Next Article in Journal
Nutritional Status and Selected Adipokines in Children with Irritable Bowel Syndrome
Previous Article in Journal
Association between Adherence to the Healthy Food Pyramid and Breast Milk Fatty Acids in the First Month of Lactation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Nutrients
Volume 14
Issue 24
10.3390/nu14245281
nutrients-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Hesperidin Reversed Long-Term N-methyl-N-nitro-N-Nitroguanidine Exposure Induced EMT and Cell Proliferation by Activating Autophagy in Gastric Tissues of Rats

by
Zhaofeng Liang
1,2,*,†,
Jiajia Song
2,†,
Yumeng Xu
2,
Xinyi Zhang
2,
Yue Zhang
2 and
Hui Qian
1,2
1
Wujin Institute of Molecular Diagnostics and Precision Cancer Medicine of Jiangsu University, Wujin Hospital Affiliated of Jiangsu University, Changzhou 213017, China
2
Department of Laboratory Medicine, School of Medicine, Jiangsu University, Zhenjiang 212013, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Nutrients 2022, 14(24), 5281; https://doi.org/10.3390/nu14245281
Submission received: 19 November 2022 / Revised: 8 December 2022 / Accepted: 9 December 2022 / Published: 11 December 2022
(This article belongs to the Section Phytochemicals and Human Health)
Browse Figures
Review Reports Versions Notes

Abstract

:
Gastric cancer is a common malignant tumor worldwide. N-methyl-N-nitro-N-nitroguanidine (MNNG) is one of the most important inducing factors of gastric cancer. Autophagy can affect the occurrence and development of gastric cancer, but the mechanism is not clear. Chemoprevention has been shown to be a rational and very promising approach to the prevention of gastric cancer. Hesperidin is a citrus flavone, an abundant polyphenol in citrus fruits and traditional Chinese medicine. It has an excellent phytochemistry that plays an intervention role in gastric cancer. However, it is unclear whether long-term exposure to MNNG will affect the occurrence of gastric cancer by regulating autophagy and whether hesperidin can play an intervention role in this process. In the present study, we demonstrated that long-term MNNG exposure inhibits autophagy in stomach tissues of rats, promotes the epithelial–mesenchymal transition (EMT) process and cell proliferation and suppresses the activity of the PI3K/AKT pathway. We further found that after rapamycin-activated autophagy, long-term MNNG exposure promoted cell proliferation and EMT were inhibited. In addition, hesperidin promotes autophagy and the activity of the PI3K/AKT pathway, as well as the suppression of proliferation and EMT in the stomach tissues of rats. Our findings indicate that hesperidin reverses MNNG-induced gastric cancer by activating autophagy and the PI3K/AKT pathway, which may provide a new basis for the early prevention and treatment of MNNG-induced gastric cancer.

Graphical Abstract

1. Introduction

Gastric cancer is the fourth most common malignant cancer and the third most common cause of cancer death worldwide [1]. Many risk factors are related to the occurrence and development of gastric cancer, including dietary factors, infection, environmental factors, and gene mutation [2,3]. N-nitrosamines are one of the most important inducing factors of gastric cancer, which widely exist in the environment and food. N-methyl-N-nitro-N-nitroguanidine (MNNG) is a common N-nitrosamine, which is often used to simulate the exposure of N-nitrosamine in the living environment and common food. It has been confirmed that MNNG induces precancerous lesions of gastric cancer in vivo and in vitro models [4,5]. Studies also show that MNNG promotes the occurrence of gastric cancer [6,7]. Although great progress has been made in understanding the relationship between MNNG and gastric cancer, the underlying mechanisms are still unclear. Abnormal cell proliferation and EMT play a critical role in gastric cancer and can be induced by various harmful stimuli [8,9,10,11].
EMT makes cells lose epithelial characteristics and obtain mesenchymal characteristics, which contribute to the progression of cancer. It has been reported that cells or mice exposed to MNNG promote the EMT process. Cancer is also characterized by abnormal cell proliferation [12,13]. Studies indicate that exposure to MNNG induces cell proliferation [14,15]. Nevertheless, the molecular mechanism of MNNG-induced gastric EMT and cell proliferation is unclear. Autophagy plays an important role in the occurrence and development of gastric cancer, but it is unclear whether MNNG regulates autophagy to participate in the occurrence of gastric cancer.
Autophagy is a conserved self-defense mechanism that responds to various cellular stresses [16,17,18]. Normal and moderate autophagy is particularly important for cell survival and maintaining homeostasis. Dysregulation of autophagy involves the occurrence and development of a variety of diseases, including gastric cancer. Increasing pieces of evidence show that autophagy plays a critical role in the occurrence and development of gastric cancer [17,19,20]. Studies demonstrated that autophagy plays a regulatory role in the occurrence and development of cancer by regulating EMT and abnormal cell proliferation [21,22,23]. Autophagy is regulated by different signaling pathways (PI3K/AKT, P53, MAPK, PTEN, AMPK, etc.) and ncRNAs (miRNA, lncRNA, circRNAs)[16,17,18,24,25]. Therefore, investigating the mechanism of MNNG-mediated gastric autophagy, EMT, and abnormal cell proliferation may provide new insights for the early treatment and intervention of gastric cancer.
The incidence of gastric cancer is hidden, and there are no characteristic early diagnostic markers in the clinical setting. It is difficult to diagnose gastric cancer early, so the intervention of phytochemicals is particularly important. Phytochemicals have excellent anti-cancer activity and health benefits. Hesperidin is a multi-effect citrus flavone, and the most abundant polyphenol in citrus fruits and traditional Chinese medicine [26,27]. Studies have confirmed that hesperidin has minimal or no side effects [28] and has an anti-cancer effect in a variety of cancers, such as gastric cancer [29,30], breast cancer [27], and lung cancer [31,32]. Although the role of hesperidin’s anti-cancer activity in different cancer has been studied, limited work has been conducted on its role in MNNG-induced gastric cancer. Choi et al. reported that hesperidin has a protective effect on the TGF-β1 elicited EMT-like changes of podocytes through regulation of the mTOR pathway [33]. Wang et al. found that hesperidin suppresses EMT-mediated invasion and migration of cervical cancer cells by inhibiting abnormal activation of TGF-β1/Smads pathway [34]. It was reported that hesperidin could inhibit the cell proliferation of gastric cancer cells by activating the mitochondrial pathway [35]. Jeong et al. found that hesperidin inhibits the cell proliferation of prostate cancer cells via inducing oxidative stress and destroying Ca2+ homeostasis [36]. Studies have shown that hesperidin can improve mitochondrial damage and promote gastric motility in functional dyspepsia rats by regulating the phagocytosis of interstitial cells of cajal mitochondria mediated by Drp1[37]. The results of Li et al., demonstrated that hesperidin reduced myocardial ischemia/reperfusion injury by suppressing excessive autophagy [38]. However, it is still unclear whether hesperidin can play an intervention role in gastric cancer induced by long-term MNNG exposure by regulating cell autophagy, cell proliferation, and the EMT process.
Herein, in order to explore whether hesperidin can play an intervention effect and its molecular mechanism in MNNG-induced gastric cancer through regulating cell autophagy, cell proliferation, and EMT, we designed this study. In the current study, we established a rat model of long-term MNNG exposure, observed the effects of long-term MNNG exposure on autophagy, EMT, and cell proliferation and observed whether the PI3K/AKT pathway is involved in this process. The preventive effects of hesperidin are also determined in the gastric tissues of long-term MNNG-exposed rats. The findings of the current study may provide a way forward in the pathogenesis and early intervention of MNNG-induced gastric tumorigenesis.

2. Materials and Methods

2.1. Chemicals and Reagents

E-cadherin antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). Beclin1, LC3-I/II, ATG5, p-PI3K, p-Akt, vimentin, and proliferating cell nuclear antigen (PCNA) were purchased from Bioworld (Minnesota, Billerica, MA, USA). GAPDH was from Biogot Technology (Nanjing, China), Horseradish peroxidase-conjugated secondary antibodies were purchased from Bioworld (Minnesota, USA), and the primers for vimentin, E-cadherin, and PCNA were synthesized according to published sequences and synthesized by Invitrogen (Carlsbad, CA, USA). MNNG (purity ≥ 98%) was purchased from Chroma Biotechnology Co. Ltd. (Chengdu, China). Rapamycin was purchased from Med Chem Express (New Jersey, NJ, USA). Sources of other materials are noted accordingly in the text.

2.2. Rats and Exposure to MNNG

Male Wistar rats (n = 60), 6–8 weeks old, were purchased from the Animal Research Center of Jiangsu University. Rats were housed in polypropylene cages at 20–22 °C and 40–60% humidity with 12 h light/dark cycles. All of the mice experiments were approved by the Animal Care and Use Committee of Jiangsu University, and efforts were made to minimize suffering and distress. Wistar rats were acclimated for 1 week prior to MNNG, rapamycin, and hesperidin exposure. The control group rats had free access to water and a normal diet (Open Formula Animal Diets, Changzhou, China). The rats in the MNNG group received MMNG by intragastric administration (100 mg/kg BW) every 5 days for 12 weeks [6]. After the final MNNG exposure, rats were sacrificed, and gastric tissues were collected and stored at −80 °C for further analysis.

2.3. In Vivo Delivery of Rapamycin

Rapamycin is a commonly used autophagy activator. To study the role of autophagy in cell proliferation and EMT induced by long-term MNNG exposure, we treated rats with rapamycin. Wistar rats 6–8 weeks old were grouped according to the following: the control group rats had free access to water and a normal diet; the MNNG group rats were exposed to MNNG; the MNNG and DMSO group, rats were injected with sterile DMSO (Sigma-Aldrich, St. Louis, MO, USA) and exposed to MNNG; the MNNG and rapamycin group rats were injected with rapamycin (1 mg/kg BW) and exposed to MNNG. Rapamycin was administered intraperitoneally three times a week by dissolving it in the sterile DMSO. Rats were weighed weekly. After the last treatment, rats were sacrificed, and gastric tissues were collected and stored at −80 °C for further analysis.

2.4. Hesperidin Intervention

In order to explore whether hesperidin can play an intervention role and s in MNNG-induced gastric cancer, we treated rats with hesperidin (30 mg/kg BW). Wistar rats 6–8 weeks old were grouped into 4 groups: the control group rats received a normal diet; the MNNG group rats were exposed to MNNG and received a normal diet; the MNNG and solvent control group rats were exposed to MNNG and DMSO and received a normal diet; the MMNG and hesperidin group rats were exposed to MNNG and received 30 mg/kg hesperidin by gavage and a normal diet. After the 12 weeks treatment, rats were sacrificed, and gastric tissues were collected and stored at −80 °C for further analysis.

2.5. Hematoxylin–Eosin Staining

Stomach tissues of rats in the control group and different treatment groups were fixed in 4% buffered formalin for 24 h, then paraffin-embedded for slicing into 5 μm sections. The sections were used for subsequent hematoxylin–eosin staining. Subsequently, sections were deparaffinized with xylene and rehydrated in water through a series of different grades of alcohol. The gastric tissues of rat sections were stained with hematoxylin–eosin staining.

2.6. Immunohistochemical Staining

Immunohistochemistry was performed according to the standard protocol. Briefly, 5 μm paraffin-embedded stomach tissues sections of rats in the control group and different treatment groups were de-waxed in xylene and rehydrated in an alcohol gradient. Endogenous peroxidase activity was inhibited with exposure to 3% (v/v) H2O2 solution. Sections were boiled in citrate buffer (pH 6.0, 10 mM) for antigen retrieval and incubated with 5% (w/v) BSA to block the non-specific binding. The sections were incubated with the primary antibody (E-cadherin and vimentin) at 4 °C overnight and subsequently incubated with a biotinylated secondary antibody. Finally, sections were incubated with biotinylated immunoglobulin G and SABC (BOSTER, China). Images were taken using a Nikon Eclipse Ti-S microscope (Nikon Corporation, Tokyo, Japan) at X200 magnification.

2.7. RNA Extraction and Real-Time PCR

Total RNA was isolated from gastric tissues of rats in the control group and different treatment groups using Trizol (Gibco, CA, USA). Reverse transcription was performed according to the manufacturer’s protocol of the reverse transcription kit (Vazyme, Nanjing, China); 1 μg RNA was used for reverse transcription. Real-time PCR was carried out on the step one plus real-time PCR System (ABI, USA) by using the AceQ QPCR SYBR GREEN master mix (Vazyme, China). GAPDH served as the housekeeping gene. Fold changes of gene expression were evaluated by the 2−ΔΔCt method. The primers were synthesized by biological companies (Invitrogen, MA, USA), and the sequences of the primers are listed in Table 1.

2.8. Western Blotting

Gastric tissues of rats in the control group and different treatment groups were homogenized using a fully automatic sample rapid grinding instrument (Shanghai Jingxin Industrial Development, Co., Ltd., Shanghai, China) in lysate buffer 1% protease inhibitors (Roche, Basel, Switzerland) and centrifuged at 4 °C for 20 min. Equal amounts (60 μg) of the protein were separated on 7.5–10% SDS-polyacrylamide gel and transferred to PVDF membranes (Millipore, Burlington, MA, USA). After being blocked with skim milk (5%) at 25 ˚C for 1 h, the PVDF membranes were incubated with the primary antibodies (Beclin1, LC3-I/II, ATG5, p-PI3K, p-Akt, vimentin, and PCNA) at 4 °C overnight. After being washed with tris-buffered saline and Tween 20, the PVDF membranes were incubated with horseradish peroxidase-conjugated secondary antibody, and bands were detected using an enhanced chemiluminescence kit (Millipore, USA).

2.9. Statistical Analysis

All the statistical data were presented as mean ± standard deviation and analyzed by using SPSS software 22.0 (SPSS, Chicago, IL, USA). ANOVA was used for the comparison of statistical differences among multiple groups, followed by the multiple comparisons (LSD) significant difference tests. The Unpaired Student’s test was also used for the comparison between two groups. Values of p < 0.05 were considered significant.

3. Results

3.1. Long-Term MNNGExposure Induced EMT and Cell Proliferation and Inhibited Autophagy in the Gastric Tissues of Rats

N-nitrosamine exposure is one of the most important risk factors for gastric cancer. Abnormal EMT and cell proliferation are crucially involved in the initiation of gastric cancer. Autophagy plays a regulatory role in the occurrence and development of cancer by regulating EMT and abnormal cell proliferation. After 12 weeks of MNNG exposure, we assessed the changes in histology alterations and the changes in the expression levels of autophagy, EMT, and cell proliferation markers in the gastric tissues of rats. Histological analysis showed that long-term MNNG exposure induced a canceration tendency in gastric tissue of rats (Figure 1A). The results of real-time PCR showed that long-term MNNG exposure reduced E-cadherin and Beclin1 mRNA levels, and the expression of vimentin and PCNA were elevated (Figure 1B). Western blot analyses revealed that long-term MNNG exposure reduced Beclin1, LC3-I/II, ATG5, and E-cadherin expression, while the levels of vimentin and PCNA increased (Figure 1C). Immunohistochemical staining also showed that long-term MNNG exposure increased vimentin expression and decreased Beclin1 levels (Figure 1D). These results suggested that long-term MNNG exposure induces autophagy, EMT, and proliferation in the gastric tissues of rats. Long-term MNNG exposure may play an important role in the occurrence and development of gastric cancer by affecting autophagy, cell proliferation, and the EMT process.

3.2. Long-Term MNNG Exposure Decreased the PI3K/AKT Pathway Activation in Rats Gastric Tissues

In order to clarify the molecular mechanism of autophagy, EMT, and cell proliferation of gastric tissue cells induced by long-term MNNG exposure, we analyzed whether gastric autophagy, EMT, and cell proliferation triggered by long-term MNNG exposure correlate with the PI3K/AKT pathway in the gastric tissues of rats; the levels of phosphorylated PI3K and phosphorylated AKT were measured. The results of Western blot showed that long-term MNNG exposure decreased the expression of phosphorylated PI3K and AKT (Figure 2), suggesting that long-term MNNG exposure induces autophagy, EMT, and proliferation in the gastric tissues of rats and relates with the PI3K/AKT pathway.

3.3. Long-Term MNNG Exposure Mediated EMT and Proliferation Reversed by Autophagic Activation

Studies have shown that changes in autophagic activity can affect cell proliferation and the EMT process. To verify the effect of autophagy in long-term MNNG exposure induced gastric EMT and cell proliferation in the gastric tissues of rats, the rats were treated with the autophagy activator rapamycin (1 mg/kg BW, three times a week). After 12 weeks treatment with MNNG and rapamycin, Western blot results showed that rapamycin significantly increased the autophagy-related proteins Beclin1, LC3-I/II, and ATG5 (Figure 3). The above results revealed that autophagy inhibited by long-term MNNG exposure was partially recovered by rapamycin in the gastric tissues of rats.
The expression of EMT and cell proliferation markers were also detected after 12 weeks of treatment. The results of Western blot showed that the reduction of E-cadherin protein level and increase of vimentin and PCNA protein levels induced by MNNG exposure were reversed by autophagic activation (Figure 4A). Real-time PCR analyses revealed that MNNG reduced E-cadherin expression and increased the levels of vimentin, and PCNA was also reversed by autophagic activation (Figure 4B). These data indicated that activation of the autophagic pathway reverses long-term MNNG-exposure-mediated EMT and cell proliferation in the gastric tissues of rats.

3.4. Hesperidin Activated Autophagy and Reversed EMT, Proliferation in Rats Gastric Tissues Elicited by Long-Term MNNG Exposure

In recent years, the intervention effect of phytochemicals in gastric cancer and other cancers has received increasing attention. Hesperidin has an excellent phytochemistry that plays an intervention role in gastric cancer and other cancers. To explore the effects of hesperidin in long-term MNNG-exposure-mediated autophagy, EMT, and cell proliferation in the gastric tissues of rats, the rats were given hesperidin (30 mg/kg BW) and exposed to MNNG for 12 weeks. Results in Figure 5 indicate that hesperidin reduced expression of Beclin1, LC3-I/II, and ATG5 and reversed the effects of long-term MNNG exposure. In addition, the reduction of E-cadherin and the upregulation of vimentin and PCNA triggered by long-term MNNG exposure were also attenuated by hesperidin (30 mg/kg BW) (Figure 6). These results indicate the protective effects of hesperidin on long-term MNNG-exposure-mediated autophagy, EMT, and cell proliferation in gastric tissues of rats.

3.5. Hesperidin Attenuated Long-Term MNNG Exposure Activated PI3K/AKT Pathway

In this study, we found that PI3K/AKT pathway was involved in the process of long-term MNNG-induced autophagy, cell proliferation, and EMT in rat gastric tissues. To investigate whether hesperidin reverses long-term MNNG-exposure-induced alterations of gastric autophagy, EMT, and proliferation through the PI3K/AKT pathway, we further observed the alterations of phosphorylated PI3K and AKT in the gastric tissues of rats after hesperidin and MNNG exposure. We found that hesperidin (30 mg/kg BW) reversed the changes of phosphorylated PI3K and AKT induced by long-term MNNG exposure (Figure 7).

4. Discussion

Long-term N-nitrosamine exposure is the primary cause of gastric cancer, which promotes the initiation and progression of gastric tumorigenesis. However, the underlying mechanisms by which N-nitrosamines cause gastric cancer remain to be well-established. In the present study, we revealed that MNNG, a common N-nitrosamine chemical, induced autophagy, EMT, and cell proliferation in the gastric tissues of Wistar rats. Most importantly, we demonstrated that autophagy prevents long-term MNNG-exposure-triggered EMT and cell proliferation and promotes the PI3K/AKT pathway participation in this process. In addition, our data indicated that hesperidin promotes the PI3K/AKT pathway to prevent long-term MNNG-exposure-induced changes, such as inhibited autophagy, induced EMT process, and increased cell proliferation. These findings suggest an important role of autophagy and the intervention effect of hesperidin in long-term MNNG-exposure-mediated gastric EMT process and cell proliferation, which provide critical information for the mechanisms of long-term MNNG-exposure-related gastric tumorigenesis, as well as for the search for the potential target of gastric cancer intervention.
The EMT process, uncontrolled autophagy, and abnormal cell proliferation can directly contribute to malignant phenotypes of cancer cells. A number of studies found that uncontrolled autophagy, cell proliferation, and EMT play a critical role in the initiation and progression of gastric cancer and can be induced by various harmful stimuli [8,9,10,11]. To determine whether reduced autophagy, cell proliferation, and EMT occurred in the gastric tissues of rats exposed to MNNG for 12 weeks, the expression of autophagy, EMT, and cell proliferation markers were examined. Results of Western blot and real-time PCR showed that long-term MNNG exposure reduced the expression levels of Beclin1, LC3-I/II, ATG5, and E-cadherin and increased the levels of vimentin and PCNA. Immunohistochemical staining also showed that long-term MNNG exposure increased vimentin expression and decreased Beclin1 expression. These results suggest that long-term MNNG exposure reduces autophagy but increases EMT and cell proliferation in the gastric tissues of rats. Long-term MNNG exposure may play an important role in the occurrence and development of gastric cancer by affecting autophagy, cell proliferation, and EMT process. However, the mechanisms by which MNNG induces a reduction in autophagy, and increases cell proliferation and EMT are not well articulated.
Several signal pathways are involved in autophagy, including PI3K/AKT, P53, MAPK, PTEN, and AMPK. The PI3K/AKT pathway plays a critical role in multiple physiological processes and pathologies, including autophagy, cell proliferation, differentiation, apoptosis, inflammation, EMT, and tumorigenesis [39,40,41,42]. In our study, results showed that long-term MNNG exposure reduces autophagy but promotes EMT and cell proliferation, which is related to the downregulation of phosphorylated PI3K and phosphorylated AKT. The PI3K/AKT pathway may play an important role in the alteration of autophagy, cell proliferation, and EMT induced by long-term MNNG exposure.
The EMT and cell proliferation triggered by long-term MNNG exposure were associated with the inhibition of autophagy. To identify the role of autophagy in gastric EMT and cell proliferation, rats were treated with rapamycin (1 mg/kg BW, three times a week). Rapamycin is a commonly used autophagy activator [43,44]. After treatment with MNNG and rapamycin for 12 weeks, we found that 1 mg/kg rapamycin significantly upregulated the autophagy-related proteins Beclin1, LC3-I/II, and ATG5 in the gastric tissues of rats. These results revealed that autophagy inhibited by long-term MNNG exposure was partially recovered by rapamycin. Furthermore, the activation of autophagy reversed MNNG-mediated EMT and cell proliferation in the gastric tissues of rats, as showed by an elevated level of E-cadherin and decreased expression of vimentin and PCNA. These results imply that long-term MNNG exposure mediates EMT and cell proliferation, which is reversed by the activation of autophagy.
Phytochemicals have been attracting attention due to their potent anti-cancer activity and health benefits, especially in high-risk populations. In recent years, the intervention effect of phytochemicals in gastric cancer and other cancers has received increasing attention. Hesperidin is a multi-effect citrus flavone, and the most abundant polyphenol in citrus fruits and traditional Chinese medicine [26,27]. The safety and anticancer activity of hesperidin have been demonstrated in many studies [28,29,35]. Hesperidin has excellent antibacterial, antioxidant, and anti-cancer effects. A study by Kim HW indicated that hesperidin has antibacterial effects against Helicobacter pylori, thereby delaying the occurrence and development of gastric cancer [45]. It is also reported that hesperidin has a good preventive and therapeutic effect on chronic gastric ulcers induced by acetic acid in rats [46]. Other studies have also demonstrated the intervention or protective role played by hesperidin in the occurrence and development of gastric cancer [29]. However, the role of hesperidin in the development of gastric cancer induced by long-term exposure to MNNG remains unclear. Data show that hesperidin plays an intervention role by influencing autophagy, cell proliferation, and EMT process in other cancers and diseases [34,35,36,38,47,48]. However, it is still unclear whether hesperidin plays an intervention role in gastric cancer induced by long-term MNNG exposure by regulating cell autophagy, cell proliferation, and the EMT process.
The intervention effect of hesperidin on long-term MNNG-exposure-induced gastric autophagy, EMT, and cell proliferation was examined after treatment with hesperidin (30 mg/kg) and MNNG for 12 weeks. As shown in Figure 5, the reduced expression of Beclin1, LC3-I/II, and ATG5 was reversed by 30 mg/kg hesperidin in rats after long-term MNNG exposure. In addition, the reduction of E-cadherin and the upregulation of vimentin and PCNA triggered by long-term MNNG exposure were also attenuated by 30 mg/kg BW hesperidin (Figure 6). Our data showed that hesperidin exerted an intervention or protective effect in long-term MNNG-exposure-mediated autophagy, EMT, and cell proliferation in the gastric tissues of rats. This study may provide potential strategies for early intervention of gastric cancer. To further study the intervention target and molecular mechanism of hesperidin in gastric cancer induced by long-term MNNG exposure, we explored whether hesperidin exerted the intervention effect through the PI3K/AKT pathway. The results in Figure 7 demonstrate that long-term MNNG exposure triggered reduced expression of phosphorylated PI3K and phosphorylated AKT, which were attenuated by hesperidin (30 mg/kg) by increasing their expression in the gastric tissues of rats. These results of our current research provide a new potential intervention strategy and target for MNNG-induced gastric cancer.

5. Conclusions

Our study illustrated that autophagy inhibits long-term MNNG-exposure-triggered EMT and cell proliferation, and hesperidin exerts a protective effect on abnormal cell proliferation and EMT of gastric tissue in rats through the PI3K/AKT pathway. These findings may provide new insights into the mechanisms and the chemoprevention of MNNG-induced gastric cancer.

Author Contributions

Z.L. designed research and wrote the paper. J.S. and Y.Z. performed research. X.Z. and Y.X. analyzed data. H.Q. contributed to the writing and revisions. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by project of social development in Zhenjiang (No. SH2021045), the Foundation for excellent young teachers at Jiangsu university (5521280013), and Technology Development Project of Jiangsu University (20220516).

Institutional Review Board Statement

All of the mice experiments were approved by the Animal Care and Use Committee of Jiangsu University and efforts to minimize suffering and distress.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analyzed during this study are included in this published article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA A Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
  2. Lu, L.; Chen, J.; Li, M.; Tang, L.; Wu, R.; Jin, L.; Liang, Z. betacarotene reverses tobacco smokeinduced gastric EMT via Notch pathway in vivo. Oncol. Rep. 2018, 39, 1867–1873. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Song, M.; Camargo, M.C.; Katki, H.A.; Weinstein, S.J.; Mannisto, S.; Albanes, D.; Surcel, H.M.; Rabkin, C.S. Association of Antiparietal Cell and Anti-Intrinsic Factor Antibodies with Risk of Gastric Cancer. JAMA Oncol. 2022, 8, 268–274. [Google Scholar] [CrossRef]
  4. Xu, J.; Shen, W.; Pei, B.; Wang, X.; Sun, D.; Li, Y.; Xiu, L.; Liu, X.; Lu, Y.; Zhang, X.; et al. Xiao Tan He Wei Decoction reverses MNNG-induced precancerous lesions of gastric carcinoma in vivo and vitro: Regulation of apoptosis through NF-kappaB pathway. Biomed. Pharmacother. Biomed. Pharmacother. 2018, 108, 95–102. [Google Scholar] [CrossRef] [PubMed]
  5. Cai, T.; Zhang, C.; Zeng, X.; Zhao, Z.; Yan, Y.; Yu, X.; Wu, L.; Lin, L.; Pan, H. Protective effects of Weipixiao decoction against MNNG-induced gastric precancerous lesions in rats. Biomed. Pharmacother. Biomed. Pharmacother. 2019, 120, 109427. [Google Scholar] [CrossRef] [PubMed]
  6. Gunes-Bayir, A.; Guler, E.M.; Bilgin, M.G.; Ergun, I.S.; Kocyigit, A.; Dadak, A. Anti-Inflammatory and Antioxidant Effects of Carvacrol on N-Methyl-N′-Nitro-N-Nitrosoguanidine (MNNG) Induced Gastric Carcinogenesis in Wistar Rats. Nutrients 2022, 14, 2848. [Google Scholar] [CrossRef]
  7. Isyraqiah, F.; Kutty, M.K.; Durairajanayagam, D.; Singh, H.J. Leptin enhances N-methyl-N′-nitro-N-nitrosoguanidine (MNNG)-induced tumour growth in gastric mucosa of male Sprague-Dawley rats. Mol. Biol. Rep. 2019, 46, 5967–5975. [Google Scholar] [CrossRef] [PubMed]
  8. Zhang, X.; Wang, S.; Wang, H.; Cao, J.; Huang, X.; Chen, Z.; Xu, P.; Sun, G.; Xu, J.; Lv, J.; et al. Circular RNA circNRIP1 acts as a microRNA-149-5p sponge to promote gastric cancer progression via the AKT1/mTOR pathway. Mol. Cancer 2019, 18, 20. [Google Scholar] [CrossRef] [Green Version]
  9. Baj, J.; Korona-Glowniak, I.; Forma, A.; Maani, A.; Sitarz, E.; Rahnama-Hezavah, M.; Radzikowska, E.; Portincasa, P. Mechanisms of the Epithelial-Mesenchymal Transition and Tumor Microenvironment in Helicobacter pylori-Induced Gastric Cancer. Cells 2020, 9, 1055. [Google Scholar] [CrossRef] [Green Version]
  10. Iwamuro, M.; Shiraha, H.; Oyama, A.; Uchida, D.; Horiguchi, S.; Okada, H. Laminin-411 and -511 Modulate the Proliferation, Adhesion, and Morphology of Gastric Cancer Cells. Cell Biochem. Biophys. 2021, 79, 407–418. [Google Scholar] [CrossRef]
  11. Shen, H.; Zhu, H.; Chen, Y.; Shen, Z.; Qiu, W.; Qian, C.; Zhang, J. ZEB1-induced LINC01559 expedites cell proliferation, migration and EMT process in gastric cancer through recruiting IGF2BP2 to stabilize ZEB1 expression. Cell Death Dis. 2021, 12, 349. [Google Scholar] [CrossRef] [PubMed]
  12. Gandhi, G.R.; Antony, P.J.; Lana, M.; da Silva, B.F.X.; Oliveira, R.V.; Jothi, G.; Hariharan, G.; Mohana, T.; Gan, R.Y.; Gurgel, R.Q.; et al. Natural products modulating interleukins and other inflammatory mediators in tumor-bearing animals: A systematic review. Phytomed. Int. J. Phytother. Phytopharm. 2022, 100, 154038. [Google Scholar] [CrossRef] [PubMed]
  13. Pisani, L.F.; Tontini, G.E.; Gentile, C.; Marinoni, B.; Teani, I.; Nandi, N.; Creo, P.; Asti, E.; Bonavina, L.; Vecchi, M.; et al. Proinflammatory Interleukin-33 Induces Dichotomic Effects on Cell Proliferation in Normal Gastric Epithelium and Gastric Cancer. Int. J. Mol. Sci. 2021, 22, 5792. [Google Scholar] [CrossRef] [PubMed]
  14. Zhang, Y.; Zheng, Y.; Pan, E.; Zhao, C.; Zhang, H.; Liu, R.; Wang, S.; Pu, Y.; Yin, L. Synergism of HPV and MNNG repress miR-218 promoting Het-1A cell malignant transformation by targeting GAB2. Toxicology 2021, 447, 152635. [Google Scholar] [CrossRef]
  15. Zhang, Y.; Ma, Y.; Zhao, C.; Zhang, H.; Pu, Y.; Yin, L. Synergistic Carcinogenesis of HPV18 and MNNG in Het-1A Cells through p62-KEAP1-NRF2 and PI3K/AKT/mTOR Pathway. Oxidative Med. Cell. Longev. 2020, 2020, 6352876. [Google Scholar] [CrossRef]
  16. Levine, B.; Kroemer, G. Biological Functions of Autophagy Genes: A Disease Perspective. Cell 2019, 176, 11–42. [Google Scholar] [CrossRef] [Green Version]
  17. Lu, L.; Liang, Q.; Zhang, X.; Xu, Y.; Meng, D.; Liang, Z. Autophagy Related Noncoding RNAs: Emerging Regulatory Factors of Gastric Cancer. Cancer Manag. Res. 2022, 14, 2215–2224. [Google Scholar] [CrossRef]
  18. Xu, J.L.; Yuan, L.; Tang, Y.C.; Xu, Z.Y.; Xu, H.D.; Cheng, X.D.; Qin, J.J. The Role of Autophagy in Gastric Cancer Chemoresistance: Friend or Foe? Front. Cell Dev. Biol. 2020, 8, 621428. [Google Scholar] [CrossRef]
  19. Cao, Y.; Luo, Y.; Zou, J.; Ouyang, J.; Cai, Z.; Zeng, X.; Ling, H.; Zeng, T. Autophagy and its role in gastric cancer. Clin. Chim. Acta Int. J. Clin. Chem. 2019, 489, 10–20. [Google Scholar] [CrossRef]
  20. Li, G.M.; Li, L.; Li, M.Q.; Chen, X.; Su, Q.; Deng, Z.J.; Liu, H.B.; Li, B.; Zhang, W.H.; Jia, Y.X.; et al. DAPK3 inhibits gastric cancer progression via activation of ULK1-dependent autophagy. Cell Death Differ. 2021, 28, 952–967. [Google Scholar] [CrossRef]
  21. Wu, Q.; Ma, J.; Wei, J.; Meng, W.; Wang, Y.; Shi, M. lncRNA SNHG11 Promotes Gastric Cancer Progression by Activating the Wnt/beta-Catenin Pathway and Oncogenic Autophagy. Mol. Ther. J. Am. Soc. Gene Ther. 2021, 29, 1258–1278. [Google Scholar] [CrossRef] [PubMed]
  22. Courtois, S.; Haykal, M.; Bodineau, C.; Sifre, E.; Azzi-Martin, L.; Menard, A.; Megraud, F.; Lehours, P.; Duran, R.V.; Varon, C.; et al. Autophagy induced by Helicobacter pylori infection is necessary for gastric cancer stem cell emergence. Gastric Cancer Off. J. Int. Gastric Cancer Assoc. Jpn. Gastric Cancer Assoc. 2021, 24, 133–144. [Google Scholar] [CrossRef] [PubMed]
  23. Su, S.; Shi, Y.T.; Chu, Y.; Jiang, M.Z.; Wu, N.; Xu, B.; Zhou, H.; Lin, J.C.; Jin, Y.R.; Li, X.F.; et al. Sec62 promotes gastric cancer metastasis through mediating UPR-induced autophagy activation. Cell. Mol. Life Sci. CMLS 2022, 79, 133. [Google Scholar] [CrossRef] [PubMed]
  24. Galluzzi, L.; Green, D.R. Autophagy-Independent Functions of the Autophagy Machinery. Cell 2019, 177, 1682–1699. [Google Scholar] [CrossRef] [PubMed]
  25. Wang, Y.; Zhang, H. Regulation of Autophagy by mTOR Signaling Pathway. Adv. Exp. Med. Biol. 2019, 1206, 67–83. [Google Scholar] [CrossRef] [PubMed]
  26. Ricci, A.; Gallorini, M.; Del Bufalo, D.; Cataldi, A.; D’Agostino, I.; Carradori, S.; Zara, S. Negative Modulation of the Angiogenic Cascade Induced by Allosteric Kinesin Eg5 Inhibitors in a Gastric Adenocarcinoma In Vitro Model. Molecules 2022, 27, 957. [Google Scholar] [CrossRef] [PubMed]
  27. Lu, Q.; Lai, Y.; Zhang, H.; Ren, K.; Liu, W.; An, Y.; Yao, J.; Fan, H. Hesperetin Inhibits TGF-beta1-Induced Migration and Invasion of Triple Negative Breast Cancer MDA-MB-231 Cells via Suppressing Fyn/Paxillin/RhoA Pathway. Integr. Cancer Ther. 2022, 21, 15347354221086900. [Google Scholar] [CrossRef]
  28. Semis, H.S.; Kandemir, F.M.; Kaynar, O.; Dogan, T.; Arikan, S.M. The protective effects of hesperidin against paclitaxel-induced peripheral neuropathy in rats. Life Sci. 2021, 287, 120104. [Google Scholar] [CrossRef]
  29. Wang, S.W.; Sheng, H.; Zheng, F.; Zhang, F. Hesperetin promotes DOT1L degradation and reduces histone H3K79 methylation to inhibit gastric cancer metastasis. Phytomed. Int. J. Phytother. Phytopharm. 2021, 84, 153499. [Google Scholar] [CrossRef]
  30. He, P.; Ma, J.; Liu, Y.; Deng, H.; Dong, W. Hesperetin Promotes Cisplatin-Induced Apoptosis of Gastric Cancer In Vitro and In Vivo by Upregulating PTEN Expression. Front. Pharmacol. 2020, 11, 1326. [Google Scholar] [CrossRef]
  31. Zhou, L.; Gu, W.; Kui, F.; Gao, F.; Niu, Y.; Li, W.; Zhang, Y.; Guo, L.; Wang, J.; Guo, Z.; et al. The mechanism and candidate compounds of aged citrus peel (chenpi) preventing chronic obstructive pulmonary disease and its progression to lung cancer. Food Nutr. Res. 2021, 65. [Google Scholar] [CrossRef] [PubMed]
  32. Kong, W.; Ling, X.; Chen, Y.; Wu, X.; Zhao, Z.; Wang, W.; Wang, S.; Lai, G.; Yu, Z. Hesperetin reverses Pglycoproteinmediated cisplatin resistance in DDPresistant human lung cancer cells via modulation of the nuclear factorkappaB signaling pathway. Int. J. Mol. Med. 2020, 45, 1213–1224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Choi, D.; Kim, C.L.; Kim, J.E.; Mo, J.S.; Jeong, H.S. Hesperetin inhibit EMT in TGF-beta treated podocyte by regulation of mTOR pathway. Biochem. Biophys. Res. Commun. 2020, 528, 154–159. [Google Scholar] [CrossRef] [PubMed]
  34. Wang, J.; Chen, H.; Hu, Z.; Ma, K.; Wang, H. Hesperetin regulates transforming growth factor-beta1/Smads pathway to suppress epithelial-mesenchymal transition -mediated invasion and migration in cervical cancer cell. Anti-Cancer Drugs 2021, 32, 930–938. [Google Scholar] [CrossRef] [PubMed]
  35. Zhang, J.; Wu, D.; Vikash; Song, J.; Wang, J.; Yi, J.; Dong, W. Hesperetin Induces the Apoptosis of Gastric Cancer Cells via Activating Mitochondrial Pathway by Increasing Reactive Oxygen Species. Dig. Dis. Sci. 2015, 60, 2985–2995. [Google Scholar] [CrossRef]
  36. Jeong, S.A.; Yang, C.; Song, J.; Song, G.; Jeong, W.; Lim, W. Hesperidin Suppresses the Proliferation of Prostate Cancer Cells by Inducing Oxidative Stress and Disrupting Ca(2+) Homeostasis. Antioxidants 2022, 11, 1633. [Google Scholar] [CrossRef]
  37. Jia, Q.; Li, L.; Wang, X.; Wang, Y.; Jiang, K.; Yang, K.; Cong, J.; Cai, G.; Ling, J. Hesperidin promotes gastric motility in rats with functional dyspepsia by regulating Drp1-mediated ICC mitophagy. Front. Pharmacol. 2022, 13, 945624. [Google Scholar] [CrossRef]
  38. Li, X.; Hu, X.; Wang, J.; Xu, W.; Yi, C.; Ma, R.; Jiang, H. Inhibition of autophagy via activation of PI3K/Akt/mTOR pathway contributes to the protection of hesperidin against myocardial ischemia/reperfusion injury. Int. J. Mol. Med. 2018, 42, 1917–1924. [Google Scholar] [CrossRef] [Green Version]
  39. Fattahi, S.; Amjadi-Moheb, F.; Tabaripour, R.; Ashrafi, G.H.; Akhavan-Niaki, H. PI3K/AKT/mTOR signaling in gastric cancer: Epigenetics and beyond. Life Sci. 2020, 262, 118513. [Google Scholar] [CrossRef]
  40. Duan, Y.; Haybaeck, J.; Yang, Z. Therapeutic Potential of PI3K/AKT/mTOR Pathway in Gastrointestinal Stromal Tumors: Rationale and Progress. Cancers 2020, 12, 2972. [Google Scholar] [CrossRef]
  41. Rong, L.; Li, Z.; Leng, X.; Li, H.; Ma, Y.; Chen, Y.; Song, F. Salidroside induces apoptosis and protective autophagy in human gastric cancer AGS cells through the PI3K/Akt/mTOR pathway. Biomed. Pharmacother. Biomed. Pharmacother. 2020, 122, 109726. [Google Scholar] [CrossRef] [PubMed]
  42. Wang, C.; Yang, Z.; Xu, E.; Shen, X.; Wang, X.; Li, Z.; Yu, H.; Chen, K.; Hu, Q.; Xia, X.; et al. Apolipoprotein C-II induces EMT to promote gastric cancer peritoneal metastasis via PI3K/AKT/mTOR pathway. Clin. Transl. Med. 2021, 11, e522. [Google Scholar] [CrossRef] [PubMed]
  43. Lu, H.; Yang, H.L.; Zhou, W.J.; Lai, Z.Z.; Qiu, X.M.; Fu, Q.; Zhao, J.Y.; Wang, J.; Li, D.J.; Li, M.Q. Rapamycin prevents spontaneous abortion by triggering decidual stromal cell autophagy-mediated NK cell residence. Autophagy 2021, 17, 2511–2527. [Google Scholar] [CrossRef]
  44. Zhang, X.; Wei, M.; Fan, J.; Yan, W.; Zha, X.; Song, H.; Wan, R.; Yin, Y.; Wang, W. Ischemia-induced upregulation of autophagy preludes dysfunctional lysosomal storage and associated synaptic impairments in neurons. Autophagy 2021, 17, 1519–1542. [Google Scholar] [CrossRef] [PubMed]
  45. Kim, H.W.; Woo, H.J.; Yang, J.Y.; Kim, J.B.; Kim, S.H. Hesperetin Inhibits Expression of Virulence Factors and Growth of Helicobacter pylori. Int. J. Mol. Sci. 2021, 22, 10035. [Google Scholar] [CrossRef] [PubMed]
  46. da Silva, L.M.; Pezzini, B.C.; Somensi, L.B.; Bolda Mariano, L.N.; Mariott, M.; Boeing, T.; Dos Santos, A.C.; Longo, B.; Cechinel-Filho, V.; de Souza, P.; et al. Hesperidin, a citrus flavanone glycoside, accelerates the gastric healing process of acetic acid-induced ulcer in rats. Chem. Biol. Interact. 2019, 308, 45–50. [Google Scholar] [CrossRef] [PubMed]
  47. Tan, S.; Dai, L.; Tan, P.; Liu, W.; Mu, Y.; Wang, J.; Huang, X.; Hou, A. Hesperidin administration suppresses the proliferation of lung cancer cells by promoting apoptosis via targeting the miR-132/ZEB2 signalling pathway. Int. J. Mol. Med. 2020, 46, 2069–2077. [Google Scholar] [CrossRef] [PubMed]
  48. Kucukler, S.; Comakli, S.; Ozdemir, S.; Caglayan, C.; Kandemir, F.M. Hesperidin protects against the chlorpyrifos-induced chronic hepato-renal toxicity in rats associated with oxidative stress, inflammation, apoptosis, autophagy, and up-regulation of PARP-1/VEGF. Environ. Toxicol. 2021, 36, 1600–1617. [Google Scholar] [CrossRef]
Nutrients 14 05281 g001 550
Figure 1. Long-term MNNG exposure induced EMT, proliferation, and inhibited autophagy in gastric tissues of rats. Rats were exposed to MNNG (100 mg/kg BW) every 5 days for 12 weeks: (A) hematoxylin and eosin-stained sections of gastric tissues after long-term MNNG exposure. Tissues from 3 rats were examined; the representative image is shown; (B) MNNG-induced alterations in the protein expression of autophagy, EMT and proliferation markers. Tissues from n = 3 rats as representative images; (C) MNNG reduced mRNA levels of autophagy and epithelial markers and increased the mesenchymal and proliferation markers. Real-time PCR results are these samples from 3 rats, and the experiments were repeated three times: (D) immunohistochemistry showing decreased Beclin1 expression and increased vimentin. Tissues from 3 rats were examined; the representative image is shown. GAPDH served as the housekeeping gene; ** p < 0.01, compared with control group.
Figure 1. Long-term MNNG exposure induced EMT, proliferation, and inhibited autophagy in gastric tissues of rats. Rats were exposed to MNNG (100 mg/kg BW) every 5 days for 12 weeks: (A) hematoxylin and eosin-stained sections of gastric tissues after long-term MNNG exposure. Tissues from 3 rats were examined; the representative image is shown; (B) MNNG-induced alterations in the protein expression of autophagy, EMT and proliferation markers. Tissues from n = 3 rats as representative images; (C) MNNG reduced mRNA levels of autophagy and epithelial markers and increased the mesenchymal and proliferation markers. Real-time PCR results are these samples from 3 rats, and the experiments were repeated three times: (D) immunohistochemistry showing decreased Beclin1 expression and increased vimentin. Tissues from 3 rats were examined; the representative image is shown. GAPDH served as the housekeeping gene; ** p < 0.01, compared with control group.
Nutrients 14 05281 g001
Nutrients 14 05281 g002 550
Figure 2. MMNG decreased the PI3K/AKT pathway activation in the gastric tissues of rats. Rats were exposed to MNNG (100 mg/kg BW) every 5 days for 12 weeks. MNNG inhibited the expressions of phosphorylated PI3K, phosphorylated AKT, and mTOR. Tissues were from n = 3 rats as representative images.
Figure 2. MMNG decreased the PI3K/AKT pathway activation in the gastric tissues of rats. Rats were exposed to MNNG (100 mg/kg BW) every 5 days for 12 weeks. MNNG inhibited the expressions of phosphorylated PI3K, phosphorylated AKT, and mTOR. Tissues were from n = 3 rats as representative images.
Nutrients 14 05281 g002
Nutrients 14 05281 g003 550
Figure 3. MMNG-mediated autophagy was recovered by rapamycin in the gastric tissues of rats. Rats were divided into a control group, an MNNG group, an MNNG and DMSO group, and an MNNG and rapamycin group. Western blot showed that rapamycin reversed the downregulation of Beclin1, LC3-I/II, and ATG5 induced by long-term MNNG exposure. Tissues were from n = 3 rats as representative images.
Figure 3. MMNG-mediated autophagy was recovered by rapamycin in the gastric tissues of rats. Rats were divided into a control group, an MNNG group, an MNNG and DMSO group, and an MNNG and rapamycin group. Western blot showed that rapamycin reversed the downregulation of Beclin1, LC3-I/II, and ATG5 induced by long-term MNNG exposure. Tissues were from n = 3 rats as representative images.
Nutrients 14 05281 g003
Nutrients 14 05281 g004 550
Figure 4. MMNG-mediated EMT and proliferation reversed by autophagy activation in the gastric tissues of rats. Rats were divided into a control group, an MNNG group, an MNNG and DMSO group, and an MNNG and rapamycin group: (A) Western blot analyzed the levels of EMT and proliferation markers. Tissues were from n = 3 rats as representative images; (B) real-time PCR analyzed the expression of EMT and proliferation markers. Real-time PCR results are from the samples from 3 rats and the experiment was repeated three times. GAPDH served as the housekeeping gene; ** p < 0.01, compared with control group; ## p < 0.01; compared with MNNG group.
Figure 4. MMNG-mediated EMT and proliferation reversed by autophagy activation in the gastric tissues of rats. Rats were divided into a control group, an MNNG group, an MNNG and DMSO group, and an MNNG and rapamycin group: (A) Western blot analyzed the levels of EMT and proliferation markers. Tissues were from n = 3 rats as representative images; (B) real-time PCR analyzed the expression of EMT and proliferation markers. Real-time PCR results are from the samples from 3 rats and the experiment was repeated three times. GAPDH served as the housekeeping gene; ** p < 0.01, compared with control group; ## p < 0.01; compared with MNNG group.
Nutrients 14 05281 g004
Nutrients 14 05281 g005 550
Figure 5. Hesperidin activated autophagy in rats’ gastric tissues elicited by MNNG. Rats were divided into a control group, an MNNG group, an MNNG and solvent control group, and an MNNG and hesperidin group. Analysis of protein expression of autophagy markers was by Western blotting. Tissues were from n = 3 rats as representative images.
Figure 5. Hesperidin activated autophagy in rats’ gastric tissues elicited by MNNG. Rats were divided into a control group, an MNNG group, an MNNG and solvent control group, and an MNNG and hesperidin group. Analysis of protein expression of autophagy markers was by Western blotting. Tissues were from n = 3 rats as representative images.
Nutrients 14 05281 g005
Nutrients 14 05281 g006 550
Figure 6. Hesperidin attenuated EMT and proliferation elicited by MNNG. Rats were divided into a control group, an MNNG group, an MNNG and solvent control group, and an MNNG and hesperidin group: (A) analysis of protein expression of EMT and proliferation markers by Western blotting. Tissues were from n = 3 rats as representative images; (B) real-time PCR analyzed mRNA levels of EMT and proliferation markers. Real-time PCR results are the samples from 3 rats, and the experiment was repeated three times. GAPDH served as the housekeeping gene; ** p < 0.01, compared with control group; # p < 0.05; compared with MNNG group.
Figure 6. Hesperidin attenuated EMT and proliferation elicited by MNNG. Rats were divided into a control group, an MNNG group, an MNNG and solvent control group, and an MNNG and hesperidin group: (A) analysis of protein expression of EMT and proliferation markers by Western blotting. Tissues were from n = 3 rats as representative images; (B) real-time PCR analyzed mRNA levels of EMT and proliferation markers. Real-time PCR results are the samples from 3 rats, and the experiment was repeated three times. GAPDH served as the housekeeping gene; ** p < 0.01, compared with control group; # p < 0.05; compared with MNNG group.
Nutrients 14 05281 g006
Nutrients 14 05281 g007 550
Figure 7. Hesperidin reversed the MNNG-inhibited PI3K/AKT pathway. Rats were divided into a control group, an MNNG group, an MNNG and solvent control group, and an MNNG and hesperidin group. Hesperidin reversed the MNNG-inhibited PI3K/AKT pathway in the gastric tissues of rats. Western blotting analyzed expression changes of phosphorylated PI3K and phosphorylated AKT. Tissues were from n = 3 rats as representative images.
Figure 7. Hesperidin reversed the MNNG-inhibited PI3K/AKT pathway. Rats were divided into a control group, an MNNG group, an MNNG and solvent control group, and an MNNG and hesperidin group. Hesperidin reversed the MNNG-inhibited PI3K/AKT pathway in the gastric tissues of rats. Western blotting analyzed expression changes of phosphorylated PI3K and phosphorylated AKT. Tissues were from n = 3 rats as representative images.
Nutrients 14 05281 g007
Table
Table 1. Primer sequences.
Table 1. Primer sequences.
Gene NamePrimer Sequence (5′-3′)
E-cadherinForward: CAGGTCTCCTCATGGCTTTGC
Reverse: CTTCCGAAAAGAAGGCTGTCC
PCNAForward: CAAGAAGGTGTTGGAGGCA
Reverse: TCGCAGCGGTAGGTGTC
VimentinForward: CCTTGACATTGAGATTGCCA
Reverse: GTATCAACCAGAGGGAGTGA
GAPDHForward: AGGTCGGTGTGAACGGATTTG
Reverse: TGTAGACCATGTAGTTGAGGTCA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Liang, Z.; Song, J.; Xu, Y.; Zhang, X.; Zhang, Y.; Qian, H. Hesperidin Reversed Long-Term N-methyl-N-nitro-N-Nitroguanidine Exposure Induced EMT and Cell Proliferation by Activating Autophagy in Gastric Tissues of Rats. Nutrients 2022, 14, 5281. https://doi.org/10.3390/nu14245281

AMA Style

Liang Z, Song J, Xu Y, Zhang X, Zhang Y, Qian H. Hesperidin Reversed Long-Term N-methyl-N-nitro-N-Nitroguanidine Exposure Induced EMT and Cell Proliferation by Activating Autophagy in Gastric Tissues of Rats. Nutrients. 2022; 14(24):5281. https://doi.org/10.3390/nu14245281

Chicago/Turabian Style

Liang, Zhaofeng, Jiajia Song, Yumeng Xu, Xinyi Zhang, Yue Zhang, and Hui Qian. 2022. "Hesperidin Reversed Long-Term N-methyl-N-nitro-N-Nitroguanidine Exposure Induced EMT and Cell Proliferation by Activating Autophagy in Gastric Tissues of Rats" Nutrients 14, no. 24: 5281. https://doi.org/10.3390/nu14245281

APA Style

Liang, Z., Song, J., Xu, Y., Zhang, X., Zhang, Y., & Qian, H. (2022). Hesperidin Reversed Long-Term N-methyl-N-nitro-N-Nitroguanidine Exposure Induced EMT and Cell Proliferation by Activating Autophagy in Gastric Tissues of Rats. Nutrients, 14(24), 5281. https://doi.org/10.3390/nu14245281

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop