems to be the prevalent glycopeptide-resistant Enterococcus spp. encountered in the country and the main threat for public health. Mobile genetic elements are, rather, the cause of spreading of resistance, as genetic diversity is present among hospital-acquired and community strains. Finally, the induction of VREf colonization of hosts, is possibly related with prolonged usage of specific antibiotics.
The findings of our study are in accordance with these data, as a vanA-type VREf was isolated, the presence of a plasmid-mediated resistance is suspected, and a prior long-lasting treatment with clindamycin and marbofloxacin had occurred.
A noteworthy fact is that in the studies that referred to both human and animal samples, HLGR (which is identified in the isolate from this study) was related with hospital/human-associated strains, as it was rarely observed in samples of animal origin, and a significant statistical difference was detected [33,79].

4.4. Fosfomycin Resistance

A specific mention should be carried out for the Fosfomycin-resistant phenotype of this isolate, as it is an agent infrequently used in dogs, and, to our knowledge, the dog from this study had never received the antibiotic.
Fosfomycin has potentialities as an alternative agent against VRE, alone or combined with other agents [80,81,82,83,84]. In previous studies searching Fosfomycin resistance in VRE, it was mediated by the fosB gene (one or multiple copies) located in transferable plasmids, in all the isolates tested. A physical link between the fosB and Vancomycin ARGs (vanA or vanM) was detected, emphasizing the need of Fosfomycin-resistance surveillance in VRE [85,86,87,88]. Moreover, an amino acid substitution on the agent’s active site of MurA protein has been detected in VREf expressing high-level Fosfomycin resistance [89]. The Fosfomycin-resistant phenotype in this isolate indicates a possible occurrence of one of the previously described mechanisms. The presence of a plasmid co-conferring Fosfomycin and glycopeptide resistance would definitely be a more significant issue and should be further investigated.

5. Conclusions

The isolation of a VREf co-expressing resistance to a wide spectrum of antibiotics from a canine sample is undoubtedly a matter of concern. This highly resistant phenotype is rarely encountered in community strains, whereas it is more common in hospital-associated ones. Moreover, the site of the sample, a contaminated paraprostatic cyst, is indicative of the isolate’s origin from the host’s own flora. A possible colonization of companion animals by similar strains raises an issue for public health, enhancing the prevalence and the circulation of MDR epidemic strains and respective MGEs between pets, owners, and their environment. Variable factors could contribute to this spreading, such as the prolonged and excessive usage of antibacterial agents in human and veterinary medicine. Surveillance measures are essential for the accomplishment of a comprehensive investigation of these factors, which could provide us the appropriate preventive actions.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microbiolres14020042/s1, Figure S1: X-ray image from the dog; Figure S2. Vitek 2 Biochemical Identification Report; Figure S3. Petri dishes of Disc Diffusion Test; Figure S4. Vitek 2 MIC Report.

Author Contributions

Conceptualization, M.L., E.T. and I.T.; methodology, M.L., E.T. and I.T.; investigation, M.L., E.T., I.T., P.K., K.A., E.D. and A.K.; writing—original draft preparation, M.L. and I.T.; writing—review and editing, C.N.T., C.B. and G.V.; supervision, C.B. and G.V. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study is available in the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. García-Solache, M.; Rice, L.B. The Enterococcus: A Model of Adaptability to Its Environment. Clin. Microbiol. Rev. 2019, 32, e00058-18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Fiore, E.; Van Tyne, D.; Gilmore, M.S. Pathogenicity of Enterococci. Microbiol. Spectr. 2019, 7. [Google Scholar] [CrossRef]
  3. Zhen, X.; Lundborg, C.S.; Sun, X.; Hu, X.; Dong, H. Economic Burden of Antibiotic Resistance in ESKAPE Organisms: A Systematic Review. Antimicrob. Resist. Infect. Control 2019, 8, 137. [Google Scholar] [CrossRef] [Green Version]
  4. Devriese, L.A.; Ieven, M.; Goossens, H.; Vandamme, P.; Pot, B.; Hommez, J.; Haesebrouck, F. Presence of Vancomycin-Resistant Enterococci in Farm and Pet Animals. Antimicrob. Agents Chemother. 1996, 40, 2285–2287. [Google Scholar] [CrossRef] [Green Version]
  5. Iseppi, R.; Messi, P.; Anacarso, I.; Bondi, M.; Sabia, C.; Condò, C.; de Niederhausern, S. Antimicrobial resistance and virulence traits in Enterococcus strains isolated from dogs and cats. New Microbiol. 2015, 38, 369–378. [Google Scholar] [PubMed]
  6. Bertelloni, F.; Salvadori, C.; Lotti, G.; Cerri, D.; Ebani, V.V. Antimicrobial Resistance in Enterococcus Strains Isolated from Healthy Domestic Dogs. Acta Microbiol. Immunol. Hung. 2016, 64, 301–312. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Pillay, S.; Zishiri, O.T.; Adeleke, M.A. Prevalence of Virulence Genes in Enterococcus Species Isolated from Companion Animals and Livestock. Onderstepoort J. Vet. Res. 2018, 85, e1–e8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Iseppi, R.; Di Cerbo, A.; Messi, P.; Sabia, C. Antibiotic Resistance and Virulence Traits in Vancomycin-Resistant Enterococci (VRE) and Extended-Spectrum β-Lactamase/AmpC-Producing (ESBL/AmpC) Enterobacteriaceae from Humans and Pets. Antibiotics 2020, 9, 152. [Google Scholar] [CrossRef] [Green Version]
  9. Trościańczyk, A.; Nowakiewicz, A.; Gnat, S.; Łagowski, D.; Osińska, M. Are Dogs and Cats a Reservoir of Resistant and Virulent Enterococcus Faecalis Strains and a Potential Threat to Public Health? J. Appl. Microbiol. 2021, 131, 2061–2071. [Google Scholar] [CrossRef]
  10. Stępień-Pyśniak, D.; Bertelloni, F.; Dec, M.; Cagnoli, G.; Pietras-Ożga, D.; Urban-Chmiel, R.; Ebani, V.V. Characterization and Comparison of Enterococcus Spp. Isolates from Feces of Healthy Dogs and Urine of Dogs with UTIs. Animals 2021, 11, 2845. [Google Scholar] [CrossRef]
  11. Simjee, S.; White, D.G.; McDermott, P.F.; Wagner, D.D.; Zervos, M.J.; Donabedian, S.M.; English, L.L.; Hayes, J.R.; Walker, R.D. Characterization of Tn 1546 in Vancomycin-Resistant Enterococcus Faecium Isolated from Canine Urinary Tract Infections: Evidence of Gene Exchange between Human and Animal Enterococci. J. Clin. Microbiol. 2002, 40, 4659–4665. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Pasotto, D.; Dotto, G.; Menandro, M.L.; Mondin, A.; Martini, M. Prevalence and Antimicrobial-Resistance Characterization of Vancomycin Resistant Enterococci (VRE) Strains in Healthy Household Dogs in Italy. Int. J. Infect. Dis. 2016, 53, 50. [Google Scholar] [CrossRef] [Green Version]
  13. van den Bunt, G.; Top, J.; Hordijk, J.; de Greeff, S.C.; Mughini-Gras, L.; Corander, J.; van Pelt, W.; Bonten, M.J.M.; Fluit, A.C.; Willems, R.J.L. Intestinal Carriage of Ampicillin- and Vancomycin-Resistant Enterococcus Faecium in Humans, Dogs and Cats in the Netherlands. J. Antimicrob. Chemother. 2018, 73, 607–614. [Google Scholar] [CrossRef] [PubMed]
  14. Kwon, J.; Ko, H.J.; Yang, M.H.; Park, C.; Park, S.C. Antibiotic Resistance and Species Profile of Enterococcus Species in Dogs with Chronic Otitis Externa. Vet. Sci. 2022, 9, 592. [Google Scholar] [CrossRef]
  15. Bush, K.; Bradford, P.A. β-Lactams and β-Lactamase Inhibitors: An Overview. Cold Spring Harb. Perspect. Med. 2016, 6, a025247. [Google Scholar] [CrossRef]
  16. Sifaoui, F.; Arthur, M.; Rice, L.; Gutmann, L. Role of Penicillin-Binding Protein 5 in Expression of Ampicillin Resistance and Peptidoglycan Structure in Enterococcus faecium. Antimicrob. Agents Chemother. 2001, 45, 2594–2597. [Google Scholar] [CrossRef] [Green Version]
  17. Arbeloa, A.; Segal, H.; Hugonnet, J.E.; Josseaume, N.; Dubost, L.; Brouard, J.P.; Gutmann, L.; Mengin-Lecreulx, D.; Arthur, M. Role of class A penicillin-binding proteins in PBP5-mediated beta-lactam resistance in Enterococcus faecalis. J. Bacteriol. 2004, 186, 1221–1228. [Google Scholar] [CrossRef] [Green Version]
  18. Fontana, R.; Aldegheri, M.; Ligozzi, M.; Lopez, H.; Sucari, A.; Satta, G. Overproduction of a Low-Affinity Penicillin-Binding Protein and High-Level Ampicillin Resistance in Enterococcus faecium. Antimicrob. Agents Chemother. 1994, 38, 1980–1983. [Google Scholar] [CrossRef] [Green Version]
  19. Rice, L.B.; Bellais, S.; Carias, L.L.; Hutton-Thomas, R.; Bonomo, R.A.; Caspers, P.; Page, M.G.; Gutmann, L. Impact of specific pbp5 mutations on expression of beta-lactam resistance in Enterococcus faecium. Antimicrob. Agents Chemother. 2004, 48, 3028–3032. [Google Scholar] [CrossRef] [Green Version]
  20. Miller, W.R.; Munita, J.M.; Arias, C.A. Mechanisms of Antibiotic Resistance in Enterococci. Expert Rev. Anti Infect. Ther. 2014, 12, 1221–1236. [Google Scholar] [CrossRef]
  21. Reynolds, P.E. Structure, Biochemistry and Mechanism of Action of Glycopeptide Antibiotics. Eur. J. Clin. Microbiol. Infect. Dis. 1989, 8, 943–950. [Google Scholar] [CrossRef] [PubMed]
  22. Courvalin, P. Vancomycin Resistance in Gram-Positive Cocci. Clin. Infect. Dis. 2006, 42, S25–S34. [Google Scholar] [CrossRef] [PubMed]
  23. Stogios, P.J.; Savchenko, A. Molecular Mechanisms of Vancomycin Resistance. Protein Sci. 2020, 29, 654–669. [Google Scholar] [CrossRef] [PubMed]
  24. Vakulenko, S.B.; Donabedian, S.M.; Voskresenskiy, A.M.; Zervos, M.J.; Lerner, S.A.; Chow, J.W. Multiplex PCR for Detection of Aminoglycoside Resistance Genes in Enterococci. Antimicrob. Agents Chemother. 2003, 47, 1423–1426. [Google Scholar] [CrossRef] [Green Version]
  25. Chow, J.W. Aminoglycoside Resistance in Enterococci. Clin. Infect. Dis. 2000, 31, 586–589. [Google Scholar] [CrossRef] [Green Version]
  26. Chopra, I.; Roberts, M. Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiol. Mol. Biol. Rev. 2001, 65, 232–260. [Google Scholar] [CrossRef] [Green Version]
  27. López, M.; Tenorio, C.; Del Campo, R.; Zarazaga, M.; Torres, C. Characterization of the Mechanisms of Fluoroquinolone Resistance in Vancomycin-Resistant Enterococci of Different Origins. J. Chemother. 2011, 23, 87–91. [Google Scholar] [CrossRef]
  28. Kristich, C.J.; Wells, C.L.; Dunny, G.M. A Eukaryotic-Type Ser/Thr Kinase in Enterococcus Faecalis Mediates Antimicrobial Resistance and Intestinal Persistence. Proc. Natl. Acad. Sci. USA 2007, 104, 3508–3513. [Google Scholar] [CrossRef] [Green Version]
  29. Portillo, A.; Ruiz-Larrea, F.; Zarazaga, M.; Alonso, A.; Martinez, J.L.; Torres, C. Macrolide Resistance Genes in Enterococcus spp. Antimicrob. Agents Chemother. 2000, 44, 967–971. [Google Scholar] [CrossRef] [Green Version]
  30. CLSI. Performance Standards for Antimicrobial Susceptibillity Testing, 32nd ed.; Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2022; ISBN 978-1-68440-134-5. [Google Scholar]
  31. CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 6th ed.; Supplement VET01S; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2023. [Google Scholar]
  32. Depardieu, F.; Perichon, B.; Courvalin, P. Detection of the van Alphabet and Identification of Enterococci and Staphylococci at the Species Level by Multiplex PCR. J. Clin. Microbiol. 2004, 42, 5857–5860. [Google Scholar] [CrossRef] [Green Version]
  33. Tzavaras, I.; Siarkou, V.I.; Zdragas, A.; Kotzamanidis, C.; Vafeas, G.; Bourtzi-Hatzopoulou, E.; Pournaras, S.; Sofianou, D. Diversity of VanA-Type Vancomycin-Resistant Enterococcus Faecium Isolated from Broilers, Poultry Slaughterers and Hospitalized Humans in Greece. J. Antimicrob. Chemother. 2012, 67, 1811–1818. [Google Scholar] [CrossRef] [PubMed]
  34. Lautenbach, E.; Schuster, M.G.; Bilker, W.B.; Brennan, P.J. The Role of Chloramphenicol in the Treatment of Bloodstream Infection Due to Vancomycin-Resistant Enterococcus. Clin. Infect. Dis. 1998, 27, 1259–1265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Scapellato, P.G.; Ormazabal, C.; Scapellato, J.L.; Bottaro, E.G. Meningitis Due to Vancomycin-Resistant Enterococcus Faecium Successfully Treated with Combined Intravenous and Intraventricular Chloramphenicol. J. Clin. Microbiol. 2005, 43, 3578–3579. [Google Scholar] [CrossRef] [Green Version]
  36. Linden, P.K. Treatment Options for Vancomycin- Resistant Enterococcal Infections. Drugs 2002, 62, 425–441. [Google Scholar] [CrossRef]
  37. Lautenbach, E.; Gould, C.V.; LaRosa, L.A.; Marr, A.M.; Nachamkin, I.; Bilker, W.B.; Fishman, N.O. Emergence of Resistance to Chloramphenicol among Vancomycin-Resistant Enterococcal (VRE) Bloodstream Isolates. Int. J. Antimicrob. Agents 2004, 23, 200–203. [Google Scholar] [CrossRef] [PubMed]
  38. Herrero, I.A.; Fernández-Garayzábal, J.F.; Moreno, M.A.; Domínguez, L. Dogs Should Be Included in Surveillance Programs for Vancomycin-Resistant Enterococci. J. Clin. Microbiol. 2004, 42, 1384–1385. [Google Scholar] [CrossRef] [Green Version]
  39. De Graef, E.M.; Decostere, A.; Devriese, L.A.; Haesebrouck, F. Antibiotic Resistance among Fecal Indicator Bacteria from Healthy Individually Owned and Kennel Dogs. Microb. Drug Resist. 2004, 10, 65–69. [Google Scholar] [CrossRef]
  40. Leener, E.D.; Decostere, A.; De Graef, E.M.; Moyaert, H.; Haesebrouck, F. Presence and Mechanism of Antimicrobial Resistance among Enterococci from Cats and Dogs. Microb. Drug Resist. 2005, 11, 395–403. [Google Scholar] [CrossRef]
  41. Damborg, P.; Top, J.; Hendrickx, A.P.A.; Dawson, S.; Willems, R.J.L.; Guardabassi, L. Dogs Are a Reservoir of Ampicillin-Resistant Enterococcus Faecium Lineages Associated with Human Infections. Appl. Environ. Microbiol. 2009, 75, 2360–2365. [Google Scholar] [CrossRef] [Green Version]
  42. Van Belkun, A.; van den Braak, N.; Thomassen, R.; Verbrugh, H.; Endtz, H. Vancomycin-resistant enterococci in cats and dogs. Lancet 1996, 348, 1038–1039. [Google Scholar] [CrossRef]
  43. Manson, J.M.; Keis, S.; Smith, J.M.B.; Cook, G.M. Characterization of a Vancomycin-Resistant Enterococcus Faecalis (VREF) Isolate from a Dog with Mastitis: Further Evidence of a Clonal Lineage of VREF in New Zealand. J. Clin. Microbiol. 2003, 41, 3331–3333. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Abbott, Y.; Kirby, B.M.; Karczmarczyk, M.; Markey, B.K.; Leonard, F.C.; Fitzgerald, S. High-Level Gentamicin-Resistant and Vancomycin-Resistant Enterococcus Faecium Isolated from a Wound in a Dog. J. Small Anim. Pract. 2009, 50, 194–197. [Google Scholar] [CrossRef]
  45. Aslantaş, Ö.; Tek, E. Köpek ve Kedilerden Ampisilin ve Vankomisin Dirençli Enterococcus Faecium İzolasyonu. Kafkas Univ. Vet. Fak. Derg. 2018. [Google Scholar] [CrossRef]
  46. Rodrigues, J.; Poeta, P.; Martins, A.; Costa, D. The Importance of Pets as Reservoirs of Resistant Enterococcus Strains, with Special Reference to Vancomycin. J. Vet. Med. Ser. B 2002, 49, 278–280. [Google Scholar] [CrossRef] [PubMed]
  47. Delgado, M.; Neto, I.; Correia, J.H.D.; Pomba, C. Antimicrobial Resistance and Evaluation of Susceptibility Testing among Pathogenic Enterococci Isolated from Dogs and Cats. Int. J. Antimicrob. Agents 2007, 30, 98–100. [Google Scholar] [CrossRef] [PubMed]
  48. Jackson, C.R.; Fedorka-Cray, P.J.; Davis, J.A.; Barrett, J.B.; Frye, J.G. Prevalence, Species Distribution and Antimicrobial Resistance of Enterococci Isolated from Dogs and Cats in the United States: Enterococci from Dogs and Cats in the USA. J. Appl. Microbiol. 2009, 107, 1269–1278. [Google Scholar] [CrossRef]
  49. Chung, Y.S.; Kwon, K.H.; Shin, S.; Kim, J.H.; Park, Y.H.; Yoon, J.W. Characterization of Veterinary Hospital-Associated Isolates of Enterococcus Species in Korea. J. Microbiol. Biotechnol. 2014, 24, 386–393. [Google Scholar] [CrossRef] [Green Version]
  50. Kataoka, Y.; Umino, Y.; Ochi, H.; Harada, K.; Sawada, T. Antimicrobial Susceptibility of Enterococcal Species Isolated from Antibiotic-Treated Dogs and Cats. J. Vet. Med. Sci. 2014, 76, 1399–1402. [Google Scholar] [CrossRef] [Green Version]
  51. Jung, W.K.; Shin, S.; Park, Y.K.; Noh, S.M.; Shin, S.R.; Yoo, H.S.; Park, S.C.; Park, Y.H.; Park, K.T. Distribution and Antimicrobial Resistance Profiles of Bacterial Species in Stray Dogs, Hospital-Admitted Dogs, and Veterinary Staff in South Korea. Prev. Vet. Med. 2020, 184, 105151. [Google Scholar] [CrossRef]
  52. Rantala, M.; Lahti, E.; Kuhalampi, J.; Pesonen, S.; Järvinen, A.K.; Saijonmaa-Koulumies, L.; Honkanen-Buzalski, T. Antimicrobial resistance in Staphylococcus spp., Escherichia coli and Enterococcus spp. in dogs given antibiotics for chronic dermatological disorders, compared with non-treated control dogs. Acta Vet. Scand. 2004, 45, 37–45. [Google Scholar] [CrossRef]
  53. López, M.; Tenorio, C.; Torres, C. Study of Vancomycin Resistance in Faecal Enterococci from Healthy Humans and Dogs in Spain a Decade after the Avoparcin Ban in Europe: VRE From Healthy Dogs and Humans. Zoonoses Public Health 2013, 60, 160–167. [Google Scholar] [CrossRef] [PubMed]
  54. Funda BağcigïL, A.; İKïZ, S.; Ak, S.; Yakut Özgür, N. Hayvan Dışkılarından Vankomisin Dirençli Enterokokların İzolasyonu, Antimikrobiyal Direnç Profillerinin ve Vankomisin Direnç Genlerinin Saptanması. Kafkas Univ. Vet. Fak. Derg. 2015. [Google Scholar] [CrossRef]
  55. Bager, F.; Madsen, M.; Christensen, J.; Aarestrup, F.M. Avoparcin Used as a Growth Promoter Is Associated with the Occurrence of Vancomycin-Resistant Enterococcus Faecium on Danish Poultry and Pig Farms. Prev. Vet. Med. 1997, 31, 95–112. [Google Scholar] [CrossRef] [PubMed]
  56. Tornieporth, N.G.; Roberts, R.B.; John, J.; Hafner, A.; Riley, L.W. Risk Factors Associated with Vancomycin-Resistant Enterococcus Faecium Infection or Colonization in 145 Matched Case Patients and Control Patients. Clin. Infect. Dis. 1996, 23, 767–772. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Van der Auwera, P.; Pensart, N.; Korten, V.; Murray, B.E.; Leclercq, R. Influence of Oral Glycopeptides on the Fecal Flora of Human Volunteers: Selection of Highly Glycopeptide-Resistant Enterococci. J. Infect. Dis. 1996, 173, 1129–1136. [Google Scholar] [CrossRef]
  58. Fridkin, S.K.; Edwards, J.R.; Courval, J.M.; Hill, H.; Tenover, F.C.; Lawton, R.; Gaynes, R.P.; McGowan, J.E.; The Intensive Care Antimicrobial Resistance Epidemiology (ICARE) Project; The National Nosocomial Infections Surveillance (NNIS) System Hospitals. The Effect of Vancomycin and Third-Generation Cephalosporins on Prevalence of Vancomycin-Resistant Enterococci in 126 U.S. Adult Intensive Care Units. Ann. Intern. Med. 2001, 135, 175. [Google Scholar] [CrossRef]
  59. Ghanem, G.; Hachem, R.; Jiang, Y.; Chemaly, R.F.; Raad, I. Outcomes for and Risk Factors Associated With Vancomycin-Resistant Enterococcus Faecalis and Vancomycin-Resistant Enterococcus Faecium Bacteremia in Cancer Patients. Infect. Control Hosp. Epidemiol. 2007, 28, 1054–1059. [Google Scholar] [CrossRef]
  60. Crank, C.; O’Driscoll, T. Vancomycin-Resistant Enterococcal Infections: Epidemiology, Clinical Manifestations, and Optimal Management. Infect. Drug Resist. 2015, 8, 217–230. [Google Scholar] [CrossRef] [Green Version]
  61. Aarestrup, F.M. Characterization of Glycopeptide-Resistant Enterococcus Faecium (GRE) from Broilers and Pigs in Denmark: Genetic Evidence That Persistence of GRE in Pig Herds Is Associated with Coselection by Resistance to Macrolides. J. Clin. Microbiol. 2000, 38, 2774–2777. [Google Scholar] [CrossRef] [Green Version]
  62. Borgen, K.; Sørum, M.; Wasteson, Y.; Kruse, H.; Oppegaard, H. Genetic Linkage Between Erm (B) and VanA in Enterococcus Hirae of Poultry Origin. Microb. Drug Resist. 2002, 8, 363–368. [Google Scholar] [CrossRef]
  63. Bingen, E.H.; Denamur, E.; Lambert-Zechovsky, N.Y.; Elion, J. Evidence for the Genetic Unrelatedness of Nosocomial Vancomycin-Resistant Enterococcus Faecium Strains in a Pediatric Hospital. J. Clin. Microbiol. 1991, 29, 1888–1892. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Jensen, L.B.; Ahrens, P.; Dons, L.; Jones, R.N.; Hammerum, A.M.; Aarestrup, F.M. Molecular Analysis of Tn 1546 in Enterococcus Faecium Isolated from Animals and Humans. J. Clin. Microbiol. 1998, 36, 437–442. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Kühn, I.; Iversen, A.; Finn, M.; Greko, C.; Burman, L.G.; Blanch, A.R.; Vilanova, X.; Manero, A.; Taylor, H.; Caplin, J.; et al. Occurrence and Relatedness of Vancomycin-Resistant Enterococci in Animals, Humans, and the Environment in Different European Regions. Appl. Environ. Microbiol. 2005, 71, 5383–5390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. Mikalsen, T.; Pedersen, T.; Willems, R.; Coque, T.M.; Werner, G.; Sadowy, E.; van Schaik, W.; Jensen, L.B.; Sundsfjord, A.; Hegstad, K. Investigating the Mobilome in Clinically Important Lineages of Enterococcus faecium and Enterococcus faecalis. BMC Genom. 2015, 16, 282. [Google Scholar] [CrossRef] [Green Version]
  67. Tedim, A.P.; Lanza, V.F.; Manrique, M.; Pareja, E.; Ruiz-Garbajosa, P.; Cantón, R.; Baquero, F.; Coque, T.M.; Tobes, R. Complete Genome Sequences of Isolates of Enterococcus faecium Sequence Type 117, a Globally Disseminated Multidrug-Resistant Clone. Genome Announc. 2017, 5, e01553-16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Ahmed, M.O.; Baptiste, K.E. Vancomycin-Resistant Enterococci: A Review of Antimicrobial Resistance Mechanisms and Perspectives of Human and Animal Health. Microb. Drug Resist. 2018, 24, 590–606. [Google Scholar] [CrossRef] [Green Version]
  69. Murray, B. Diversity among Multidrug-Resistant Enterococci. Emerg. Infect. Dis. 1998, 4, 37–47. [Google Scholar] [CrossRef] [Green Version]
  70. Chavers, L.S.; Moser, S.A.; Benjamin, W.H.; Banks, S.E.; Steinhauer, J.R.; Smith, A.M.; Johnson, C.N.; Funkhouser, E.; Chavers, L.P.; Stamm, A.M.; et al. Vancomycin-Resistant Enterococci: 15 Years and Counting. J. Hosp. Infect. 2003, 53, 159–171. [Google Scholar] [CrossRef]
  71. Barsanti, J.A.; Finco, D.R. Canine Prostatic Diseases. Vet. Clin. N. Am. Small Anim. Pract. 1986, 16, 587–599. [Google Scholar] [CrossRef]
  72. Smith, J. Canine Prostatic Disease: A Review of Anatomy, Pathology, Diagnosis, and Treatment. Theriogenology 2008, 70, 375–383. [Google Scholar] [CrossRef]
  73. Souli, M.; Sakka, V.; Galani, I.; Antoniadou, A.; Galani, L.; Siafakas, N.; Zerva, L.; Fytrou, H.; Tsiodras, S.; Giamarellou, H. Colonisation with Vancomycin- and Linezolid-Resistant Enterococcus Faecium in a University Hospital: Molecular Epidemiology and Risk Factor Analysis. Int. J. Antimicrob. Agents 2009, 33, 137–142. [Google Scholar] [CrossRef] [PubMed]
  74. Protonotariou, E.; Dimitroulia, E.; Pournaras, S.; Pitiriga, V.; Sofianou, D.; Tsakris, A. Trends in Antimicrobial Resistance of Clinical Isolates of Enterococcus Faecalis and Enterococcus Faecium in Greece between 2002 and 2007. J. Hosp. Infect. 2010, 75, 225–227. [Google Scholar] [CrossRef] [PubMed]
  75. Papadimitriou-Olivgeris, M.; Drougka, E.; Fligou, F.; Kolonitsiou, F.; Liakopoulos, A.; Dodou, V.; Anastassiou, E.D.; Petinaki, E.; Marangos, M.; Filos, K.S.; et al. Risk Factors for Enterococcal Infection and Colonization by Vancomycin-Resistant Enterococci in Critically Ill Patients. Infection 2014, 42, 1013–1022. [Google Scholar] [CrossRef] [PubMed]
  76. Vasilakopoulou, A.; Karakosta, P.; Vourli, S.; Tarpatzi, A.; Varda, P.; Kostoula, M.; Antoniadou, A.; Pournaras, S. Gastrointestinal Carriage of Vancomycin-Resistant Enterococci and Carbapenem-Resistant Gram-Negative Bacteria in an Endemic Setting: Prevalence, Risk Factors, and Outcomes. Front. Public Health 2020, 8, 55. [Google Scholar] [CrossRef] [Green Version]
  77. Sakka, V.; Tsiodras, S.; Galani, L.; Antoniadou, A.; Souli, M.; Galani, I.; Pantelaki, M.; Siafakas, N.; Zerva, L.; Giamarellou, H. Risk-Factors and Predictors of Mortality in Patients Colonised with Vancomycin-Resistant Enterococci. Clin. Microbiol. Infect. 2008, 14, 14–21. [Google Scholar] [CrossRef] [Green Version]
  78. Gousia, P.; Economou, V.; Sakkas, H.; Leveidiotou, S.; Papadopoulou, C. Antimicrobial Resistance of Major Foodborne Pathogens from Major Meat Products. Foodborne Pathog. Dis. 2011, 8, 27–38. [Google Scholar] [CrossRef] [PubMed]
  79. Kotzamanidis, C.; Zdragas, A.; Kourelis, A.; Moraitou, E.; Papa, A.; Yiantzi, V.; Pantelidou, C.; Yiangou, M. Characterization of VanA -Type Enterococcus Faecium Isolates from Urban and Hospital Wastewater and Pigs. J. Appl. Microbiol. 2009, 107, 997–1005. [Google Scholar] [CrossRef] [PubMed]
  80. Allerberger, F. In-Vitro Activity of Fosfomycin against Vancomycin-Resistant Enterococci. J. Antimicrob. Chemother. 1999, 43, 211–217. [Google Scholar] [CrossRef] [Green Version]
  81. Perri, M.B.; Hershberger, E.; Ionescu, M.; Lauter, C.; Zervos, M.J. In Vitro Susceptibility of Vancomycin-Resistant Enterococci (VRE) to Fosfomycin. Diagn. Microbiol. Infect. Dis. 2002, 42, 269–271. [Google Scholar] [CrossRef]
  82. Shrestha, N.K.; Chua, J.D.; Tuohy, M.J.; Wilson, D.A.; Procop, G.W.; Longworth, D.L.; Isada, C.M.; Hall, G.S. Antimicrobial Susceptibility of Vancomycin-Resistant Enterococcus Faecium: Potential Utility of Fosfomycin. Scand. J. Infect. Dis. 2003, 35, 12–14. [Google Scholar] [CrossRef]
  83. Hall Snyder, A.D.; Werth, B.J.; Nonejuie, P.; McRoberts, J.P.; Pogliano, J.; Sakoulas, G.; Yim, J.; Singh, N.; Rybak, M.J. Fosfomycin Enhances the Activity of Daptomycin against Vancomycin-Resistant Enterococci in an In Vitro Pharmacokinetic-Pharmacodynamic Model. Antimicrob. Agents Chemother. 2016, 60, 5716–5723. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  84. Yan, Y.; Yang, G.; Li, Y.; Mao, J.; Wang, S.; Zhang, N.; Liu, H.; Huang, X. Factorial Design and Post-Antibiotic Sub-MIC Effects of Linezolid Combined with Fosfomycin against Vancomycin-Resistant Enterococci. Ann. Transl. Med. 2022, 10, 148. [Google Scholar] [CrossRef] [PubMed]
  85. Qu, T.-T.; Yang, Q.; Shen, P.; Wei, Z.-Q.; Yu, Y.-S. Novel Vancomycin-Resistance Transposon, Plasmid Replicon Types, and Virulence Factors of Vancomycin-Resistant Enterococci in Zhejiang, China. Microb. Drug Resist. 2012, 18, 183–188. [Google Scholar] [CrossRef] [PubMed]
  86. Xu, X.; Chen, C.; Lin, D.; Guo, Q.; Hu, F.; Zhu, D.; Li, G.; Wang, M. The Fosfomycin Resistance Gene FosB3 Is Located on a Transferable, Extrachromosomal Circular Intermediate in Clinical Enterococcus Faecium Isolates. PLoS ONE 2013, 8, e78106. [Google Scholar] [CrossRef] [PubMed]
  87. Qu, T.; Shi, K.; Ji, J.; Yang, Q.; Du, X.; Wei, Z.; Yu, Y. Fosfomycin Resistance among Vancomycin-Resistant Enterococci Owing to Transfer of a Plasmid Harbouring the FosB Gene. Int. J. Antimicrob. Agents 2014, 43, 361–365. [Google Scholar] [CrossRef]
  88. Sun, L.; Zhang, P.; Qu, T.; Chen, Y.; Hua, X.; Shi, K.; Yu, Y. Identification of Novel Conjugative Plasmids with Multiple Copies of FosB That Confer High-Level Fosfomycin Resistance to Vancomycin-Resistant Enterococci. Front. Microbiol. 2017, 8, 1541. [Google Scholar] [CrossRef] [Green Version]
  89. Guo, Y.; Tomich, A.D.; McElheny, C.L.; Cooper, V.S.; Tait-Kamradt, A.; Wang, M.; Hu, F.; Rice, L.B.; Sluis-Cremer, N.; Doi, Y. High-Level Fosfomycin Resistance in Vancomycin-Resistant Enterococcus faecium. Emerg. Infect. Dis. 2017, 23, 1902–1904. [Google Scholar] [CrossRef]
Microbiolres 14 00042 g001 550
Figure 1. Multiplex PCR gel electrophoresis image with positive controls (PC), negative controls (NC) and canine positive sample. L: Ladder; Line 1: E. faecalis vanG PC; Line 2: NC; Line 3: E. faecalis vanB PC; Line 4: E. faecium vanD PC; Line 5: NC; Line 6: E. gallinarum vanC PC; Line 7: E. faecalis vanΕ PC; Line 8: E. faecium vanA PC; Line 9: NC; Line 10: E. faecalis vanB PC; Line 11: canine positive sample.
Figure 1. Multiplex PCR gel electrophoresis image with positive controls (PC), negative controls (NC) and canine positive sample. L: Ladder; Line 1: E. faecalis vanG PC; Line 2: NC; Line 3: E. faecalis vanB PC; Line 4: E. faecium vanD PC; Line 5: NC; Line 6: E. gallinarum vanC PC; Line 7: E. faecalis vanΕ PC; Line 8: E. faecium vanA PC; Line 9: NC; Line 10: E. faecalis vanB PC; Line 11: canine positive sample.
Microbiolres 14 00042 g001
Table
Table 1. Main mechanisms of resistance in Enterococci.
Table 1. Main mechanisms of resistance in Enterococci.
Antibiotic ClassMain Mechanisms of Resistance 1References
Β-lactams• Production of PBPs 2 that demonstrate a lower binding affinity to agents of this class, such as Ampicillin and Cephalosporins.
• Overproduction or mutations of PBPs. 		[15,16,17,18,19,20]
GlycopeptidesAmino-acid substitutions in specific precursors of peptidoglycan, decreasing the binding affinity of glycopeptides to them by 7- to 1000-fold. A variety of respective gene clusters has been identified, such as vanA, vanB, vanC, vanD, vanE, vanG, vanL, vanM and vanN.[20,21,22,23]
AminoglycosidesEnzymatic inactivation of Gentamicin, Streptomycin, or both of them, mediated by acquired ARGs, confers high-level aminoglycoside resistance (HLAR) to Enterococci, while they are intrinsically resistant against the other agents of this class, escaping their bactericidal action by variable procedures.[20,24,25]
Tetracyclines• Ribosomal protection encoded by genes tet(M), tet(O) and tet(S) results in resistance against all the available agents of this class in veterinary medicine (Tetracycline, Doxycycline and Minocycline).
• Efflux proteins encoded by specific genes, such as tet(K) and tet (L) confer resistance against Tetracycline.		[26]
QuinolonesMutations of the target genes of the antibiotics, gyrA and parC, confer high-level acquired resistance, while Enterococci express low levels of resistance to Quinolones intrinsically.[20,27]
RifampinMutations of the rpoB gene and consequently substitutions in the β-subunit of the RNA polymerase, which is the target of this agent.[28]
MacrolidesProduction of a methyltransferase that alternates the 23S rRNA subunit, inhibiting the binding of the antibiotic, and is mediated by erm genes (and specifically ermB).[29]
1 The mechanisms described here are the more frequently encountered. More resistance mechanisms have been described in the literature. 2 Penicillin binding proteins, membrane proteins essential for the peptidoglycan biosynthesis. B-lactam antibiotics act by a covalent binding to them.
Table
Table 2. Antibiotics, disc contents and breakpoints used in this study.
Table 2. Antibiotics, disc contents and breakpoints used in this study.
Antibacterial AgentDisk Content (μg)Zone Diameter Breakpoints (mm)MIC Breakpoints (μg/mL)
Ampicillin10S: ≥17, R: ≤16S: ≤8, R ≥ 16
Amoxicillin + Clavulanate20 + 10NA1NT
Ampicillin + Sulbactam10 + 10NA1NT
Imipenem10NA1NT
Gentamicin 1120S: ≥10, I:7–9, R: ≤6500 2
Streptomycin 1300S: ≥10, I:7–9, R: ≤61000 2
Ciprofloxacin5S: ≥21 I:16–20, R: ≤15S: ≤1, I:2, R ≥ 4
Tetracycline30S: ≥19 I:15–18, R: ≤14NT
Doxycycline30S: ≥16 I:13–15, R: ≤12NT
Minocycline30S: ≥19 I:15–18, R: ≤14NT
Florfenicol30NA2NT
Chloramphenicol30S: ≥18 I:13–17, R: ≤12NT
Fosfomycin200S: ≥16 I:13–15, R: ≤12 3NT
Nitrofurantoin300S: ≥17 I:15–16, R: ≤14NT
Rifampin5S: ≥20 I:17–19, R: ≤16NT
Erythromycin15S: ≥23 I:14–22, R: ≤13NT
Vancomycin30S: ≥17 I:15–16, R: ≤14S: ≤4, I: 8–16, R ≥ 32
Teicoplanin30S: ≥14 I:11–13, R: ≤10S: ≤8, I:16, R ≥ 32
Daptomycin-NTSDD: ≤4, R ≥ 8
Quinupristin/Dalfopristin-NTS: ≤1, I:2, R ≥ 4
Linezolid30S: ≥23 I:21–22, R: ≤20S: ≤2, I:4, R ≥ 8
S: Susceptible, I: intermediate, R: resistant. NA1: Breakpoints not available, susceptibility was evaluated based on absence of inhibition zone. NA2: breakpoints not available, susceptibility was evaluated based on Chloramphenicol breakpoints. NT: not tested. SDD: susceptible-dose dependent, as defined by the related CLSI document [30]. 1 Test for detection of high-level aminoglycoside resistance. 2 Any Growth = resistant. 3 Breakpoints for E. faecalis were used due to lack of respective breakpoints for E. faecium.
Table
Table 3. Primers used in this study [32,33].
Table 3. Primers used in this study [32,33].
PrimerSequence (5′→3′)Size of PCR Product (bp)
vanA(+)GGGAAAACGACAATTGC732
vanA(−)GTACAATGCGGCCGTTA
vanB(+)ACGGAATGGGAAGCCGA647
vanB(−)TGCACCCGATTTCGTTC
vanC1/2(+)ATGGATTGGTAYTKGTAT815/827
vanC1/2(−)TAGCGGGAGTGMCYMGTAA
vanD(+)TGTGGGATGCGATATTCAA500
vanD(−)TGCAGCCAAGTATCCGGTAA
vanE(+)TGTGGTATCGGAGCTGCAG430
vanE(−)ATAGTTTAGCTGGTAAC
vanG(+)CGGCATCCGCTGTTTTTGA941
vanG(−)GAACGATAGACCAATGCCTT
ddl E. faecalis(+)CACCTGAAGAAACAGGC475
ddl E. faecalis(−)ATGGCTACTTCAATTTCACG
ddl E. faecium(+)GAGTAAATCACTGAACGA1091
ddl E. faecium(−)CGCTGATGGTATCGATTCAT
Table
Table 4. Results of the AST for the E. faecium isolate.
Table 4. Results of the AST for the E. faecium isolate.
Antibacterial AgentResult of AST
AmpicillinR 1,2
Amoxicillin + ClavulanateR 1
Ampicillin + SulbactamR 1
ImipenemR 1
Gentamicin (HL)R 1,2
Streptomycin (HL)S 1,2
CiprofloxacinR 1,2
DoxycyclineR 1
MinocyclineR 1
TetracyclineR 1
FlorfenicolS 1
ChloramphenicolS 1
FosfomycinR 1
NitrofurantoinR 1
RifampinR 1
ErythromycinR 1
VancomycinR 1,2
TeicoplaninR 1,2
Quinupristin/DalfopristinS 2
DaptomycinSDD 2
LinezolidS 1,2
1 AST result by disc diffusion method. 2 AST result by MIC method.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lysitsas, M.; Triantafillou, E.; Tzavaras, I.; Karamichali, P.; Agathaggelidis, K.; Tsokana, C.N.; Dushku, E.; Katsiaflaka, A.; Billinis, C.; Valiakos, G. Isolation of a Multidrug-Resistant vanA-Positive Enterococcus faecium Strain from a Canine Clinical Sample in Greece. Microbiol. Res. 2023, 14, 603-613. https://doi.org/10.3390/microbiolres14020042

AMA Style

Lysitsas M, Triantafillou E, Tzavaras I, Karamichali P, Agathaggelidis K, Tsokana CN, Dushku E, Katsiaflaka A, Billinis C, Valiakos G. Isolation of a Multidrug-Resistant vanA-Positive Enterococcus faecium Strain from a Canine Clinical Sample in Greece. Microbiology Research. 2023; 14(2):603-613. https://doi.org/10.3390/microbiolres14020042

Chicago/Turabian Style

Lysitsas, Marios, Eleftherios Triantafillou, Ioannis Tzavaras, Panagiota Karamichali, Kiriakos Agathaggelidis, Constantina N. Tsokana, Esmeralda Dushku, Anna Katsiaflaka, Charalambos Billinis, and George Valiakos. 2023. "Isolation of a Multidrug-Resistant vanA-Positive Enterococcus faecium Strain from a Canine Clinical Sample in Greece" Microbiology Research 14, no. 2: 603-613. https://doi.org/10.3390/microbiolres14020042

APA Style

Lysitsas, M., Triantafillou, E., Tzavaras, I., Karamichali, P., Agathaggelidis, K., Tsokana, C. N., Dushku, E., Katsiaflaka, A., Billinis, C., & Valiakos, G. (2023). Isolation of a Multidrug-Resistant vanA-Positive Enterococcus faecium Strain from a Canine Clinical Sample in Greece. Microbiology Research, 14(2), 603-613. https://doi.org/10.3390/microbiolres14020042

Article Metrics

Back to TopTop