Next Article in Journal
Food Beliefs and the Risk of Orthorexia in Patients with Inflammatory Bowel Disease
Next Article in Special Issue
Differences in the Course, Diagnosis, and Treatment of Food Allergies Depending on Age—Comparison of Children and Adults
Previous Article in Journal
Starvation in Mice Induces Liver Damage Associated with Autophagy
Previous Article in Special Issue
Vegetable Extracts as Therapeutic Agents: A Comprehensive Exploration of Anti-Allergic Effects
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Nutrients
Volume 16
Issue 8
10.3390/nu16081192
nutrients-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Allergenic Shrimp Tropomyosin Distinguishes from a Non-Allergenic Chicken Homolog by Pronounced Intestinal Barrier Disruption and Downstream Th2 Responses in Epithelial and Dendritic Cell (Co)Culture

by
Marit Zuurveld
1,
Anna M. Ogrodowczyk
2,†,
Sara Benedé
3,4,†,
Rebecca Czolk
5,6,
Simona Lucia Bavaro
7,
Stefanie Randow
8,
Lidia H. Markiewicz
2,
Barbara Wróblewska
2,
Elena Molina
3,
Annette Kuehn
5,
Thomas Holzhauser
8 and
Linette E. M. Willemsen
1,*
1
Division of Pharmacology, Utrecht Institute for Pharmaceutical Science, Faculty of Science, Utrecht University, 3584 CG Utrecht, The Netherlands
2
Department of Immunology and Food Microbiology, Institute of Animal Reproduction and Food Research, Polish Academy of Sciences, 10-748 Olsztyn, Poland
3
Department of Bioactivity and Food Analysis, Instituto de Investigación en Ciencias de la Alimentación (CIAL, CSIC-UAM), 28049 Madrid, Spain
4
Department of Immunology, Ophthalmology and ENT, Faculty of Medicine, Complutense University of Madrid, 28040 Madrid, Spain
5
Department of Infection and Immunity, Luxembourg Institute of Health, 4354 Esch-sur-Alzette, Luxembourg
6
Faculty of Science, Technology and Medicine, University of Luxembourg, 1359 Kirchberg, Luxembourg
7
Institute of Sciences of Food Production, National Research Council (Ispa-Cnr), 70126 Bari, Italy
8
Division of Allergology, Paul-Ehrlich-Institut, 63225 Langen, Germany
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Nutrients 2024, 16(8), 1192; https://doi.org/10.3390/nu16081192
Submission received: 8 March 2024 / Revised: 29 March 2024 / Accepted: 11 April 2024 / Published: 17 April 2024
(This article belongs to the Special Issue Relationship Between Food Allergy and Human Health)
Browse Figures
Review Reports Versions Notes

Abstract

:
Background: Tropomyosins (TM) from vertebrates are generally non-allergenic, while invertebrate homologs are potent pan-allergens. This study aims to compare the risk of sensitization between chicken TM and shrimp TM through affecting the intestinal epithelial barrier integrity and type 2 mucosal immune activation. Methods: Epithelial activation and/or barrier effects upon exposure to 2–50 μg/mL chicken TM, shrimp TM or ovalbumin (OVA) as a control allergen, were studied using Caco-2, HT-29MTX, or HT-29 intestinal epithelial cells. Monocyte-derived dendritic cells (moDC), cocultured with HT-29 cells or moDC alone, were exposed to 50 μg/mL chicken TM or shrimp TM. Primed moDC were cocultured with naïve Th cells. Intestinal barrier integrity (TEER), gene expression, cytokine secretion and immune cell phenotypes were determined in these human in vitro models. Results: Shrimp TM, but not chicken TM or OVA exposure, profoundly disrupted intestinal barrier integrity and increased alarmin genes expression in Caco-2 cells. Proinflammatory cytokine secretion in HT-29 cells was only enhanced upon shrimp TM or OVA, but not chicken TM, exposure. Shrimp TM enhanced the maturation of moDC and chemokine secretion in the presence or absence of HT-29 cells, while only in the absence of epithelial cells chicken TM activated moDC. Direct exposure of moDC to shrimp TM increased IL13 and TNFα secretion by Th cells cocultured with these primed moDC, while shrimp TM exposure via HT-29 cells cocultured with moDC sequentially increased IL13 expression and IL4 secretion in Th cells. Conclusions: Shrimp TM, but not chicken TM, disrupted the epithelial barrier while triggering type 2 mucosal immune activation, both of which are key events in allergic sensitization.

1. Introduction

Food allergic diseases are a growing health problem in Western societies. A recent systematic review and meta-analysis described that up to almost 10% of children are burdened with a physician-diagnosed food allergy [1]. Most food allergic reactions are induced by peanut-, cow’s milk-, egg-, soy-, wheat-, tree nut-, fish-, and shellfish-containing products [2], but numerous other food allergens have been identified [3]. Allergenic food proteins often possess intrinsic properties to promote allergic sensitization, including intestinal epithelial activation and permeabilization [4,5,6,7,8,9]. This mucosal immune activation can lead to the activation of dendritic cells (DC) and subsequent polarization of a type 2 T cell response which drives the development of allergen-specific IgE production and IgE-mediated clinical reactions upon subsequent encounter with the allergen [10]. Currently, there is a lack of in vitro models enabling discrimination between proteins in food products with a low or high risk for allergic sensitization [11,12].
Tropomyosins are functional proteins present in all eukaryotic cells and key regulators of muscle contraction [13]. Typically, in most vertebrate species, including chicken, these tropomyosins have a low sensitization and allergenicity risk [14,15]. However, tropomyosins that can be found in arthropods, such as crustaceans and insects, or in mollusks are important allergens. Tropomyosins contain an evolutionary highly conserved dimeric α-helical structure, shown by the 54–60% shared sequence between vertebrate and invertebrate tropomyosins [16]. Recently it was described that vertebrate (chicken) and invertebrate (shrimp) tropomyosin differ in gastric digestion, but both bound to IgE from shrimp-allergic patients. However, a positive skin prick test was only observed with shrimp tropomyosin in these patients [17]. In several types of existing assays, the allergic effector response is characterized and associated with allergenic potential that would indicate towards the risk of an allergic reaction. However, sensitizing allergenicity identifies the possible intrinsic property of a protein to activate type 2 driving immune cascades and, thus, increases the risk of allergic sensitization and food allergy development. The first step in this cascade is the breaching and/or activation of the epithelial barrier followed by activation of DC and a type 2 T cell response [18]. A previous study has shown this response for ovalbumin (OVA) as model allergen, which was able to activate intestinal epithelial cells (IEC) and/or monocyte-derived dendritic cells (moDC) [19].
This study aims to investigate the differential capacity of chicken TM (low sensitizing capacity) versus shrimp TM (high sensitizing capacity) in epithelial barrier disruption and activation, and in mucosal type 2 activation. Human in vitro models were used, including intestinal epithelial cells and blood-derived immune cells, which may provide tools to study the intrinsic sensitizing properties of current and future dietary proteins.

2. Materials and Methods

2.1. Allergenic Proteins

High-allergenic recombinant black tiger shrimp tropomyosin (Pen m 1; shrimp TM) and low-allergenic recombinant chicken tropomyosin (chicken TM) were expressed in E. coli and purified as previously described [17,20]. The recombinant proteins were purified from LPS (as described in the Supplemental Methods in Supplementary Materials) and the final concentration of LPS was lower than 1 ng (10 EU)/mL for both TM proteins when used in a concentration of 50 μg/mL. The amino acid sequences of shrimp TM and chicken TM are presented in Supplemental Figures S5 and S6. A detailed description of cloning, expression and isolation can be found in the Supplemental Methods in Supplementary Materials. A ‘control’ condition was used in every cell culture experiment; this control medium condition was not exposed to any additional protein component. OVA was used as an allergenic protein model known to induce activation of IEC and/or moDC to drive sequential mucosal type 2 responses [19,21].

2.2. Caco-2, HT-29MTX and HT-29 Cell Culture

Several human IEC model cell lines (colon carcinogenic origin) were used. Caco-2 cells were used for epithelial barrier studies; HT-29 cells were used to study epithelial cytokine responses. Caco-2 cells (passages 28–33 and 45–47) from the American Type Culture Collection (ATCC, USA) were cultured for 21 days in DMEM medium supplemented with 10% fetal bovine serum (FBS), 1% l-glutamine, 1% sodium pyruvate, 1% penicillin/streptomycin/amphotericin and 1% non-essential amino acids (all from Biowest, Nuaillé, France). The Caco-2 cells were seeded at a density of 1 × 105 cells/well onto 12 well or 1.67 × 104 cells/well onto 24 well transwell inserts (0.4 μm pore size; Costar, Washington, DC, USA; Corning, New York, NY, USA) and grown 2–3 weeks post confluency before use for barrier studies. HT29-MTX cells (methotrexate-selected HT29 clone, gifted by Dr. Giblin from Teagasc Food Research Centre, Moorepark, Fermoy, Ireland) were seeded in a 3:1 ratio (Caco-2:HT-29MTX) at a density of 3 × 104 cells/well onto 12 well transwell inserts (0.4 μm pore size; Costar, Corning).
HT-29 cells (passage 158–161), obtained from ATCC, were grown until ~80% confluency in 25 cm2 cell culture flasks was achieved. McCoy’s 5A medium (Gibco, Norristown, PA, USA), containing 10% heat-inactivated FBS, 1% penicillin and streptomycin (Sigma-Aldrich, London, UK) was used. Upon trypsinization, HT-29 cells were 5 times diluted based on surface area and seeded in transwell inserts (Corning Incorporated, New York, NY, USA) and cultured for 6 days into confluent layers to be used for coculture experiments.
Additionally, Caco-2 cells were seeded and cultured for 21 days, or HT-29 cells were seeded and cultured into confluent layers for 6 days in 96 wells plates.

2.3. Transepithelial Electrical Resistance (TEER) and Cytotoxicity Assay

Barrier permeability of transwell cultured Caco-2 or mixed Caco-2/HT-29MTX monolayer, featuring characteristics of polarized enterocytes and mucus-producing cells, was measured using a Millicell ERS-2 electrical-resistance system (Millipore, Burlington, MA, USA) prior to and during the allergen exposure and TEER was expressed as ohm.cm2.
The LDH (lactate dehydrogenase) activity cytotoxicity assay was carried out in the supernatants of exposed Caco-2 cells by using the CyQUANT™ LDH Cytotoxicity Assay Kit (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions and expressed as an absorbance value (OD490-655 nm).

2.4. Caco-2 and PBMC Coculture

Healthy volunteer donor peripheral blood mononuclear cells (PBMCs) were isolated by density-gradient separation (Ficoll-Histopaque, GE Healthcare, Barcelona Spain) from heparinized venous blood samples from 5 non-allergic subjects obtained from the Institute of Food Science Research (CIAL, Spain) blood library. Written informed consent was obtained from all participants, according to the procedures approved by the Bioethics Committee of the CIAL.
PBMCs (2 × 106 cells/well) were added to the basolateral compartment of 12-well transwell plates where Caco-2 cells (at passage 28–33) where previously fully differentiated. Chicken TM, shrimp TM or OVA were apically added to the Caco-2 and PBMCs coculture and incubated for 8 h at 37 °C and 5% CO2. Caco-2 cells were preserved at −80 °C in RA-1 buffer (Macherey-Nagel, Düren, Germany) for gene expression analyses by qPCR (see Supplemental Methods in Supplementary Materials).

2.5. HT-29-moDC or moDC and Sequential DC/T Cell Coculture

This coculture model to study mucosal immunity was previously described in more detail [19]. In brief, healthy donor PBMC from volunteers, who had given written informed consent for research purposes, were obtained from the Dutch Blood bank (Amsterdam, The Netherlands). Monocytes and naïve Th cells were isolated using negative selection by magnetic beads. Monocytes were differentiated into immature moDC for 6 days using GM-CSF and interleukin (IL)4, and Th cells were stored in liquid nitrogen. After HT-29 cells reached confluence in the transwells, 5 × 105 moDC were added to the basolateral compartment for 48h. The epithelial cells in the HT-29/moDC coculture were apically exposed to chicken TM or shrimp TM. Simultaneously, wells containing moDC without IEC, were also exposed to chicken TM or shrimp TM for 48h, allowing direct interaction with the moDC. Subsequently, moDC were collected for analysis by flow cytometry (FACS CantoII, BD Biosciences, Franklin Lakes, NJ, USA) and coculture with allogenic naïve T cells (stimulated with αCD3 and IL2). moDC and T cells (in a 1:10 ratio) were cocultured for 96 h. Cells were collected for flow cytometric analysis and supernatants were collected to measure cytokines using ELISA (R&D systems, Minneapolis, MN, USA) or multiplex array (Meso Scale Discovery, Rockville, MD, USA).

2.6. Cytokine Measurements

Cytokine levels were determined in collected cell-free supernatants. Concentrations of IL33, TSLP, IL25, CCL20, CCL22, IL8 and IL13, IL4, IFNγ, IL10, IL17, IL21 and TNFα, were measured by commercially available ELISA kits (R&D systems, USA or Invitrogen, USA) according to the manufacturer’s instructions. To compare cytokine secretion after OVA, shrimp TM or chicken TM exposure of Caco-2 cells and HT-29 cells (cultured in 96 wells), a multiplex array was performed (Meso Scale Discovery, USA) to measure secreted levels of epithelial-derived IL33, TSLP, IL25, IL1α, IL1β, IL6, IL8 CCL20, CCL22 and TNFα in undiluted supernatant, according to the manufacturer’s instructions.

2.7. Flow Cytometry

Flow cytometric analysis was performed on cocultured moDC and Th cells. After collection of the cells, the cells were washed with PBS, stained with Fixable Viability Dye eFluor 780 (eBioscience, San Diego, CA, USA) and nonspecific binding was blocked. Staining of moDC was performed using titrated amounts of CD11c-PerCP eFluor 710, HLA-DR-PE, CD80-FITC, CD86-PE-Cy7 and OX40L-APC. Staining of Th cells was performed with titrated volumes of CD4-PerCP-Cy5.5, CXCR3-AF488, CRTH2-APC and IL13-PE. All antibodies were purchased from eBioscience or BD Biosciences. Flow cytometric data was collected using a BD FACS CantoII (BD Biosciences, USA) and analyzed using FlowLogic software (Version 8, Inivai Technologies, Mentone, Australia).

2.8. Gene Transcription Analysis

Total RNA was isolated using an RNA Isolation Kit (Macherey-Nagel, Düren, Germany) and reverse transcribed into cDNA using PrimeScript RT Reagent Kit (Takara Bio Inc., Shiga, Japan). Primer pairs and thermal cycling conditions for qPCR assays are described in Table 1. Relative gene transcription was calculated by normalizing data to the transcription of the Gadph gene, using the 2−ΔΔCT method.

2.9. Statistics

Statistical analysis was performed using Graphpad Prism (version 9.4.1). Data was analyzed using One-Way ANOVA, or Friedmann test when data did not fit a normal distribution. All conditions were compared to the control condition, therefore a Dunett’s post hoc test (if normally distributed) or Dunn’s post hoc test was performed. A Two-Way ANOVA was applied to analyze TEER data measured at several time points during protein exposure. p < 0.05 is considered statistically significant, and data is represented as mean ± standard error of mean (SEM) of n = 3 or n = 5 independent repeats of a full dataset per in vitro model.

3. Results

3.1. Shrimp TM Decreases Epithelial Barrier and Induces Expression of Alarmins

First the effects of chicken TM, shrimp TM or OVA exposure on intestinal epithelial barrier integrity were investigated in transwell Caco-2 models. Forty-eight hour exposure of Caco-2 cells (Figure 1A) to chicken TM or OVA resulted in an overall increased TEER compared to medium controls for most concentrations (Figure 1B,D,E). By contrast, all shrimp TM doses, except for 2 μg/mL, resulted in an overall decrease in TEER (Figure 1C). However, at the 6 h timepoint only a decrease in TEER by 10, 25 and 50 μg/mL shrimp TM was observed, which was not detected for similar concentrations of chicken TM and OVA. Secretion of IL8, as marker of epithelial activation, was increased in all conditions (Figure 1F). Nonetheless, in this model some increase in cytotoxicity was also measured when exposing Caco-2 to all allergens except for the lowest concentrations used (Figure 1G). Subsequent experiments were performed with 50 μg/mL of tropomyosins to provoke an epithelial response, which allows comparison to the concentrations used for OVA-induced IEC activation. In addition, subsequent experiments did not reveal a decrease in viability upon exposure to 50 μg/mL tropomyosins (Supplemental Figure S1D,E).
Next, Caco-2/HT-29MTX cells were cultured in transwells and exposed to 50 μg/mL of chicken TM, shrimp TM or OVA for 8 h to validate the decrease in barrier integrity found in Caco-2 cells (Figure 1H). Similar to the Caco-2 cells, TEER was decreased after exposure to shrimp TM in Caco-2/HT-29MTX cultures compared to the medium control, and this was not observed for chicken TM or OVA (Figure 1I). In addition, a coculture was performed combining Caco-2 cells grown in 12 wells transwell plates with PBMCs in the basolateral compartment (Figure 1J). After 8 h of incubation with chicken TM, shrimp TM or OVA, expression of type-2-associated alarmins Il33, Il25, and Tslp was increased in Caco-2 cells after exposure to 25 μg/mL and 50 μg/mL shrimp TM (Supplemental Figure S1A–C; Figure 1K–M). By contrast, 50 μg/mL chicken TM exposure only enhanced Il33 expression and OVA did not enhance mRNA expression of these alarmins (Figure 1K). In addition, PBMC-derived cytokines were measured but these remained below the detection limit.

3.2. Cytokine and Chemokine Secretion Is Enhanced in HT-29 Cells after Allergen Exposure

In order to study chicken TM, shrimp TM or OVA-induced IEC activation and cytokine secretion, the effects on Caco-2 and HT-29 cell lines were compared using multiplex analyses. Cells were grown in 96 well plates and exposed for 48 h to 50 μg/mL of each protein (Figure 2A). No cytotoxicity was observed in these cultures (Supplemental Figure S1D,E). Despite increased mRNA expression of Il33, Il25 and Tslp in transwell-grown Caco-2 cells after shrimp TM exposure (Figure 1K–M), the secretion levels of these cytokines were not elevated after 48 h exposure in the 96 wells plates (Figure 2B–D). Yet, CCL20 secretion was significantly increased in this condition (Figure 2G). On the other hand, enhanced secretion of IL25, IL1α, IL1β, CCL22, IL8, and TNFα was shown by HT-29 cells when exposed to shrimp TM, but not with chicken TM, which even lowered IL8 secretion (Figure 2C,E,F,H,I,K). Increased cytokine secretion by HT-29 cells was observed to a lesser extent after exposure to 25 μg/mL shrimp TM (Supplemental Figure S1F). OVA exposure also significantly enhanced secretion of ILβ, CCL22, and IL8 (Figure 2F,H,I). A dose–response experiment was performed in HT-29 cells and epithelial-derived mediators were measured by ELISA. Secretion of IL8 and CCL20 from HT-29 cells in response to either shrimp TM or OVA exposure dose-dependently increased, while chicken TM did not affect these mediators (Supplemental Figure S2A–E).

3.3. Shrimp TM Induces moDC Activation in Presence and Absence of IEC

To study the sensitizing capacity of chicken TM and shrimp TM, these proteins were added to HT-29 cell/moDC (IEC-DC) coculture or moDC (DC) in absence of HT-29 cells for 48 h (Figure 3A). After exposure, chicken TM increased the proportion of moDC expressing the costimulatory receptor CD80 (Figure 3B) as well as CCL22 secretion (Figure 3E). A small increase in CCL20 secretion was observed (Figure 3F), but only during direct exposure of moDC. Exposure to shrimp TM also increased the percentage of moDC expressing CD80 (Figure 3B) and secretion of CCL20, CCL22, and IL8 (Figure 3E–G) when exposed to IEC-DC or directly to moDC. During direct shrimp TM exposure to moDC, the percentage of cells expressing OX40L was also increased (Figure 3D).

3.4. Shrimp TM Promotes a Type 2 T Cell Response via moDC

After exposing IEC-DC and moDC to chicken TM or shrimp TM, the primed moDC were collected for a subsequent coculture with allogenic naïve Th cells for 4 days. Viability was assessed after each culture step (Supplemental Figure S3). The viability of IEC was minorly reduced (by 25%) due to exposure to 50 μg/mL shrimp TM, yet the viability of DC was reduced by 53%. However, shrimp TM exposure to IEC-DC did not affect the viability of the underlying moDC (Supplemental Figure S3). After the moDC/T cell coculture, the T cell response was assessed based on Th subset development and cytokine secretion. The percentage of Th2 cells, based on CRTH2 expression, was not affected by coculture with chicken-TM- or shrimp-TM-primed moDC (Figure 4B). The percentage of cells expressing intracellular type 2 IL13 (Figure 4C) and IL4 secretion (Figure 4G) was enhanced in T cells cocultured with shrimp TM primed IEC-DC, while secretion of IL13 was enhanced in T cells cocultures with shrimp TM primed DC (Figure 4D). Furthermore, the proportion of CXCR3+ Th1 cells was decreased upon coculture with shrimp-TM-primed moDC (Figure 4E), even though the secretion of type 1 IFNγ was not significantly changed upon coculture with allergen-primed moDC (Figure 4F). Secretion of IL17 was decreased upon coculture with chicken-TM- or shrimp-TM-primed IEC-DC or moDC (Figure 4H). Furthermore, TNFα and IL21 secretion was significantly enhanced upon coculture of T cells with shrimp-TM-primed moDC (Figure 4I,J), while the secretion of regulatory IL10 (Supplemental Figure S3D) was not affected. Supplemental Figure S4B shows a heatmap of overall data.

4. Discussion

Shellfish allergies belong to the top eight food allergies [25] and tropomyosins are common allergenic proteins in shellfish. Although highly conserved in the animal kingdom, a clear difference between low- and high-allergenic potential is found between, respectively, vertebrate and invertebrate tropomyosins [15]. In this study, we aimed to investigate the effects of a recombinant chicken tropomyosin and recombinant shrimp tropomyosin on barrier integrity and mucosal immune activation to reveal their difference in sensitizing allergenicity. Hen’s egg-derived OVA was used as a control allergen, as it is among the top three most common food allergy inducers [2]. Previously, it was shown that OVA promotes a type 2 immune response in vitro, demonstrating its sensitizing capacity [19,26].
Proper intestinal epithelial integrity contributes to homeostasis and may prevent allergic sensitization [27,28,29]. A decrease in epithelial barrier integrity allows penetrations of allergens and potentially promotes the development of type 2 immune responses [30,31]. Next to environmental triggers disrupting the intestinal epithelial barrier and/or activating the epithelial lining, various allergenic proteins are known for their intrinsic capacity to activate epithelial cells and/or their protease activity [32,33,34]. However, recently it was established that both shrimp TM as well as OVA interact with the intestinal epithelium via upregulation of the Hippo signaling pathway, which promotes epithelial instability and production of type 2 cytokines [35]. In the current study, shrimp TM was found to reduce barrier integrity after 6 h exposure in Caco-2 cell cultures and 8 h exposure in Caco-2/HT29MTX cell cultures, which was not observed for the chicken TM or OVA. Previous studies exposing Caco-2 cells in transwell found that intestinal permeability remained intact as TEER values stayed constant, while OVA was taken up by the cells and transported over the epithelium [36,37]. Beyond barrier disruption, allergens may also activate epithelial cells to produce alarmins and inflammatory mediators that can instruct underlying immune cells. For example, Der p 10, a tropomyosin from house dust mites, is known to interact with epithelial expressed Dectin-1 [38]. Similar to Der p 10, OVA may be able to bind to Dectin-1, which normally protects against allergy development [39]. In allergic individuals, abnormal epithelial Dectin-1 expression via altered epigenetic regulation is observed [39,40], connecting epithelial functioning to allergic sensitization. Similar interactions can be hypothesized for other tropomyosins due to structural homology. However, there is no data available to verify this.
Epithelial injury often coincides with the release of alarmins such as IL33, TSLP and IL25 and pro-inflammatory IL8 secretion. In this study an increased fold change in alarmin gene expression was observed in Caco-2 cells after shrimp TM exposure (Figure 1). This is in line with the increased mRNA expression of Tslp and Il33 in the intestine of mice that were sensitized against a shrimp TM (Litopenaeus vannamei) as described by Fu et al. [41]. Furthermore, it is known that epithelial exposure to allergenic proteins promotes the secretion of multiple cytokines, such as of IL33, IL25, TSLP and IL1α or IL1β [42,43]. Compared to Caco-2, the HT-29 cells were more responsive to the applied proteins allowing discrimination between low and high sensitizing TM (further visualized in Supplemental Figure S4A). Albeit from carcinogenic origin, Caco-2 and HT-29 are both commonly used model epithelial cell lines. In this study, these cell lines were used to develop the presented in vitro models, and although future studies should focus on the use of primary human intestinal epithelial cells, these cell lines possess several relevant characteristics as a model for the human intestine. Caco-2 can differentiate in culture and form ciliated polarized monolayers representing fully differentiated villus tip enterocytes. HT-29 cells do not differentiate in culture and resemble crypt epithelial cells. Therefore, these cells have different phenotypes as well as receptor expression and signaling cascades, although both resemble relevant functions of primary human intestinal epithelial cells [44,45]. This may underly the difference in sensitivity of these cell lines for activation and concomitant cytokine release upon protein exposure. Here, increased secretion of several of these cytokines from HT-29 cells was measured after exposure to shrimp TM, but not chicken TM, further emphasizing the differential epithelial interaction between the tropomyosins. The HT-29 cells were able to discriminate between proteins with high and low sensitizing allergenicity since the chicken TM, which has a low sensitizing risk, did not provoke an increase in any of the mediators. Even though it is known that allergenic proteins can induce cytokine secretion from intestinal epithelial cells, the exact interactions with the epithelium are often poorly understood [46]. Future studies could further elaborate on these effects by using primary intestinal epithelial cells or human organoids.
After IEC-DC or moDC were exposed for 48 h to chicken TM or shrimp TM, primed DC were subsequently cocultured with naïve T cells to assess the functional immune response after TM exposure. The effects of OVA exposure in this sequential mucosal immune model were already recently published, revealing type 2 immune polarization when OVA was directly exposed to DC and to a lesser extent this was also the case for IEC-DC [19]. The current study shows the differential activating capacity of shrimp TM versus chicken TM in IEC and moDC (visually summarized in Supplemental Figure S4B). Shrimp TM enhanced the maturation of DC, based on an enhanced frequency of DC expressing of CD80 and OX40L, and secretion of CCL20, CCL22 and IL8 by the DC. Except for the increase in OX40L expression, IEC-DC shrimp TM exposure enhanced DC activation in a similar manner. Especially, expression of OX40L by DC and secretion of CCL22 are related to promote subsequent Th2 immune development [47,48]. Although chicken TM exposure also promoted expression of CD80 and CCL20 as well as CCL22 chemokine secretion, this only occurred when moDC were directly exposed to chicken TM. In contrast to shrimp TM, chicken TM did not activate IEC-DC. This shows that also in interaction with moDC, the presence of IEC aids to differentiate between high and low sensitizing allergenicity of these tropomyosin sources.
Exposure to shrimp TM via IEC slightly altered the response of the DC compared to direct exposure of DC. However, the primed DC strongly differ in their capacity to induce T cell polarization. Shrimp TM-DC provoked increased IL13 secretion, while lowering Th1 development, whereas shrimp TM-IEC-DC induced intracellular IL13 expression and IL4 secretion in T cells. Interestingly, shrimp TM-DC enhanced proinflammatory TNFα and IL21 release on top of the type 2 immune shift after T cell coculture. A similar immune restraining effect by IEC was previously observed for OVA in this model, even though OVA was capable of activating IEC as well [19]. The current study did not assess subsequent B cell antibody production upon coculture with primed T cells. However, considering the known role of IL4 and IL13 in inducing IgE class switching [49] and based on our previous results [19], it could be hypothesized that the functional response of T cells cocultured with either shrimp TM-IEC-DC or shrimp TM-DC could be sufficient to induce IgE production in B cells. Future studies are necessary to confirm the generation of an IgE-dominant humoral response by shrimp TM.
Xu et al. exposed moDC to Bla g 7, an allergenic cockroach TM, and subsequently cocultured the moDC with T cells [50]. Bla g 7 exposure enhanced expression of Th2 driving TIM-4, CD80 and CD86 on moDC. These moDC were then capable of promoting a type 2 response during T cell coculture, which is comparable to our results for shrimp TM. Even though chicken TM was capable of activating DC (albeit less pronounced than shrimp TM), these DC were unable to instruct a type 2 response in T cells. Furthermore, beyond being capable of producing pro-inflammatory mediators, IEC are known for their capability to promote tolerance development and control intestinal homeostasis by dampening mucosal immune activation via the production of tolerogenic factors such as TGFβ or retinoic acid [51]. Indeed, as indicated in the heatmap (Supplemental Figure S4B), in general when compared to medium control, chicken TM did not provoke type 2 activation when exposed via epithelial cells, while shrimp TM did which may lead to allergic sensitization. This could be mediated by the secretion of tolerogenic factors, which have not been the focus of this current study. However, in the absence of epithelial cells, thus upon direct exposure of moDC to shrimp TM, a strong inflammatory type 2 response was provoked. In the current study, the dose of 50 mg/mL shrimp TM, but not chicken TM, was found to cause loss of viability in DC and IEC to some extent (Supplemental Figure S3). This may have further contributed to the provocation of inflammatory responses leading to type 2 development of sequential T cell responses. In future studies, the mechanisms by which shrimp TM versus chicken TM differ in their intrinsic capacity to induce type 2 activation, including the contribution of DC maturation in presence or absence of IEC and the consequent Th2 development, should be further addressed. In addition to increased OX40L expression, Tim-4 expression may also contribute to Th2 polarization [52]. On the other hand, blocking Tim-4 on DC may lead to regulatory T cell development, and increased expression of jagged-1 may also facilitate this. The currently presented data demonstrate the differential immune activating capacity of structurally similar tropomyosins and emphasize the importance of understanding the underlying mechanism of allergic sensitization to improve allergenicity risk assessment of current and future dietary protein sources.

5. Conclusions

This study focused on the differential epithelial barrier disruption and mucosal immune activation by homologous tropomyosins with known differences in sensitizing allergenicity. The allergenic invertebrate shrimp tropomyosin provoked a proinflammatory response in IEC and/or DC, while disrupting epithelial barrier properties. The non-allergenic vertebrate chicken tropomyosin did not induce type 2 activation of IEC nor induced type 2 immunity. Future studies should elaborate on elucidating the mechanism underlying epithelial barrier disruption and mucosal immune activation by allergenic proteins, such as tropomyosins. This would allow for the further development of predictive tools to assess potential sensitizing capacity of food proteins.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/nu16081192/s1, Figure S1. Fold change in gene expression was measured 8 h after 25 or 50 μg/mL chicken TM, shrimp TM or OVA exposure in Caco-2 cells cocultured with PBMCs. mRNA expression of the alarmins (A) Il33, (B) Il25, and (C) Tslp was increased upon exposure to either concentration of sshrimp TM. D) LDH release and (E) WST conversion by Caco-2 cells and HT-29 cells respectively was not affected 48 h after exposure in 96 wells flat bottom plates to increasing doses of chicken TM, shrimp TM or OVA. (F) A multiplex array was performed on supernatants from Caco-2 cells and HT-29 cells that were exposed to 25 and 50 μg/mL chicken TM or shrimp TM, or 50 μg/mL OVA. Next to the increased secretion of IL25, TSLP, IL1β, CCL22, and TNFα after exposing HT-29 cells to 50 μg/mL sdhrimp TM, a similar effect on cytokine secretion was seen after exposure to 25 μg/mL shrimp TM. Both chicken TM exposures decreased secretion of IL1α in Caco-2 cells, but exposure to this low-allergenic protein did not induce any other changes in cytokines secretion from Caco-2 cells or HT-29 cells. Data is analyzed by One-Way ANOVA or Friedman test when data did not fit a normal distribution, n = 3 or n = 5, mean ± SEM (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001). Figure S2. HT-29 cells were exposed to increasing doses of chicken TM, shrimp TM or OVA for 48 h in 96 wells flat bottom plates. Secreted A) IL33, B) TSLP, C) IL8, D) CCL20, and E) CCL22 were measured by ELISA. Exposure to chicken TM did not enhance cytokine secretion, exposure to shrimp TM and OVA induced a dose-dependent enhanced secretion of IL8 and CCL20. Data is analyzed by One-Way ANOVA, n = 3, mean ± SEM (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001). Figure S3. After culture of moDC with or without HT-29 cells and coculture of primed DC with T cells, viability was assessed. Viability of A) HT-29 cells after 50 μg/mL shrimp TM exposure. B) Viability of moDC was not affected by chicken TM or shrimp TM exposure when cocultured with HT-29 cells. However when moDCs were directly exposed to TmH, cell viability was significantly decreased. Coculture of the primed DCs with T cells did not affect C) viability or D) IL10 secretion. E) Furthermore, the gating strategy used to determine the viable T helper cells population and corresponding FMOs are presented. Data is analyzed by One-Way ANOVA, n = 3, mean ± SEM (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001). Figure S4. A visual representation, using z-scores, of (A) the cytokine secretion from Caco-2 and HT29 cells cultured in 96 well flatbottom culture plates and, (B) cytokine secretion and marker expression upon exposure to chicken TM or shrimp TM in the IEC/DC/T cell coculture model. Figure S5. Amino acid (aa) sequence of recombinant chicken α-1 tropomyosin (UniProt P04268), including residual aa from cloning site (italic) and His6-Tag (bold), with a calculated molecular weight of 34.044 kDa and pI of 4.83 (Expasy ProtParam). Figure S6. Amino acid (aa) sequence of recombinant shrimp tropomyosin (UniProt A1KYZ2), including residual aa from cloning site (italic) and His6-Tag (bold), with a calculated molecular weight of 34.2 kDa and pI of 4.96 (Expasy ProtParam). Figure S7. (A) Coomassie-stained chicken tropomyosin after removal of endotoxin with a major protein band around 36 kDa. (B) Silver stained and Coomassie stained shrimp tropomyosin after removal of endotoxin with a major protein band around 35 kDa (M, molecular kDa marker; chTM, chicken tropomyosin; sTM, shrimp tropomyosin). Refs. [53,54] are cited in the Supplementary Materials.

Author Contributions

Conceptualization, all; investigation, M.Z., A.M.O., S.B. and S.L.B.; data curation, M.Z.; writing—original draft preparation, M.Z. and L.E.M.W.; writing—review and editing, all authors. All authors have read and agreed to the published version of the manuscript.

Funding

Part of this study was financed by the PPP allowance made available by TKI Health Holland, Top Sector Life Sciences and Health, to the Utrecht University (LSHM18037, acronym HMOS4ALL). Part of this study was funded by the project PID2021-123236OB-100 of the Spanish Ministry of Science and Innovation. Part of this study was financed by the statutory funds of Statutory funds of the Institute of Animal Reproduction and Food Research, Polish Academy of Sciences, Olsztyn, Poland. This collaborative effort is a spin off from the Imparas, Cost Action FA1402, working group 2 in vitro models.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

We are grateful for the technical and analytical support by Elke Völker for LPS removal, Philipp Windecker for endotoxin measurements and Andreas Reuter for verification of chicken tropomyosin identity by mass spectrometry.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Spolidoro, G.C.I.; Amera, Y.T.; Ali, M.M.; Nyassi, S.; Lisik, D.; Ioannidou, A.; Rovner, G.; Khaleva, E.; Venter, C.; van Ree, R.; et al. Frequency of food allergy in Europe: An updated systematic review and meta-analysis. Allergy Eur. J. Allergy Clin. Immunol. 2022, 78, 351–368. [Google Scholar] [CrossRef] [PubMed]
  2. Loh, W.; Tang, M.L.K. The epidemiology of food allergy in the global context. Int. J. Environ. Res. Public Health 2018, 15, 2043. [Google Scholar] [CrossRef] [PubMed]
  3. Matsuo, H.; Yokooji, T.; Taogoshi, T. Common food allergens and their IgE-binding epitopes. Allergol. Int. 2015, 64, 332–343. [Google Scholar] [CrossRef] [PubMed]
  4. Ménard, S.; Cerf-Bensussan, N.; Heyman, M. Multiple facets of intestinal permeability and epithelial handling of dietary antigens. Mucosal Immunol. 2010, 3, 247–259. [Google Scholar] [CrossRef] [PubMed]
  5. Tordesillas, L.; Gómez-Casado, C.; Garrido-Arandia, M.; Murua-García, A.; Palacín, A.; Varela, J.; Konieczna, P.; Cuesta-Herranz, J.; Akdis, C.A.; O’Mahony, L.; et al. Transport of Pru p 3 across gastrointestinal epithelium—An essential step towards the induction of food allergy? Clin. Exp. Allergy 2013, 43, 1374–1383. [Google Scholar] [CrossRef] [PubMed]
  6. Dhanapala, P.; De Silva, C.; Doran, T.; Suphioglu, C. Cracking the egg: An insight into egg hypersensitivity. Mol. Immunol. 2015, 66, 375–383. [Google Scholar] [CrossRef] [PubMed]
  7. Smits, M.; Nooijen, I.; Redegeld, F.; de Jong, A.; Le, T.; Knulst, A.; Houben, G.; Verhoeckx, K. Digestion and Transport across the Intestinal Epithelium Affects the Allergenicity of Ara h 1 and 3 but Not of Ara h 2 and 6. Mol. Nutr. Food Res. 2021, 65, e2000712. [Google Scholar] [CrossRef] [PubMed]
  8. Niewiem, M.; Grzybowska-Chlebowczyk, U. Intestinal Barrier Permeability in Allergic Diseases. Nutrients 2022, 14, 1893. [Google Scholar] [CrossRef] [PubMed]
  9. Dijk, W.; Villa, C.; Benedé, S.; Vassilopoulou, E.; Mafra, I.; Garrido-Arandia, M.; Blanco, M.M.; Bouchaud, G.; Hoppenbrouwers, T.; Bavaro, S.L.; et al. Critical features of an in vitro intestinal absorption model to study the first key aspects underlying food allergen sensitization. Compr. Rev. Food Sci. Food Saf. 2023, 22, 971–1005. [Google Scholar] [CrossRef]
  10. Ballegaard, A.S.R.; Bøgh, K.L. Intestinal protein uptake and IgE-mediated food allergy. Food Res. Int. 2023, 163, 112150. [Google Scholar] [CrossRef] [PubMed]
  11. Mazzucchelli, G.; Holzhauser, T.; Velickovic, T.C.; Diaz-Perales, A.; Molina, E.; Roncada, P.; Rodrigues, P.; Verhoeckx, K.; Hoffmann-Sommergruber, K. Current (Food) Allergenic Risk Assessment: Is It Fit for Novel Foods? Status Quo and Identification of Gaps. Mol. Nutr. Food Res. 2018, 62, 1700278. [Google Scholar] [CrossRef] [PubMed]
  12. Verhoeckx, K.; Broekman, H.; Knulst, A.; Houben, G. Allergenicity assessment strategy for novel food proteins and protein sources. Regul. Toxicol. Pharmacol. 2016, 79, 118–124. [Google Scholar] [CrossRef] [PubMed]
  13. El-Mezgueldi, M. Tropomyosin dynamics. J. Muscle Res. Cell Motil. 2014, 35, 203–210. [Google Scholar] [CrossRef] [PubMed]
  14. Reese, G.; Ayuso, R.; Lehrer, S.B. Tropomyosin: An invertebrate pan-allergen. Int. Arch. Allergy Immunol. 1999, 119, 247–258. [Google Scholar] [CrossRef] [PubMed]
  15. Cheng, J.H.; Wang, H.; Sun, D.W. An overview of tropomyosin as an important seafood allergen: Structure, cross-reactivity, epitopes, allergenicity, and processing modifications. Compr. Rev. Food Sci. Food Saf. 2022, 21, 127–147. [Google Scholar] [CrossRef] [PubMed]
  16. Ruethers, T.; Taki, A.C.; Johnston, E.; Nugraha, R.; Le, T.T.K.; Kalic, T.; McLean, T.; Kamath, S.D.; Lopata, A.L. Seafood allergy: A comprehensive review of fish and shellfish allergens. Mol. Immunol. 2018, 100, 28–57. [Google Scholar] [CrossRef] [PubMed]
  17. Klueber, J.; Costa, J.; Randow, S.; Codreanu-Morel, F.; Verhoeckx, K.; Bindslev-Jensen, C.; Ollert, M.; Hoffmann-Sommergruber, K.; Morisset, M.; Holzhauser, T.; et al. Homologous tropomyosins from vertebrate and invertebrate: Recombinant calibrator proteins in functional biological assays for tropomyosin allergenicity assessment of novel animal foods. Clin. Exp. Allergy 2020, 50, 105. [Google Scholar] [CrossRef] [PubMed]
  18. Van Bilsen, J.H.; Sienkiewicz-Szłapka, E.; Lozano-Ojalvo, D.; Willemsen, L.E.; Antunes, C.M.; Molina, E.; Smit, J.J.; Wróblewska, B.; Wichers, H.J.; Knol, E.F.; et al. Application of the adverse outcome pathway (AOP) concept to structure the available in vivo and in vitro mechanistic data for allergic sensitization to food proteins. Clin. Transl. Allergy 2017, 7, 13. [Google Scholar] [CrossRef] [PubMed]
  19. Zuurveld, M.; Díaz, C.B.; Redegeld, F.; Folkerts, G.; Garssen, J.; van’t Land, B.; Willemsen, L.E. An advanced in vitro human mucosal immune model to predict food sensitizing allergenicity risk: A proof of concept using ovalbumin as model allergen. Front. Immunol. 2023, 13, 1073034. [Google Scholar] [CrossRef]
  20. Popp, J.; Trendelenburg, V.; Niggemann, B.; Randow, S.; Völker, E.; Vogel, L.; Reuter, A.; Spiric, J.; Schiller, D.; Beyer, K.; et al. Pea (Pisum sativum) allergy in children: Pis s 1 is an immunodominant major pea allergen and presents IgE binding sites with potential diagnostic value. Clin. Exp. Allergy 2020, 50, 625–635. [Google Scholar] [CrossRef] [PubMed]
  21. Zuurveld, M.; Kiliaan, P.C.; van Grinsven, S.E.; Folkerts, G.; Garssen, J.; van‘t Land, B.; Willemsen, L.E. Ovalbumin induced epithelial activation directs moDC to instruct type 2 inflammation in T cells which is differentially modulated by 2′-fucosyllactose and 3-fucosyllactose. J. Innate Immun. 2022, 15, 222–239. [Google Scholar] [CrossRef] [PubMed]
  22. Pérez-Rodríguez, L.; Lozano-Ojalvo, D.; Menchén-Martínez, D.; Molina, E.; López-Fandiño, R.; Benedé, S. Egg yolk lipids induce sensitization to egg white proteins in a mouse model without adjuvant and exacerbate Th2 responses to egg white in cells from allergic patients. Food Res. Int. 2023, 172, 112669. [Google Scholar] [CrossRef] [PubMed]
  23. Tordesillas, L.; Goswami, R.; Benedé, S.; Grishina, G.; Dunkin, D.; Järvinen, K.M.; Maleki, S.J.; Sampson, H.A.; Berin, M.C. Skin exposure promotes a Th2-dependent sensitization to peanut allergens. J. Clin. Investig. 2014, 124, 4965–4975. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, Y.-H.; Angkasekwinai, P.; Lu, N.; Voo, K.S.; Arima, K.; Hanabuchi, S.; Hippe, A.; Corrigan, C.J.; Dong, C.; Homey, B.; et al. IL-25 augments type 2 immune responses by enhancing the expansion and functions of TSLP-DC-activated Th2 memory cells. J. Exp. Med. 2007, 204, 1837–1847. [Google Scholar] [CrossRef] [PubMed]
  25. Cox, A.L.; Eigenmann, P.A.; Sicherer, S.H. Clinical Relevance of Cross-Reactivity in Food Allergy. J. Allergy Clin. Immunol. Pract. 2021, 9, 82–99. [Google Scholar] [CrossRef] [PubMed]
  26. Fu, L.; Lin, W.; Wang, C.; Wang, Y. Establishment of a 3-Dimensional Intestinal Cell Model to Simulate the Intestinal Mucosal Immune System for Food Allergy Investigations. Front. Immunol. 2022, 13, 853443. [Google Scholar] [CrossRef]
  27. Yu, L.C.H. Intestinal Epithelial Barrier Dysfunction in Food Hypersensitivity. J. Allergy 2012, 2012, 596081. [Google Scholar] [CrossRef] [PubMed]
  28. Kubo, A.; Nagao, K.; Amagai, M. Epidermal barrier dysfunction and cutaneous sensitization in atopic diseases. J. Clin. Investig. 2012, 122, 440–447. [Google Scholar] [CrossRef] [PubMed]
  29. Akdis, C.A. Does the epithelial barrier hypothesis explain the increase in allergy, autoimmunity and other chronic conditions? Nat. Rev. Immunol. 2021, 21, 739–751. [Google Scholar] [CrossRef] [PubMed]
  30. Goleva, E.; Berdyshev, E.; Leung, D.Y.M. Epithelial barrier repair and prevention of allergy. J. Clin. Investig. 2019, 1, 1463–1474. [Google Scholar] [CrossRef] [PubMed]
  31. Hellings, P.W.; Steelant, B. Epithelial barriers in allergy and asthma. J. Allergy Clin. Immunol. 2020, 145, 1499. [Google Scholar] [CrossRef] [PubMed]
  32. Sander, G.R.; Cummins, A.G.; Powell, B.C. Rapid disruption of intestinal barrier function by gliadin involves altered expression of apical junctional proteins. FEBS Lett. 2005, 579, 4851–4855. [Google Scholar] [CrossRef] [PubMed]
  33. Price, D.B.; Ackland, M.L.; Burks, W.; Knight, M.I.; Suphioglu, C. Peanut allergens alter intestinal barrier permeability and tight junction localisation in Caco-2 cell cultures. Cell. Physiol. Biochem. 2014, 33, 1758–1777. [Google Scholar] [CrossRef] [PubMed]
  34. Grozdanovic, M.M.; Čavić, M.; Nešić, A.; Andjelković, U.; Akbari, P.; Smit, J.J.; Gavrović-Jankulović, M. Kiwifruit cysteine protease actinidin compromises the intestinal barrier by disrupting tight junctions. Biochim. Biophys. Acta 2016, 1860, 516–526. [Google Scholar] [CrossRef] [PubMed]
  35. Wang, C.; Lin, W.; Wang, Y.; Fu, L. Suppression of Hippo Pathway by Food Allergen Exacerbates Intestinal Epithelia Instability and Facilitates Hypersensitivity. Mol. Nutr. Food Res. 2021, 65, 2000593. [Google Scholar] [CrossRef] [PubMed]
  36. Koda, T.; Minami, H.; Ogawa, T.; Yamano, M.; Takeda, E. Higher concentrations of interferon-gamma enhances uptake and transport of dietary antigens by human intestinal cells: A study using cultured Caco-2 cells. J. Nutr. Sci. Vitaminol. 2003, 49, 179–186. [Google Scholar] [CrossRef] [PubMed]
  37. Khuda, S.E.; Nguyen, A.V.; Sharma, G.M.; Alam, M.S.; Balan, K.V.; Williams, K.M. Effects of Emulsifiers on an In vitro Model of Intestinal Epithelial Tight Junctions and the Transport of Food Allergens. Mol. Nutr. Food Res. 2022, 66, 2100576. [Google Scholar] [CrossRef] [PubMed]
  38. Kasakura, K.; Kawakami, Y.; Jacquet, A.; Kawakami, T. Histamine-Releasing Factor Is a Novel Alarmin Induced by House Dust Mite Allergen, Cytokines, and Cell Death. J. Immunol. 2022, 209, 1851–1859. [Google Scholar] [CrossRef] [PubMed]
  39. Gour, N.; Lajoie, S.; Smole, U.; White, M.; Hu, D.; Goddard, P.; Huntsman, S.; Eng, C.; Mak, A.; Oh, S.; et al. Dysregulated invertebrate tropomyosin-dectin-1 interaction confers susceptibility to allergic diseases. Sci. Immunol. 2018, 3, 9841. [Google Scholar] [CrossRef] [PubMed]
  40. Yong, H.M.; Gour, N.; Sharma, D.; Khalil, S.M.; Lane, A.P.; Lajoie, S. Epigenetic regulation of epithelial dectin-1 through an IL-33-STAT3 axis in allergic disease. Allergy 2022, 77, 207–217. [Google Scholar] [CrossRef] [PubMed]
  41. Fu, L.; Xie, M.; Wang, C.; Qian, Y.; Huang, J.; Sun, Z.; Zhang, H.; Wang, Y. Lactobacillus Casei Zhang Alleviates Shrimp Tropomyosin-Induced Food Allergy by Switching Antibody Isotypes through the NF-κB-Dependent Immune Tolerance. Mol. Nutr. Food Res. 2020, 64, 1900496. [Google Scholar] [CrossRef] [PubMed]
  42. Yang, D.; Han, Z.; Oppenheim, J.J. Alarmins and Immunity. Immunol. Rev. 2017, 280, 41–56. [Google Scholar] [CrossRef] [PubMed]
  43. Roan, F.; Obata-Ninomiya, K.; Ziegler, S.F. Epithelial cell–derived cytokines: More than just signaling the alarm. J. Clin. Investig. 2019, 129, 1441. [Google Scholar] [CrossRef] [PubMed]
  44. Chantret, I.; Barbat, A.; Dussaulx, E.; Brattain, M.G.; Zweibaum, A. Epithelial Polarity, Villin Expression, and Enterocytic Differentiation of Cultured Human Colon Carcinoma Cells: A Survey of Twenty Cell Lines. Cancer Res. 1988, 48, 1936–1942. [Google Scholar] [PubMed]
  45. Navabi, N.; McGuckin, M.A.; Lindén, S.K. Gastrointestinal Cell Lines Form Polarized Epithelia with an Adherent Mucus Layer when Cultured in Semi-Wet Interfaces with Mechanical Stimulation. PLoS ONE 2013, 8, e68761. [Google Scholar] [CrossRef] [PubMed]
  46. Han, H.; Roan, F.; Ziegler, S.F. The atopic march: Current insights into skin barrier dysfunction and epithelial cell-derived cytokines. Immunol. Rev. 2017, 278, 116–130. [Google Scholar] [CrossRef] [PubMed]
  47. Gilliet, M.; Soumelis, V.; Watanabe, N.; Hanabuchi, S.; Antonenko, S.; De Waal-Malefyt, R.; Liu, Y.J. Human dendritic cells activated by TSLP and CD40L induce proallergic cytotoxic T cells. J. Exp. Med. 2003, 197, 1059–1063. [Google Scholar] [CrossRef] [PubMed]
  48. Hoppenbrouwers, T.; Fogliano, V.; Garssen, J.; Pellegrini, N.; Willemsen, L.E.M.; Wichers, H.J. Specific Polyunsaturated Fatty Acids Can Modulate in vitro Human moDC2s and Subsequent Th2 Cytokine Release. Front. Immunol. 2020, 11, 529229. [Google Scholar] [CrossRef] [PubMed]
  49. Poulsen, L.K.; Hummelshoj, L. Triggers of IgE class switching and allergy development. Ann. Med. 2007, 39, 440–456. [Google Scholar] [CrossRef] [PubMed]
  50. Xu, L.; Zhang, M.; Ma, W.; Jin, S.; Song, W.; He, S. Cockroach Allergen Bla g 7 Promotes TIM4 Expression in Dendritic Cells Leading to Th2 Polarization. Mediat. Inflamm. 2013, 2013, 983149. [Google Scholar] [CrossRef] [PubMed]
  51. Newberry, R.D.; Hogan, S.P. Intestinal epithelial cells in tolerance and allergy to dietary antigens. J. Allergy Clin. Immunol. 2021, 147, 45–48. [Google Scholar] [CrossRef] [PubMed]
  52. Liu, W.; Xu, L.; Liang, X.; Liu, X.; Zhao, Y.; Ma, C.; Gao, L. Tim-4 in Health and Disease: Friend or Foe? Front. Immunol. 2020, 11, 509660. [Google Scholar] [CrossRef] [PubMed]
  53. Motoyama, K.; Suma, Y.; Ishizaki, S.; Nagashima, Y.; Shiomi, K. Molecular Cloning of Tropomyosins Identified as Allergens in Six Species of Crustaceans. 2007. Available online: https://pubs.acs.org/sharingguidelines (accessed on 3 July 2023).
  54. Remillard, J.F.; Gould, M.C.; Roslansky, P.F.; Novitsky, T.J. Quantitation of endotoxin in products using the LAL kinetic turbidimetric assay. Prog. Clin. Biol. Res. 1987, 231, 197–210. [Google Scholar] [PubMed]
Nutrients 16 01192 g001
Figure 1. Caco-2 cells were used as a model for studying allergen-specific effects on the intestinal epithelial barrier and (A) they were exposed for 48 h to increasing doses of (B) chicken TM, (C) shrimp TM or (D) OVA while the TEER was measured at 0 h, 2 h, 6 h, 24 h, and 48 h. (E) TEER-values after 6 h of exposure are presented as well as (F) secreted IL8 and (G) LDH-release after 48 h of protein exposure. (H) Cultured Caco-2/HT-29MTX cells were exposed to 50 μg/mL chicken TM, shrimp TM or OVA for 8 h and (I) TEER was measured at 0 h, 2 h, 4 h, and 8 h. (J) A coculture of Caco-2 cells with PBMCs was performed to assess the fold change in gene expression of (K) Il33, (L) Il25, and (M) Tslp 8 h after 50 μg/mL chicken TM, shrimp TM or OVA exposure. Data was analyzed by Friedman test, One-Way or Two-Way ANOVA, n = 3 or n = 5, mean ± SEM (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).
Figure 1. Caco-2 cells were used as a model for studying allergen-specific effects on the intestinal epithelial barrier and (A) they were exposed for 48 h to increasing doses of (B) chicken TM, (C) shrimp TM or (D) OVA while the TEER was measured at 0 h, 2 h, 6 h, 24 h, and 48 h. (E) TEER-values after 6 h of exposure are presented as well as (F) secreted IL8 and (G) LDH-release after 48 h of protein exposure. (H) Cultured Caco-2/HT-29MTX cells were exposed to 50 μg/mL chicken TM, shrimp TM or OVA for 8 h and (I) TEER was measured at 0 h, 2 h, 4 h, and 8 h. (J) A coculture of Caco-2 cells with PBMCs was performed to assess the fold change in gene expression of (K) Il33, (L) Il25, and (M) Tslp 8 h after 50 μg/mL chicken TM, shrimp TM or OVA exposure. Data was analyzed by Friedman test, One-Way or Two-Way ANOVA, n = 3 or n = 5, mean ± SEM (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).
Nutrients 16 01192 g001
Nutrients 16 01192 g002
Figure 2. (A) Caco-2 and HT29 cells were cultured in 96 well flatbottom culture plates prior to 48 h exposure to 50 μg/mL chicken TM, shrimp TM or OVA. Supernatants were collected to measure (B) IL33, (C) IL25, (D) TSLP, (E) IL1α, (F) IL1β, (G) CCL20, (H) CCL22, (I) IL8, (J) IL6 and (K) TNFα secretion by multiplex array. Data was analyzed per cell line by One-Way ANOVA or Friedman test if data did not fit a normal distribution, n = 3, mean ± SEM (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).
Figure 2. (A) Caco-2 and HT29 cells were cultured in 96 well flatbottom culture plates prior to 48 h exposure to 50 μg/mL chicken TM, shrimp TM or OVA. Supernatants were collected to measure (B) IL33, (C) IL25, (D) TSLP, (E) IL1α, (F) IL1β, (G) CCL20, (H) CCL22, (I) IL8, (J) IL6 and (K) TNFα secretion by multiplex array. Data was analyzed per cell line by One-Way ANOVA or Friedman test if data did not fit a normal distribution, n = 3, mean ± SEM (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).
Nutrients 16 01192 g002
Nutrients 16 01192 g003
Figure 3. (A) HT-29 cells cocultured with moDC or moDC alone were exposed to 50 μg/mL chicken TM or shrimp TM for 48 h, and the primed DC were subsequently cocultured with allogenic naïve T cells for 4 days. After HT-29 cell and/or moDC coculture, expression of the costimulatory molecules (B) CD80, (C) CD86 and (D) OX40L was measured by flow cytometry. In addition, supernatant concentrations of (E) CCL20, (F) CCL22, and (G) IL8 were measured. (H) The flow cytometry gating strategy is given with a representative sample and corresponding FMOs. Data is analyzed by One-Way ANOVA, n = 3, mean ± SEM (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).
Figure 3. (A) HT-29 cells cocultured with moDC or moDC alone were exposed to 50 μg/mL chicken TM or shrimp TM for 48 h, and the primed DC were subsequently cocultured with allogenic naïve T cells for 4 days. After HT-29 cell and/or moDC coculture, expression of the costimulatory molecules (B) CD80, (C) CD86 and (D) OX40L was measured by flow cytometry. In addition, supernatant concentrations of (E) CCL20, (F) CCL22, and (G) IL8 were measured. (H) The flow cytometry gating strategy is given with a representative sample and corresponding FMOs. Data is analyzed by One-Way ANOVA, n = 3, mean ± SEM (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).
Nutrients 16 01192 g003
Nutrients 16 01192 g004
Figure 4. (A) HT-29 cells cocultured with moDC or moDC alone were exposed to 50 μg/mL chicken TM or shrimp TM for 48 h, and the primed DC were subsequently cocultured with allogenic naïve T cells for 4 days. Cocultured DC and klT cells were collected to analyze T cell subsets and supernatants were collected to measure secreted cytokines. The percentage of (B) CRTH2 and (C) IL13 expressing T cells as well as the level of secreted (D) IL13 and (G) IL4 were measured as part of the type 2 response. The percentage of (E) CXCR3 expressing T cells and (F) IFNγ was measured as part of the type 1 response. Furthermore, secreted (H) IL17, (I) TNFα, and (J) IL21 were measured. (K) The flow cytometry gating strategy is given with a representative sample and corresponding FMOs. Data is analyzed by One-Way ANOVA, n = 3, mean ± SEM (* p < 0.05, ** p< 0.01, *** p < 0.001).
Figure 4. (A) HT-29 cells cocultured with moDC or moDC alone were exposed to 50 μg/mL chicken TM or shrimp TM for 48 h, and the primed DC were subsequently cocultured with allogenic naïve T cells for 4 days. Cocultured DC and klT cells were collected to analyze T cell subsets and supernatants were collected to measure secreted cytokines. The percentage of (B) CRTH2 and (C) IL13 expressing T cells as well as the level of secreted (D) IL13 and (G) IL4 were measured as part of the type 2 response. The percentage of (E) CXCR3 expressing T cells and (F) IFNγ was measured as part of the type 1 response. Furthermore, secreted (H) IL17, (I) TNFα, and (J) IL21 were measured. (K) The flow cytometry gating strategy is given with a representative sample and corresponding FMOs. Data is analyzed by One-Way ANOVA, n = 3, mean ± SEM (* p < 0.05, ** p< 0.01, *** p < 0.001).
Nutrients 16 01192 g004
Table 1. Primer pair sequences for gene transcription analysis in Caco-2 cells. fw, forward; rv, reverse.
Table 1. Primer pair sequences for gene transcription analysis in Caco-2 cells. fw, forward; rv, reverse.
GenePrimer PairsReferenceCycling Conditions
Gapdhfw 5′ GAAGGTGAAGGTCGGAGTCAA 3′
rv 5′ ACGTACTCAGCGCCAGCATC 3′		[22]Pre-incubation
2 min 50 °C
Incubation
10 min 95 °C
40 cycles
Il33fw 5′ GAGCTAAGGCCACTGAGGAA 3′
rv 5′ TGGGCCTTTGAAGTTCCATA 3′		[23]
Il25fw 5′ CCAGGTGGTTGCATTCTTGG 3′
rv 5′ TGGCTGTAGGTGTGGGTTCC 3′		[24]
Tslpfw 5′ CTCTGGAGCATCAGGGAGAC 3′
rv 5′ CAATTCCACCCCAGTTTCAC 3′		[22]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zuurveld, M.; Ogrodowczyk, A.M.; Benedé, S.; Czolk, R.; Lucia Bavaro, S.; Randow, S.; Markiewicz, L.H.; Wróblewska, B.; Molina, E.; Kuehn, A.; et al. Allergenic Shrimp Tropomyosin Distinguishes from a Non-Allergenic Chicken Homolog by Pronounced Intestinal Barrier Disruption and Downstream Th2 Responses in Epithelial and Dendritic Cell (Co)Culture. Nutrients 2024, 16, 1192. https://doi.org/10.3390/nu16081192

AMA Style

Zuurveld M, Ogrodowczyk AM, Benedé S, Czolk R, Lucia Bavaro S, Randow S, Markiewicz LH, Wróblewska B, Molina E, Kuehn A, et al. Allergenic Shrimp Tropomyosin Distinguishes from a Non-Allergenic Chicken Homolog by Pronounced Intestinal Barrier Disruption and Downstream Th2 Responses in Epithelial and Dendritic Cell (Co)Culture. Nutrients. 2024; 16(8):1192. https://doi.org/10.3390/nu16081192

Chicago/Turabian Style

Zuurveld, Marit, Anna M. Ogrodowczyk, Sara Benedé, Rebecca Czolk, Simona Lucia Bavaro, Stefanie Randow, Lidia H. Markiewicz, Barbara Wróblewska, Elena Molina, Annette Kuehn, and et al. 2024. "Allergenic Shrimp Tropomyosin Distinguishes from a Non-Allergenic Chicken Homolog by Pronounced Intestinal Barrier Disruption and Downstream Th2 Responses in Epithelial and Dendritic Cell (Co)Culture" Nutrients 16, no. 8: 1192. https://doi.org/10.3390/nu16081192

APA Style

Zuurveld, M., Ogrodowczyk, A. M., Benedé, S., Czolk, R., Lucia Bavaro, S., Randow, S., Markiewicz, L. H., Wróblewska, B., Molina, E., Kuehn, A., Holzhauser, T., & Willemsen, L. E. M. (2024). Allergenic Shrimp Tropomyosin Distinguishes from a Non-Allergenic Chicken Homolog by Pronounced Intestinal Barrier Disruption and Downstream Th2 Responses in Epithelial and Dendritic Cell (Co)Culture. Nutrients, 16(8), 1192. https://doi.org/10.3390/nu16081192

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop