Next Article in Journal
Degradation of Diclofenac by Bisulfite Coupled with Iron and Manganous Ions: Dual Mechanism, DFT-Assisted Pathway Studies, and Toxicity Assessment
Previous Article in Journal
Assessment of Different Frameworks for Addressing Climate Change Impact on Crop Production and Water Requirement
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Water
Volume 16
Issue 14
10.3390/w16141993
water-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characteristics of Novel Heterotrophic Nitrification–Aerobic Denitrification Bacteria Bacillus subtilis F4 and Alcaligenes faecalis P4 Isolated from Landfill Leachate Biochemical Treatment System

by
Xuejun Zhang
1,
Peng Xu
1,2,
Yajuan Lou
3,
Yuqi Liu
3,
Qiantong Shan
3,
Yi Xiong
3,
Hua Wei
4 and
Jianyang Song
1,2,3,*
1
Nanyang Key Laboratory of Water Pollution Control and Solid Waste Resource, Nanyang Institute of Technology, Nanyang 473004, China
2
School of Civil Engineering, Nanyang Institute of Technology, Nanyang 473004, China
3
Henan Key Laboratory of Industrial Microbial Resources and Fermentation Technology, Nanyang Institute of Technology, Nanyang 473004, China
4
School of Civil Engineering and Architecture, Wuhan University of Technology, Wuhan 430070, China
*
Author to whom correspondence should be addressed.
Water 2024, 16(14), 1993; https://doi.org/10.3390/w16141993
Submission received: 26 June 2024 / Revised: 10 July 2024 / Accepted: 11 July 2024 / Published: 14 July 2024
(This article belongs to the Section Wastewater Treatment and Reuse)
Browse Figures
Versions Notes

Abstract

:
Heterotrophic nitrification-aerobic denitrification (HN-AD) bacteria are the key functional microorganisms needed to achieve simultaneous nitrification and denitrification (SND). In this study, 25 strains of HN-AD bacteria were successfully isolated from a stable landfill leachate biochemical treatment system, of which 10 strains belonged to Firmicutes and 15 strains belonged to Proteobacteria. Bacillus subtilis F4 and Alcaligenes faecalis P4 displayed good tolerance at a wide range of ammonia nitrogen (NH4+-N) concentrations. When the C/N ratio was 20, the removal rates of ammonia nitrogen were 90.1% and 89.5%, and the chemical oxygen demand (COD) removal rates were 92.4% and 93.9%, respectively. The napA gene encoding periplasmic nitrate reductase (Nap) and the nirS gene encoding nitrite reductase (Nir) were detected, and nitrogen balance showed assimilation and HN-AD was the main nitrogen metabolism mode in both strains. The use of immobilization materials could increase removal rate of ammonia nitrogen by 21.1% and 29.6%, respectively. The research results of this work can provide theoretical basis and technical support for the practical application of HN-AD bacteria to enhance the treatment of high ammonia nitrogen wastewater with high efficiency and low consumption.

1. Introduction

During the accumulation and landfilling of garbage, a large amount of landfill leachate containing high concentrations of complex pollutants are produced [1]. High concentration of ammonia nitrogen (NH4+-N) is a typical characteristic of mature leachate and generally does not decrease with the extension of landfill years [1]. Currently, most landfills in China have entered the aging stage, and the concentration of NH4+-N can reach up to 2000 mg/L [2,3]. This presents a significant treatment challenge for aging landfills due to its high pollution concentration, strong biological toxicity to microorganisms, substantial treatment difficulty, and high treatment costs [4]. Traditional biological denitrification technology relies on the organic combination of nitrification and denitrification. However, due to the great differences in the ecological niches of the functional microorganisms of nitrification and denitrification, nitrification and denitrification usually need to be carried out in two independent reactors [5,6]. Simultaneous nitrification and denitrification (SND) has the advantages of saving infrastructure area, low treatment cost, effectively avoiding the accumulation of nitrate nitrogen, shortening reaction time, relatively stable pH of the system, and lowers energy consumption [7]. SND is recognized as a high efficiency and low consumption nitrogen removal method for mature landfill leachate.
Autotrophic nitrifying bacteria (ANB), as the main functional bacteria in the traditional ammonia oxidation process, grow slowly and are sensitive to the environment [8,9,10]. The denitrification microorganisms in the traditional process can only denitrify under anoxic condition [11]. This indicates the limitations of their application in nitrogen removal treatment. Compared with ANB and anoxic denitrifying bacteria, heterotrophic nitrification and aerobic denitrification (HN-AD) bacteria can simultaneously carry out nitrification and denitrification under aerobic conditions, thus achieving temporal and spatial integration of the nitrification and denitrification processes [8,12,13]. As more and more new strains with heterotrophic nitrification and aerobic denitrification (HN-AD) properties are discovered [14,15], the realization of SND became possible. HN-AD bacteria have the characteristics of rapid growth, easy domestication, strong adaptability, and high denitrification efficiency, which have stronger advantages and potential for the construction of simultaneous nitrification and denitrification systems in wastewater treatment [16]. In view of this, the research on HN-AD bacteria has attracted more and more attention in recent years.
In recent years, more and more HN-AD bacteria have been screened and isolated from different environments, such as Bacillus sp. YX-6 [17], Acinetobacter sp. HA2 [18], and Paracoccus versutus KS293 [19]. The Acinetobacter YS2 isolated by Lang et al. [20] from a petrochemical wastewater treatment process showed excellent denitrification performance. Under the nitrification and denitrification processes, the removal rates of NH4+-N and nitrate nitrogen (NO3−-N) after 24 h were 87.8% and 88.2%, respectively. Fu et al. [21] isolated a new type of aerobic denitrifying bacteria Zobellella denitrificans A63 and found the addition of A63 could increase the removal rates of nitrate nitrogen in saline wastewater. Liu et al. [22] isolated a strain of Vibrio, and the removal rates of NO3−-N reached up to 97.4%. However, some HN-AD bacteria only showed considerable nitrification ability, but weaker denitrification ability [23,24]. Meanwhile, the biochemical processes of HN-AD bacteria are still much debated, probably due to undetectable intermediates and limited enzyme activities. Therefore, more HN-AD bacteria of different genera and with greater environmental tolerance need to be obtained, and the functional genes of nitrogen metabolism pathways should be analyzed.
It must be noted that for practical application of isolated novel HN-AD bacteria, there exist a lot of high barriers, such as easy loss, low mechanical strength, low cell density, and difficulty in separating biomass effluents [25]. In order to ensure the stability of HN-AD bacteria in wastewater treatment systems, the application research of immobilization and biomass carriers has become inevitable. Microbial immobilization technology can not only prevent microorganisms from being washed away, but also effectively resist adverse environmental conditions. Sodium alginate (SA) is a natural polysaccharide with rich carboxyl and hydroxyl functional groups, which can react with multivalent metal ions to form gels with three-dimensional network structure. Polyvinyl alcohol (PVA) is used as a blending material for SA due to its excellent mechanical and chemical properties, as well as good biocompatibility. Mixing the two substances can produce immobilized microbial particles with good shape, stability, and mechanical properties. The previous research results of the research group showed that Artemisia argyi stem biochar (ABC) is a carbonaceous structure with rich pore structure and huge specific surface area, which is favorable for microbial attachment and growth as a carrier [26]. In this study, PVA and SA were selected as embedding carriers and ABC was used as adsorption carrier to immobilize HN-AD bacteria, thereby improving the biological enhancement effect of HN-AD bacteria.
In this study, HN-AD bacteria were isolated from a stable biological treatment system of landfill leachate and identified based on phenotypic and phylogenetic characteristics. The excellent performance strains were selected for factors affecting evaluation under various carbon to nitrogen (C/N) ratio, pH, and initial NH4+-N concentrations. Nitrogen balance and the nitrogen removal functional genes testing experiments were conducted to explore the nitrogen transformation pathway. Finally, the treatment effect of immobilized microorganisms was evaluated. The research results of this paper might provide alternate microbial resources and a method for treating high ammonia nitrogen-containing wastewater.

2. Materials and Methods

2.1. Medium

Enrichment medium and trace element solution were employed according to Jin et al. [27] during the HN-AD bacteria enrichment culture process. Bromothymol blue (BTB) agar plates were used as selective medium to screen aerobic denitrifiers and LB medium was used for bacterial activation [28]. The heterotrophic nitrification medium (HNM) was applied to measure nitrogen removal capacity and consisted of the following composition per liter: NH4Cl 0.382 g/L, sodium acetate 1.295 g/L, KCl 0.05 g/L, KH2PO4 0.130 g/L, MgSO4•7H2O 0.05 g/L, trace elements 2 mL/L, pH 7.2–7.4. All chemicals used in this study were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China).

2.2. Isolation and Identification

The activated sludge samples were collected from the biological treatment process sedimentation tank of a landfill site in Wuhan City, China. A 10 mL sample was mixed with 90 mL enrichment medium in a 250 mL flask and cultured at 28 °C and 150 rpm for 48 h. A 10 mL suspension was again transferred into 90 mL of fresh enrichment medium. This procedure was repeated three times. The enriched bacterial supernatant was gradient diluted to 10-4, 10−5, and 10−6 with ultrapure water, and then 100 μL of the diluent was spread on agar BTB plates and cultured at 30 °C for 48 h. Isolated colonies with blue circles were separated and kept in 30% glycerol solution at −80 °C.
The genomic DNA of the isolates was extracted using a DNA extraction kit (Sangon, Shanghai, China). The universal primers 27F and 1492R were used to amplify 16S rRNA genes. Subsequently, purified Polymerase chain reaction (PCR) amplification products were sequenced by Sangon Bioengineering Co., Ltd. (Shanghai, China). The sequence of 16S rRNA genes was compared with that of other bacteria in the Genbank using BLAST (https://www.ncbi.nlm.nih.gov/, accessed on 15 April 2024). A phylogenetic tree was constructed with MEGA7 using the neighbor-joining method.

2.3. Performance Evaluation of Isolated Strains

To determine the nitrogen and carbon removal performance and growth characteristic of the isolates, an overnight pre-culture of the isolates in LB media was washed by centrifugation at 8000 r/min for 10 min with sterilized PBS (phosphate buffered saline, PBS) buffer. A 10 mL cell suspension with an optical density measured at 600 nm (OD600) of 1.0 was inoculated into 90 mL HNM media in the shake and aseptically incubated at 30 °C and 150 rpm for 96 h. The OD600 and the concentrations of NH4+-N, NO3−-N, nitrite nitrogen (NO2−-N), and chemical oxygen demand (COD) were measured at the end of cultivation. The strains with better nitrogen and carbon removal effects were selected for further research.

2.4. Factors Affecting N and C Removal Capacity

To investigate the effects of different culture conditions on simultaneous heterotrophic nitrification and aerobic denitrification performance of the isolates, single-factor experiments were conducted, including C/N ratio, pH, and initial NH4+-N concentration. The concentration of NH4Cl and sodium acetate and the pH value were altered based on HNM with 10% (v/v) inoculation size. In the C/N ratio experiments, the C/N ratio was set to 4, 7, 10, 15, and 20. To explore the tolerance of the isolates to high ammonium concentrations, the initial NH4+-N concentration was set to 20, 50, 100, 150, and 200 mg/L and C/N ratio was set at 20. The initial pH was adjusted to 5.0, 6.0, 7.0, 8.0, and 9.0 to examine the effect of pH. In addition to the above mentioned, other conditions remained unchanged throughout the experiment. Shake flask experiments were incubated for 120 h and samples were collected periodically every 12 h to determine the concentration of NH4+-N, NO3−-N, NO2−-N, and COD.

2.5. Nitrogen Balance

To explore the nitrogen transformation pathway of the strains with better nitrogen and carbon removal effects, the production of nitrogen gas was monitored by gas chromatography (GC) (6890N, Agilent, Santa Clara, CA, USA) with an electron capture detector. To begin, 4 mL pre-cultured cell suspension (OD600 = 1.0) was inoculated into 40 mL HNM media in the serum bottle with the capacity of 100 mL. Before cultivation, the serum bottles were hermetically sealed and aerated with oxygen (99.5% purity). The serum bottles were incubated at 30 °C with shaking at 150 rpm for 96 h. The negative control was conducted using HNM medium without inoculums. Gas samples were collected from the headspace of the sealed serum bottles using a gas-tight syringe for the detection of N2, N2O, and O2. Simultaneously, the concentrations of NH4+-N, NO3−-N, and NO2−-N and intracellular nitrogen in culture medium was measured. Analyses were performed in triplicate.

2.6. Nitrogen Removal Functional Genes Analysis

To understand the nitrogen metabolic pathway, PCR was used to detect the key functional genes hao, napG, napA, nirS, nirK, norB, and nosZ encoding aerobic denitrification enzymes such as hydroxylamine oxidoreductase (HAO), periplasmic nitrate reductase (Nap), nitrite reductase (Nir), nitric oxide reductase (Nor), and nitrous oxide reductase (Nos) [29]. The primer sequences, annealing temperature, and target fragment size were shown in Table 1. PCR amplification products were sequenced by Sangon Bioengineering Co., Ltd. (Shanghai, China) and sequencing results were compared in the Genbank.

2.7. Performance Evaluation of Immobilized Strains

In order to explore solutions to the problem of bacterial loss and instability in actual wastewater treatment processes, the strains selected for in-depth study were immobilized according to the previous research methods [32,33]. Immobilized bacteria technology was employed with PVA and SA as embedding carrier and ABC as absorption. The PVA used in this study was polyvinyl alcohol 1750 ± 50 produced by Sinopharm Chemical Reagent Co., Ltd.. The SA used in this study was also produced by Sinopharm Chemical Reagent Co., Ltd.. To begin, 2 g ABC and 10 mL bacteria suspension (BS, OD600 = 1.0) were added to 100 mL mixed solution of SA (2 g/100 mL) and PVA (1 g/100 mL). After complete mixing, the mixture was extracted with a syringe and added drop by drop to 300 mL CaCl2 solution (5%, w/v) with continuous stirring to cross-link to form gel beads, which were named PVA/SA/ABC@BS gel beads. A comparative experiment was conducted on the nitrogen and carbon removal ability of immobilized and non-immobilized strains. The culture medium and operating conditions were described in Section 2.3.

2.8. Analytical Methods

The growth of the isolates was detected at 600 nm using a spectrophotometer (UV-2600, Shimadzu, Japan). After the supernatant of the reaction system was filtered by the 0.45 μm microporous membrane, the concentrations of NH4+-N, NO2−-N, NO3−-N, and COD in the filtrate were measured with standard methods [34]. The concentration of biomass nitrogen was the differential of the TN between non-centrifuged bacteria culture and the centrifuged samples [35].

3. Results and Discussion

3.1. Isolation and Identification of HN-AD Bacteria

Twenty-five strains with different morphological characteristics were isolated and purified from the selective agar medium. Approximately 1300-bp fragments of 16S rRNA gene obtained by PCR were sequenced, and then homology comparison of the sequences was performed in GenBank using BLAST. The identification results are shown in Table 2. Twenty-five strains were ultimately identified as seven different genera and eleven different species. The 16S rDNA sequence of isolated and most similar strains with over 99% homology were selected to construct a phylogenetic tree using the neighbor-joining method (Figure 1). According to the phylogenetic tree, strains F1, F2 (F5, F6), F3, and F4 (F7, F8, F9, F10) were identified as Firmicutes, which were Bacillus subtilis, Bacillus paramycoides, Bacillus cereus, and Bacillus thuringiensis, respectively. Strains P1 (P8, P9), P2 (P10, P11), P3 (P12, P13), P4, P5 (P14, P15), P6, and P7 belonged to Proteobacteria, which were Acinetobacter junii, Providencia rettgeri, Pseudochrobactrum asaccharolyticum, Alcaligenes faecalis, Providencia vermicola, Proteus terrae, and Proteus vulgaris, respectively. Bacillus and Acinetobacter were important members of HN-AD bacteria. Providencia rettgeri [36,37] and Alcaligenes faecalis [38,39] had also been reported to have heterotrophic nitrification and aerobic denitrification capabilities, which can efficiently remove nitrogen and organic matter from wastewater. Pseudochrobactrum and Proteus were rarely reported HN-AD bacteria, which enriched the resources of heterotrophic nitrification and aerobic denitrification bacteria.

3.2. Nitrogen and Carbon Removal Performance of Isolated Bacteria

Nitrogen and carbon removal performance of isolated bacteria were studied using NH4Cl as the sole nitrogen source (Figure 2). Among the 25 isolated strains, the nitrogen removal capacity of 8 strains was very poor, with total nitrogen removal rate of less than 20%. Instead, strains F4, P4, P7, and P3 had good nitrogen and carbon removal performance, with TN removal rate greater than 50% and COD removal rate greater than 85%. In addition, these four strains did not accumulate nitrate and nitrite nitrogen during the entire transformation and removal process of ammonia nitrogen. Considering the growth characteristic and nitrogen and carbon removal ability, Bacillus subtilis F4 and Alcaligenes faecalis P4 were selected for further analysis.

3.3. Factors Affecting Evaluation Experiment

The strains isolated from different environments showed different tolerances to pH, C/N ratio, and ammonia nitrogen concentration. pH can affect the enzyme activity in the strains, C/N ratio determines whether the carbon source for growth and denitrification of HN-AD bacteria is sufficient, and the ammonia nitrogen concentration directly determines whether the strains can grow and reproduce in this environment [8]. Therefore, this work studied the effects of different pH values, C/N ratio, and ammonia nitrogen concentration on the denitrification and carbon removal ability of the screened strains through single factor influence test so as to determine the optimal decontamination conditions.

3.3.1. Effect of pH

The impact of pH on strains Bacillus subtilis F4 and Alcaligenes faecalis P4 nitrogen and carbon removal capacity was illustrated in Figure 3. The appropriate pH range for both strains was 6–9. The optimal pH of strain Bacillus subtilis F4 was 7, and the maximum removal rate of ammonia nitrogen and COD was 56.4% and 91.11%, respectively. Strain Alcaligenes faecalis P4 grew rapidly at an optimal pH of 8 and had maximum removal rate of ammonia nitrogen and COD after 12 h of cultivation, which were 58.66% and 94.56%, respectively. In acidic environments, the adaptation period of both strains was further prolonged (pH = 6) or failed to grow (pH = 5). During the experiment, the removal rate of TN was consistent with that of ammonia nitrogen, and there was no accumulation of nitrate and nitrite. Numerous studies have found that the optimal pH for HN-AD bacteria varies greatly. In general, the optimal pH range is 6–9, and neutral or weak alkaline environments are more conducive to grow and achieving better denitrification effect for most of HN-AD bacteria [9,39,40]. The results of this study indicated that Bacillus subtilis F4 and Alcaligenes faecalis P4 were alkaline HN-AD bacteria, consistent with Rhodococcus sp. S2 and Marinobacter sp. NNA5 [41].

3.3.2. Effect of C/N Ratio

HN-AD bacteria have a wide range of C/N adaptations, with the optimal C/N ratio ranging from 2 to 15 [42,43]. It is generally reported that most HN-AD bacteria require a higher C/N ratio to achieve high nitrogen removal efficiency, and a low C/N ratio results in poor heterotrophic nitrification and aerobic denitrification performance [2,44]. Therefore, NH4+-N and COD removal efficiency of strains Bacillus subtilis F4 and Alcaligenes faecalis P4 was investigated under different C/N ratios in shaking cultures by changing the concentration of sodium acetate (Figure 4). The results showed increasing organic carbon concentration significantly improved the removal efficiency of ammonia nitrogen. When the C/N ratio was 20, the ammonia nitrogen removal was 90.1% and 89.5% for strains Bacillus subtilis F4 and Alcaligenes faecalis P4, respectively, which were enhanced by 37.8% and 30.4% compared to the C/N ratio of 10. However, the influence of C/N ratio on COD removal efficiency was small, and both strains were able to maintain more than 90% COD removal. Therefore, the optimal C/N ratio for strains Bacillus subtilis F4 and Alcaligenes faecalis P4 was 20. According to reports, the optimum C/N ratio of Bacillus subtilis A1 [45] and Alcaligenes sp. [13] were 6 and 10, respectively, which were significantly lower than the results of this study. Our findings align with the high ammonia nitrogen removal capacity exhibited by Rhodococcus sp. S2 with a C/N ratio of 16 [2].

3.3.3. Effect of Initial NH4+-N Concentration

The nitrogen and carbon removal capacity of strains Bacillus subtilis F4 and Alcaligenes faecalis P4 were assessed at initial NH4+-N concentrations ranging from 20–200 mg/L, as shown in Figure 5. Two strains demonstrated good tolerance under a wide range of ammonia nitrogen concentration pressures, with removal rate of ammonia nitrogen and COD exceeding 90% and 93%, respectively. Especially for strain Alcaligenes faecalis P4, under different initial concentrations of ammonia nitrogen, the optimal removal capacity and growth state were quickly achieved at 6 h, 12 h, 24 h, 30 h, and 48 h, respectively. In traditional high ammonia nitrogen biological wastewater treatment systems, nitrite accumulation often occurs due to the inhibition of the activity of nitrite oxidizing bacteria. In this study, nitrite was not detected, indicating that the nitrification of the screened strains was not affected under high ammonia-nitrogen environment.

3.4. Nitrogen Balance

To investigate the nitrogen transformation pathway of strains Bacillus subtilis F4 and Alcaligenes faecalis P4, NH4+-N was used as the only nitrogen source and was analyzed for nitrogen balance. The experimental results were shown in Table 3. The ammonia nitrogen removal rate of strain Bacillus subtilis F4 was 54.9%, of which 52.7% of ammonia nitrogen was assimilated into biomass-N and 47.3% of nitrogen disappeared, while no accumulation of nitrate and nitrite was found. Similar results were also found in strain Alcaligenes faecalis P4, where 54.8% of the ammonia removed was converted to endogenous nitrogen and 45.2% of nitrogen disappeared. By detecting the headspace gas composition of the sealed system before and after the reaction, an increase in N2 was found and no N2O was detected, indicating that the disappearing nitrogen was escaping as N2, which suggested that the strains were engaged in heterotrophic nitrification and aerobic denitrification process. Compared to autotrophic nitrifying bacteria, nitrogen assimilation plays an important role in the HN-AD reaction during the nitrogen removal process with HN–AD bacteria [46,47]. Some studies have found that the proportion of endogenous nitrogen utilized in the assimilation process accounts for about 40% of the total nitrogen removal, and even higher proportions have been found. For example, Chen et al. found that the NH4+-N assimilation of Acinetobacter sp. strain C-13 accounted for 86.1% of the total nitrogen removal [48]. In this study, the results of nitrogen balance and N2 production confirmed the occurrence of denitrification, indicating that the ultimate fate of ammonium was N2 and assimilation. Similar results have also been reported by Zhao et al. [49] and Huang et al. [50].

3.5. Nitrogen Removal Functional Gene Amplification

There is a complex metabolic pathway in HN-AD bacteria. So far, it is still difficult to summarize the biochemical mechanisms due to the limitation of the number of species tested. Therefore, further studies on a wider range of species are necessary [8]. The enzymes related to nitrification and denitrification play important roles in the process of nitrogen removal, and their detection is often used to speculate the metabolic pathways of HN-AD bacteria. In this research, the crucial genes encoding pivotal enzymes related to the nitrogen metabolism were amplified by PCR to determine the main denitrification pathway. The results showed napA and nirS genes were successfully amplified in both strains by bacterial liquid-phase PCR and gel electrophoresis, while hao, nirK, narG, norB, and nosZ were not detected (Figure S1). The purified products after gel cutting were sequenced. The BLAST results indicated 99% homology with napA and nirK genes. Periplasmic nitrate reductase (Nap) is a key enzyme in aerobic denitrification, catalyzing the conversion of nitrate to nitrite [51]. Nitrate reductase (Nir) is a class of oxidoreductases that can catalyze the reduction of nitrite under aerobic environments [30]. The PCR test results suggested that the nitrate-nitrite reduction nitrogen removal pathway of Bacillus subtilis F4 and Alcaligenes faecalis P4 were similar to that of heterotrophic denitrification, which may be NO3−-N→NO2−-N→N2. The results of this study are consistent with the speculations of Zhao et al. [52] and Zhang et al. [53].

3.6. N and C Removal Capacity of Immobilized Strains

Strains Bacillus subtilis F4 and Alcaligenes faecalis P4 were immobilized by being prepared as PVA/SA/ABC@BS gel beads (Figure S2), which were incubated in shake flasks for 96 h with ammonia nitrogen as the sole carbon source. During the cultivation process, the gel beads did not break with high mechanical strength. For immobilized bacteria Bacillus subtilis F4 and Alcaligenes faecalis P4, the removal rates of ammonia nitrogen were 80.1% and 89.6%, and the COD removal rates were 90.6% and 91.3%. Compared with the performance of unimmobilized bacteria, the use of immobilization materials enhanced removal rate of ammonia nitrogen of strains Bacillus subtilis F4 and Alcaligenes faecalis P4 by 21.1% and 29.6%, respectively (Figure 6). It was supposed that the removal of NH4+-N not only depended on the metabolic transformation of microorganisms, but also adsorption. Zheng et al. [54] also discovered that ammonia nitrogen removal was enhanced from simulated wastewater by immobilizing microorganisms with reed biochar compounded with SA and PVA carriers. Several studies had shown that biochar had good adsorption efficiency for ammonia nitrogen and the potential to enhance the abundance of denitrifying microorganisms, which can improve the NH4+-N removal rate. In this study, with the removal of more ammonia nitrogen, there was no significant effect on the removal of COD, which may be due to the fact that biochar, as immobilization substrate, could provide a partial carbon source to the bacteria. This result was supported by the findings of Yang et al. [55], who detected a variety of lignocellulase encoding genes in sawdust immobilization system, which guaranteed the stable carbon supply. Meanwhile, this study also found that the fast removal time of COD and ammonia nitrogen in the immobilized system were longer than that in the non-immobilized system, which was speculated to be the reason for the mass transfer limitation.

4. Conclusions

In this work, 25 strains with heterotrophic nitrification and aerobic denitrification ability were successfully isolated from a stable biochemical treatment system for landfill leachate. Phylogenetic characteristics showed 10 strains belonged to Firmicutes and 15 strains belonged to Proteobacteria. Bacillus subtilis F4 and Alcaligenes faecalis P4 were selected for in-depth research, which exhibited high nitrogen removal performance under aerobic conditions without the accumulation of nitrate and nitrite. Factors affecting results showed that their optimal pH were 7 and 8, respectively. When the C/N ratio was 20, the removal rates of ammonia nitrogen were 90.1% and 89.5%, and the COD removal rates were 92.4% and 93.9%, respectively. Simultaneously, two strains showed extensive tolerance to initial ammonia nitrogen. The napA gene encoding periplasmic nitrate reductase and the nirS gene encoding nitrite reductase were detected, and assimilatory and heterotrophic nitrification-aerobic denitrification coexisted in the metabolic pathway for nitrogen in both strains. Finally, the use of immobilization materials (sodium alginate, polyvinyl alcohol and Artemisia argyi stem biochar) enhanced removal rate of ammonia nitrogen of strains Bacillus subtilis F4 and Alcaligenes faecalis P4 by 21.1% and 29.6%, respectively. These results indicate HN-AD bacteria of different genera with greater environmental tolerance had been obtained, and immobilization strategies can be considered in the practical application. The next research focuses on the treatment of real raw landfill leachate wastewater using immobilized HN-AD bacteria in a pilot-scale reactor.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/w16141993/s1, Figure S1: The electrophoresis figure of napA and nirS genes by PCR amplification; Figure S2: Prepared PVA/SA/ABC@BS gel beads.

Author Contributions

X.Z., Conceptualization, Data curation, Investigation, Writing—original draft; P.X., Investigation, Methodology, Writing—review and editing; Y.L. (Yajuan Lou), Validation, Writing—review and editing; Y.L. (Yuqi Liu), Validation, Writing—review and editing; Q.S., Validation, Writing—review and editing; Y.X., Validation, Writing—review and editing; H.W., Validation, Writing—review and editing; J.S., Conceptualization, Data curation, Investigation, Supervision, Funding acquisition, Writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the Scientific and Technological Projects of Henan Province (242102320110), the Doctoral Research Start-up Fund Project of Nanyang Institute of Technology (510161) and the Interdisciplinary Sciences Project, Nanyang Institute of Technology.

Data Availability Statement

The data presented in this study is available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Miao, L.; Yang, G.; Tao, T.; Peng, Y. Recent advances in nitrogen removal from landfill leachate using biological treatments—A review. J. Environ. Manag. 2019, 235, 178–185. [Google Scholar] [CrossRef]
  2. Chen, X.; Li, S.; Zhang, W.; Li, S.; Gu, Y.; Ouyang, L. A Newly Isolated Rhodococcus sp. S2 from Landfill Leachate Capable of Heterotrophic Nitrification and Aerobic Denitrification. Water 2024, 16, 431. [Google Scholar] [CrossRef]
  3. Li, H.; Zhou, S.; Ma, W.; Huang, P.; Huang, G.; Qin, Y.; Xu, B.; Ouyang, H. Long-term performance and microbial ecology of a two-stage PN-ANAMMOX process treating mature landfill leachate. Bioresour. Technol. 2014, 159, 404–411. [Google Scholar] [CrossRef] [PubMed]
  4. Wydro, U.; Wołejko, E.; Sokołowska, G.; Leszczyński, J.; Jabłońska-Trypuć, A. Investigating Landfill Leachate Influence on Soil Microbial Biodiversity and Its Cytotoxicity. Water 2022, 14, 3634. [Google Scholar] [CrossRef]
  5. Silva, L.C.F.; Lima, H.S.; Sartoratto, A.; Sousa, M.P.D.; Torres, A.P.R.; Souza, R.S.D.; de Paula, S.O.; Oliveira, V.M.D.; Silva, C.C.D. Effect of salinity in heterotrophic nitrification/aerobic denitrification performed by acclimated microbiota from oil-produced water biological treatment system. Int. Biodeterior. Biodegrad. 2018, 130, 1–7. [Google Scholar] [CrossRef]
  6. Shoda, M.; Ishikawa, Y. Heterotrophic nitrification and aerobic denitrification of high-strength ammonium in anaerobically digested sludge by Alcaligenes faecalis strain No. 4. J. Biosci. Bioeng. 2014, 117, 737–741. [Google Scholar] [CrossRef] [PubMed]
  7. Li, J.; Wu, B.; Li, Q.; Zou, Y.; Cheng, Z.; Sun, X.; Xi, B. Ex situ simultaneous nitrification-denitrification and in situ denitrification process for the treatment of landfill leachates. Waste Manag. 2019, 88, 301–308. [Google Scholar] [CrossRef] [PubMed]
  8. Song, T.; Zhang, X.; Li, J.; Wu, X.; Feng, H.; Dong, W. A review of research progress of heterotrophic nitrification and aerobic denitrification microorganisms (HNADMs). Sci. Total Environ. 2021, 801, 149319. [Google Scholar] [CrossRef]
  9. Huang, F.; Pan, L.; Lv, N.; Tang, X. Characterization of novel Bacillus strain N31 from mariculture water capable of halophilic heterotrophic nitrification-aerobic denitrification. J. Biosci. Bioeng. 2017, 124, 564–571. [Google Scholar] [CrossRef]
  10. Sun, Z.; Lv, Y.; Liu, Y.; Ren, R. Removal of nitrogen by heterotrophic nitrification-aerobic denitrification of a novel metal resistant bacterium Cupriavidus sp. S1. Bioresour. Technol. 2016, 220, 142–150. [Google Scholar] [CrossRef]
  11. Luo, G.; Xu, G.; Tan, H.; Gao, J.; Liu, W. Effect of dissolved oxygen on denitrification using polycaprolactone as both the organic carbon source and the biofilm carrier. Int. Biodeterior. Biodegrad. 2016, 110, 155–162. [Google Scholar] [CrossRef]
  12. He, X.; Sun, Q.; Xu, T.; Dai, M.; Wei, D. Removal of nitrogen by heterotrophic nitrification-aerobic denitrification of a novel halotolerant bacterium Pseudomonas mendocina TJPU04. Bioprocess Biosyst. Eng. 2019, 42, 853–866. [Google Scholar] [CrossRef]
  13. Chen, J.; Gu, S.; Hao, H.; Chen, J. Characteristics and metabolic pathway of Alcaligenes sp. TB for simultaneous heterotrophic nitrification-aerobic denitrification. Appl. Microbiol. Biotechnol. 2016, 100, 9787–9794. [Google Scholar] [CrossRef]
  14. Yang, J.; Feng, L.; Pi, S.; Cui, D.; Ma, F.; Zhao, H.P.; Li, A. A critical review of aerobic denitrification: Insights into the intracellular electron transfer. Sci. Total Environ. 2020, 731, 139080. [Google Scholar] [CrossRef]
  15. Robertson, L.A.; Kuenen, J.G. Thiosphaera pantotropha gen. nov. sp. nov., a Facultatively Anaerobic, Facultatively Autotrophic Sulphur Bacterium. J. Gen. Microbiol. 1983, 129, 2847–2855. [Google Scholar] [CrossRef]
  16. Feng, L.; Yang, J.; Ma, F.; Pi, S.; Xing, L.; Li, A. Characterisation of Pseudomonas stutzeri T13 for aerobic denitrification: Stoichiometry and reaction kinetics. Sci. Total Environ. 2020, 717, 135181. [Google Scholar] [CrossRef]
  17. Song, Z.F.; An, J.; Fu, G.H.; Yang, X.L. Isolation and characterization of an aerobic denitrifying Bacillus sp. YX-6 from shrimp culture ponds. Aquaculture 2011, 319, 188–193. [Google Scholar] [CrossRef]
  18. Yao, S.; Ni, J.; Ma, T.; Li, C. Heterotrophic nitrification and aerobic denitrification at low temperature by a newly isolated bacterium, Acinetobacter sp. HA2. Bioresour. Technol. 2013, 139, 80–86. [Google Scholar] [CrossRef]
  19. Zhang, H.; Zhao, Z.; Chen, S.; Kang, P.; Wang, Y.; Feng, J.; Jia, J.; Yan, M.; Wang, Y.; Xu, L. Paracoccus versutus KS293 adaptation to aerobic and anaerobic denitrification: Insights from nitrogen removal, functional gene abundance, and proteomic profiling analysis. Bioresour. Technol. 2018, 260, 321–328. [Google Scholar] [CrossRef]
  20. Lang, X.; Li, Q.; Ji, M.; Yan, G.; Guo, S. Isolation and niche characteristics in simultaneous nitrification and denitrification application of an aerobic denitrifier, Acinetobacter sp. YS2. Bioresour. Technol. 2020, 302, 122799. [Google Scholar] [CrossRef]
  21. Fu, G.; Zhao, L.; Huangshen, L.; Wu, J. Isolation and identification of a salt-tolerant aerobic denitrifying bacterial strain and its application to saline wastewater treatment in constructed wetlands. Bioresour. Technol. 2019, 290, 121725. [Google Scholar] [CrossRef]
  22. Liu, C.; Zhu, L.; Chen, L. Effect of salt and metal accumulation on performance of membrane distillation system and microbial community succession in membrane biofilms. Water Res. 2020, 177, 115805. [Google Scholar] [CrossRef]
  23. Ye, X.; Peng, T.; Feng, J.; Yang, Q.; Pratush, A.; Xiong, G.; Huang, T.; Hu, Z. A novel dehydrogenase 17beta-HSDx from Rhodococcus sp. P14 with potential application in bioremediation of steroids contaminated environment. J. Hazard. Mater. 2019, 362, 170–177. [Google Scholar] [CrossRef]
  24. Yao, N.; Du, Y.; Xiong, J.; Xiao, Y.; He, H.; Xie, Z.; Huang, D.; Song, Q.; Chen, J.; Yan, D.; et al. Microbial detoxification of 3,5-xylenol via a novel process with sequential methyl oxidation by Rhodococcus sp. CHJ602. Environ. Res. 2023, 220, 115258. [Google Scholar] [CrossRef]
  25. Mulla, S.I.; Talwar, M.P.; Bagewadi, Z.K.; Hoskeri, R.S.; Ninnekar, H.Z. Enhanced degradation of 2-nitrotoluene by immobilized cells of Micrococcus sp. strain SMN-1. Chemosphere 2013, 90, 1920–1924. [Google Scholar] [CrossRef]
  26. Song, J.; He, Q.; Hu, X.; Zhang, W.; Wang, C.; Chen, R.; Wang, H.; Mosa, A. Highly efficient removal of Cr(VI) and Cu(II) by biochar derived from Artemisia argyi stem. Environ. Sci. Pollut. Res. 2019, 26, 13221–13234. [Google Scholar] [CrossRef]
  27. Jin, R.; Liu, T.; Liu, G.; Zhou, J.; Huang, J.; Wang, A. Simultaneous heterotrophic nitrification and aerobic denitrification by the marine origin bacterium Pseudomonas sp. ADN-42. Appl. Biochem. Biotechnol. 2015, 175, 2000–2011. [Google Scholar] [CrossRef]
  28. Wei, R.; Hui, C.; Zhang, Y.; Jiang, H.; Zhao, Y.; Du, L. Nitrogen removal characteristics and predicted conversion pathways of a heterotrophic nitrification-aerobic denitrification bacterium, Pseudomonas aeruginosa P-1. Environ. Sci. Pollut. Res. 2021, 28, 7503–7514. [Google Scholar] [CrossRef]
  29. Silva, L.; Lima, H.S.; Mendes, T.; Sartoratto, A.; Sousa, M.P.; de Souza, R.S.; de Paula, S.O.; de Oliveira, V.M.; Silva, C.C. Physicochemical characterization of Pseudomonas stutzeri UFV5 and analysis of its transcriptome under heterotrophic nitrification/aerobic denitrification pathway induction condition. Sci. Rep. 2020, 10, 2215. [Google Scholar] [CrossRef]
  30. Zhang, M.; Pan, L.; Su, C.; Liu, L.; Dou, L. Simultaneous aerobic removal of phosphorus and nitrogen by a novel salt-tolerant phosphate-accumulating organism and the application potential in treatment of domestic sewage and aquaculture sewage. Sci. Total Environ. 2021, 758, 143580. [Google Scholar] [CrossRef]
  31. Chen, R.; Deng, M.; He, X.; Hou, J. Enhancing Nitrate Removal from Freshwater Pond by Regulating Carbon/Nitrogen Ratio. Front. Microbiol. 2017, 8, 1712. [Google Scholar] [CrossRef]
  32. Zhang, H.; Shi, Y.; Ma, B.; Huang, T.; Zhang, H.; Niu, L.; Liu, X.; Liu, H. Mix-cultured aerobic denitrifying bacteria augmented carbon and nitrogen removal for micro-polluted water: Metabolic activity, coexistence and interactions, and immobilized bacteria for reservoir raw water treatment. Sci. Total Environ. 2022, 838, 156475. [Google Scholar] [CrossRef]
  33. Song, J.; Li, M.; Wang, C.; Fan, Y.; Li, Y.; Wang, Y.; Zhang, W.; Li, H.; Wang, H. Enhanced treatment of landfill leachate by biochar-based aerobic denitrifying bacteria functional microbial materials: Preparation and performance. Front. Microbiol. 2023, 14, 1139650. [Google Scholar] [CrossRef]
  34. APHA. Standard Methods for the Examination of Water and Wastewater; American Public Health Association (APHA): Washington, DC, USA, 2005. [Google Scholar]
  35. Yang, Q.; Yang, T.; Shi, Y.; Xin, Y.; Zhang, L.; Gu, Z.; Li, Y.; Ding, Z.; Shi, G. The nitrogen removal characterization of a cold-adapted bacterium: Bacillus simplex H-b. Bioresour. Technol. 2021, 323, 124554. [Google Scholar] [CrossRef]
  36. Taylor, S.M.; He, Y.; Zhao, B.; Huang, J. Heterotrophic ammonium removal characteristics of an aerobic heterotrophic nitrifying-denitrifying bacterium, Providencia rettgeri YL. J. Environ. Sci. 2009, 21, 1336–1341. [Google Scholar] [CrossRef]
  37. Ye, J.; Zhao, B.; An, Q.; Huang, Y.S. Nitrogen removal by Providencia rettgeri strain YL with heterotrophic nitrification and aerobic denitrification. Environ. Technol. 2016, 37, 2206–2213. [Google Scholar] [CrossRef]
  38. Chen, S.; He, S.; Wu, C.; Du, D. Characteristics of heterotrophic nitrification and aerobic denitrification bacterium Acinetobacter sp. T1 and its application for pig farm wastewater treatment. J. Biosci. Bioeng. 2019, 127, 201–205. [Google Scholar] [CrossRef]
  39. Yang, J.; Wang, Y.; Chen, H.; Lyu, Y. Ammonium removal characteristics of an acid-resistant bacterium Acinetobacter sp. JR1 from pharmaceutical wastewater capable of heterotrophic nitrification-aerobic denitrification. Bioresour. Technol. 2019, 274, 56–64. [Google Scholar] [CrossRef]
  40. Zeng, X.; Huang, J.J.; Hua, B.; Champagne, P. Nitrogen removal bacterial strains, MSNA-1 and MSD4, with wide ranges of salinity and pH resistances. Bioresour. Technol. 2020, 310, 123309. [Google Scholar] [CrossRef]
  41. Liu, Y.; Ai, G.; Miao, L.; Liu, Z. Marinobacter strain NNA5, a newly isolated and highly efficient aerobic denitrifier with zero N2O emission. Bioresour. Technol. 2016, 206, 9–15. [Google Scholar] [CrossRef]
  42. Carneiro, F.S.L.; Santiago, L.H.; Antonio, D.O.M.T.; Sartoratto, A.; de Paula, S.M.; Suhett, D.S.R.; Oliveira, D.P.S.; Maia, D.O.V.; Canedo, D.S.C. Heterotrophic nitrifying/aerobic denitrifying bacteria: Ammonium removal under different physical-chemical conditions and molecular characterization. J. Environ. Manag. 2019, 248, 109294. [Google Scholar] [CrossRef] [PubMed]
  43. Ren, Y.X.; Yang, L.; Liang, X. The characteristics of a novel heterotrophic nitrifying and aerobic denitrifying bacterium, Acinetobacter junii YB. Bioresour. Technol. 2014, 171, 1–9. [Google Scholar] [CrossRef]
  44. Gu, X.; Leng, J.; Zhu, J.; Zhang, K.; Zhao, J.; Wu, P.; Xing, Q.; Tang, K.; Li, X.; Hu, B. Influence mechanism of C/N ratio on heterotrophic nitrification- aerobic denitrification process. Bioresour. Technol. 2022, 343, 126116. [Google Scholar] [CrossRef] [PubMed]
  45. Yang, X.P.; Wang, S.M.; Zhang, D.W.; Zhou, L.X. Isolation and nitrogen removal characteristics of an aerobic heterotrophic nitrifying-denitrifying bacterium, Bacillus subtilis A1. Bioresour. Technol. 2011, 102, 854–862. [Google Scholar] [CrossRef]
  46. Xia, L.; Li, X.; Fan, W.; Wang, J. Heterotrophic nitrification and aerobic denitrification by a novel Acinetobacter sp. ND7 isolated from municipal activated sludge. Bioresour. Technol. 2020, 301, 122749. [Google Scholar] [CrossRef]
  47. Chen, P.; Li, J.; Li, Q.X.; Wang, Y.; Li, S.; Ren, T.; Wang, L. Simultaneous heterotrophic nitrification and aerobic denitrification by bacterium Rhodococcus sp. CPZ24. Bioresour. Technol. 2012, 116, 266–270. [Google Scholar] [CrossRef]
  48. Chen, H.; Zhou, W.; Zhu, S.; Liu, F.; Qin, L.; Xu, C.; Wang, Z. Biological nitrogen and phosphorus removal by a phosphorus-accumulating bacteria Acinetobacter sp. strain C-13 with the ability of heterotrophic nitrification-aerobic denitrification. Bioresour. Technol. 2021, 322, 124507. [Google Scholar] [CrossRef]
  49. Zhao, B.; He, Y.L.; Hughes, J.; Zhang, X.F. Heterotrophic nitrogen removal by a newly isolated Acinetobacter calcoaceticus HNR. Bioresour. Technol. 2010, 101, 5194–5200. [Google Scholar] [CrossRef] [PubMed]
  50. Huang, X.; Jiang, D.; Ni, J.; Xie, D.; Li, Z. Removal of ammonium and nitrate by the hypothermia bacterium Pseudomonas putida Y-9 mainly through assimilation. Environ. Technol. Innov. 2021, 22, 101458. [Google Scholar] [CrossRef]
  51. Kong, Q.X.; Wang, X.W.; Jin, M.; Shen, Z.Q.; Li, J.W. Development and application of a novel and effective screening method for aerobic denitrifying bacteria. FEMS Microbiol. Lett. 2006, 260, 150–155. [Google Scholar] [CrossRef]
  52. Zhao, B.; An, Q.; He, Y.L.; Guo, J.S. N2O and N2 production during heterotrophic nitrification by Alcaligenes faecalis strain NR. Bioresour. Technol. 2012, 116, 379–385. [Google Scholar] [CrossRef] [PubMed]
  53. Zhang, Q.L.; Liu, Y.; Ai, G.M.; Miao, L.L.; Zheng, H.Y.; Liu, Z.P. The characteristics of a novel heterotrophic nitrification-aerobic denitrification bacterium, Bacillus methylotrophicus strain L7. Bioresour. Technol. 2012, 108, 35–44. [Google Scholar] [CrossRef] [PubMed]
  54. Zheng, H.; Song, Q.; Zhu, Y.; Meng, Q.; Cui, X. Removing ammonia nitrogen from wastewater by immobilized microorganism with reed biochar composite carrier. Chin. J. Environ. Eng. 2019, 13, 310–318. [Google Scholar]
  55. Yang, Z.; Zhou, Q.; Sun, H.; Jia, L.; Zhao, L.; Wu, W. Metagenomic analyses of microbial structure and metabolic pathway in solid-phase denitrification systems for advanced nitrogen removal of wastewater treatment plant effluent: A pilot-scale study. Water Res. 2021, 196, 117067. [Google Scholar] [CrossRef] [PubMed]
Water 16 01993 g001
Figure 1. Phylogenetic tree.
Figure 1. Phylogenetic tree.
Water 16 01993 g001
Water 16 01993 g002
Figure 2. Denitrification and carbon removal and growth of each strain: (a) residual NH4+-N concentration, NH4+-N, and TN removal rate at 96 h; (b) NO3−-N and NO2−-N accumulation; (c) residual COD concentration and COD removal rate; (d) growth density of strain.
Figure 2. Denitrification and carbon removal and growth of each strain: (a) residual NH4+-N concentration, NH4+-N, and TN removal rate at 96 h; (b) NO3−-N and NO2−-N accumulation; (c) residual COD concentration and COD removal rate; (d) growth density of strain.
Water 16 01993 g002
Water 16 01993 g003
Figure 3. Effect of pH on nitrogen and carbon removal by the strains: (a) Bacillus subtilis F4; (b) Alcaligenes faecalis P4.
Figure 3. Effect of pH on nitrogen and carbon removal by the strains: (a) Bacillus subtilis F4; (b) Alcaligenes faecalis P4.
Water 16 01993 g003
Water 16 01993 g004
Figure 4. Effect of C/N ratio on nitrogen and carbon removal by the strains: (a) Bacillus subtilis F4; (b) Alcaligenes faecalis P4.
Figure 4. Effect of C/N ratio on nitrogen and carbon removal by the strains: (a) Bacillus subtilis F4; (b) Alcaligenes faecalis P4.
Water 16 01993 g004
Water 16 01993 g005
Figure 5. Effect of NH4+-N concentration on nitrogen and carbon removal by the strains: (a) Bacillus subtilis F4; (b) Alcaligenes faecalis P4.
Figure 5. Effect of NH4+-N concentration on nitrogen and carbon removal by the strains: (a) Bacillus subtilis F4; (b) Alcaligenes faecalis P4.
Water 16 01993 g005
Water 16 01993 g006
Figure 6. Removal of NH4+-N and COD by immobilized strains.
Figure 6. Removal of NH4+-N and COD by immobilized strains.
Water 16 01993 g006
Table 1. List of primers for gene amplification.
Table 1. List of primers for gene amplification.
Gene NamePrimer NameSequence (5′ to 3′)Annealing TemperatureProduct Size (bp)References
haohaoF1
haoR3		TGCGTGGARTGYCAC
AGRTARGAKYSGGCAAA		55 °C1485[30]
narGnarGF
narGR		GAYATGCAYCCGTT
AYCCARTCRTTRTC		58 °C1008[30]
napAnap1F
nap2R		TCTGGACCATGGGCTTCAACCA
ACGACGACCGGCCAGCGCAG		69 °C877[31]
nirKnirK1F
nirK5R		GGMATGGTKCCSTGGCA
GCCTCGATCAGRTTRTGG		59 °C514[30]
nirSnirS1F
nirS6R		CCTAYTGGCCGCCRCART
CGTTGAACTTRCCGGT		55 °C890[30]
norBnorB F
norB R		TGCTGTTCCGTCTGGAGAA
CGTAGCGACCTTCATAGAGG		57 °C669[31]
nosZnosZ F
nosZ R		GGTAACCTTGACAACACCGA
ATGACGAAGCCGTGAGACA		56 °C1100[31]
Table 2. Strain blast alignment results.
Table 2. Strain blast alignment results.
StrainPhylumClassGenusSpeciesSimilarity
F1FirmicutesBacilliBacillusBacillus thuringiensis99%
F2 (F5/F6)Bacillus cereus99%
F3Bacillus paramycoides99%
F4 (F7/F8/F9/F10)Bacillus subtilis98%
P1 (P8/P9)ProteobacteriaGammaproteobacteriaAcinetobacterAcinetobacter junii99%
P2 (P10/P11)GammaproteobacteriaProvidenciaProvidencia rettgeri99%
P3 (P12/P13)AlphaproteobacteriaPseudochrobactrumPseudochrobactrum asaccharolyticum98%
P4BetaproteobacteriaAlcaligenesAlcaligenes faecalis99%
P5(P14/P15)GammaproteobacteriaProvidenciaProvidenciav ermicola99%
P6GammaproteobacteriaProteusProteus terrae99%
P7GammaproteobacteriaProteusProteus vulgaris99%
Table 3. Nitrogen balance experiment of strains Bacillus subtilis F4 and Alcaligenes faecalis P4 (unit: mg/L).
Table 3. Nitrogen balance experiment of strains Bacillus subtilis F4 and Alcaligenes faecalis P4 (unit: mg/L).
Strain NH4+-NNO2−-NNO3−-NBiomass-NN2Lost N
Bacillus subtilis F4Initial99.5 ± 0.18--10.5 ± 0.37
Final44.8 ± 0.46 39.3 ± 0.4223.9 ± 0.352.1%
Alcaligenes faecalis P4Initial99.5 ± 0.32-0.16 ± 0.089.4 ± 0.48
Final38.9 ± 0.28 42.6 ± 0.3825.6 ± 0.521.8%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, X.; Xu, P.; Lou, Y.; Liu, Y.; Shan, Q.; Xiong, Y.; Wei, H.; Song, J. Characteristics of Novel Heterotrophic Nitrification–Aerobic Denitrification Bacteria Bacillus subtilis F4 and Alcaligenes faecalis P4 Isolated from Landfill Leachate Biochemical Treatment System. Water 2024, 16, 1993. https://doi.org/10.3390/w16141993

AMA Style

Zhang X, Xu P, Lou Y, Liu Y, Shan Q, Xiong Y, Wei H, Song J. Characteristics of Novel Heterotrophic Nitrification–Aerobic Denitrification Bacteria Bacillus subtilis F4 and Alcaligenes faecalis P4 Isolated from Landfill Leachate Biochemical Treatment System. Water. 2024; 16(14):1993. https://doi.org/10.3390/w16141993

Chicago/Turabian Style

Zhang, Xuejun, Peng Xu, Yajuan Lou, Yuqi Liu, Qiantong Shan, Yi Xiong, Hua Wei, and Jianyang Song. 2024. "Characteristics of Novel Heterotrophic Nitrification–Aerobic Denitrification Bacteria Bacillus subtilis F4 and Alcaligenes faecalis P4 Isolated from Landfill Leachate Biochemical Treatment System" Water 16, no. 14: 1993. https://doi.org/10.3390/w16141993

APA Style

Zhang, X., Xu, P., Lou, Y., Liu, Y., Shan, Q., Xiong, Y., Wei, H., & Song, J. (2024). Characteristics of Novel Heterotrophic Nitrification–Aerobic Denitrification Bacteria Bacillus subtilis F4 and Alcaligenes faecalis P4 Isolated from Landfill Leachate Biochemical Treatment System. Water, 16(14), 1993. https://doi.org/10.3390/w16141993

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop