Next Article in Journal
Whole Mitochondrial DNA Sequencing Using Fecal Samples from Domestic Dogs
Previous Article in Journal
Evaluation of ‘In-Parlour Scoring’ (IPS) to Detect Lameness in Dairy Cows during Milking
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 19
10.3390/ani14192871
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Chlorogenic Acid Plays an Important Role in Improving the Growth and Antioxidant Status and Weakening the Inflammatory Response of Largemouth Bass (Micropterus salmoides)

by
Zetian Xia
1,
Haifeng Mi
2,
Mingchun Ren
1,3,
Dongyu Huang
3,
Ahmed Mohamed Aboseif
4,
Hualiang Liang
1,3,* and
Lu Zhang
2,*
1
Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China
2
Tongwei Agricultural Development Co., Ltd., Key Laboratory of Nutrition and Healthy Culture of Aquatic, Livestock and Poultry, Ministry of Agriculture and Rural Affairs, Healthy Aquaculture Key Laboratory of Sichuan Province, Chengdu 610093, China
3
Key Laboratory of Integrated Rice-Fish Farming Ecology, Ministry of Agriculture and Rural Affairs, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, China
4
National Institute of Oceanography and Fisheries (NIOF), Academy of Scientific Research and Technology (ASRT), Cairo 11796, Egypt
*
Authors to whom correspondence should be addressed.
Animals 2024, 14(19), 2871; https://doi.org/10.3390/ani14192871
Submission received: 31 August 2024 / Revised: 2 October 2024 / Accepted: 3 October 2024 / Published: 5 October 2024
(This article belongs to the Section Aquatic Animals)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

This study examined the effects of chlorogenic acid (CGA) on largemouth bass’s growth, immunity, and antioxidant status. Over eight weeks, fish were fed diets with varying CGA levels. In this study, CGA improved the growth performance and lowered the FCR. In addition, CGA enhanced the antioxidant capacity and regulated the expression of genes related to immune responses, thereby strengthening immunity. Overall, the addition of CGA positively impacted the health and growth of largemouth bass.

Abstract

This experiment evaluated the function of chlorogenic acid (CGA) in the growth, health status, and inflammation of largemouth bass (Micropterus salmoides). Over eight weeks, CGA supplementation was designed at five levels: 0, 60, 120, 180, and 240 mg/kg. The 180 and 240 mg/kg CGA-supplemented groups showed significant improvements in the FBW, SGR, and WGR compared to the control group (0 mg/kg) (p < 0.05). All the CGA-supplemented groups exhibited a significant reduction in the FCR (p < 0.05), with the 180 mg/kg CGA group showing the lowest FCR. Nonetheless, there were no appreciable differences in the plasma concentrations of TP, ALT, or AST among the treatments (p > 0.05). Compared to the control group, the 180 mg/kg CGA group exhibited significantly lower TC and TG levels (p < 0.05). The ALP levels showed no significant differences from the control group (p > 0.05). In terms of antioxidant parameters, CGA supplementation considerably reduced the MDA content (p < 0.05) and increased the GSH levels, while decreasing the CAT, SOD, and GPx activity levels Meanwhile, CGA supplementation resulted in reduced mRNA levels of SOD, CAT, Nrf2, Keap1, and NF-κB compared to the control group. In contrast, the mRNA levels of GPx, IL-8, TLR2, and RelA were elevated in the liver. Our findings indicated that CGA supplementation improved the growth performance and antioxidant status and weakened the inflammatory response of largemouth bass. These findings suggest that CGA could be a valuable dietary supplement for enhancing the health and growth of this species.

1. Introduction

Global aquaculture is currently experiencing rapid development, with antibiotics being widely used to enhance the growth performance and nutrient digestibility in aquatic organisms [1,2,3]. However, the extensive use of antibiotics has resulted in the emergence of drug-resistant microorganisms, environmental hazards, and significant food safety concerns [4]. Therefore, it is crucial to explore and develop alternative antibiotics that can effectively improve the health and growth of aquatic organisms, thereby promoting sustainable advancements in aquaculture.
In recent years, there has been increased interest in using natural plant extracts, particularly polyphenols with antioxidant properties, in aquatic feed. Chlorogenic acid (CGA), an ester derived from cinnamic acid and quinic acid, which is also known as 5-O-caffeoylquinic acid (5-CQA), is a prevalent polyphenol found in various fruits, vegetables, Chinese herbal medicines, and coffee beans [5]. Studies have demonstrated that CGA plays a major role in enhancing the growth performance of aquatic animals. For instance, CGA supplementation at 400, 600, and 800 mg/kg led to better protease and digestive enzyme activity levels, potentially contributing to the improved growth performance of rainbow trout (Oncorhynchus mykiss) [6]. Furthermore, CGA supplementation at 200 mg/kg dramatically reduced the feed conversion ratio (FCR) and increased the specific growth rate (SGR) in the crucian carp (Carassius auratus) [7]. CGA has also demonstrated efficacy across various animal models, exhibiting anti-inflammatory properties, enhancing antioxidant enzyme activity, and influencing specific signaling pathways [8,9]. For example, CGA supplementation at 200 mg/kg increased the antioxidant enzyme activity in crucian carps (Carassius auratus), especially in the liver [7]. Additionally, CGA has been found to scavenge superoxide radicals more effectively than vitamin C and to exhibit comparable abilities to vitamin E [10]. The effects of CGA on aquatic organisms have been extensively studied, particularly its anti-inflammatory properties. For instance, in channel catfish (Ictalurus punctatus), CGA has demonstrated the ability to prevent inflammation via the nuclear factor kappa B (NF-κB) signaling pathway and alleviate intestinal barrier damage resulting from oxidized fish oil feeding [11]. Moreover, CGA has been shown to have hepatoprotective effects, protecting mice from damage induced by chemical injury or lipopolysaccharide exposure [12,13].
The largemouth bass (Micropterus salmoides), commonly known as the California perch, is a typical freshwater carnivorous warm-water fish. Due to its rapid growth, robust stress tolerance, minimal intermuscular spines, and high nutritional value, it has become a key economic species in freshwater aquaculture. However, increasing farming densities and environmental degradation have led to a decline in immune function and a rise in disease prevalence among largemouth bass, resulting in significant economic losses. Given the well-documented adverse effects of antibiotics and their subsequent ban in many regions, finding eco-friendly alternatives has become critically important. CGA is an organic compound and a significant bioactive substance known for its growth-regulating and antibacterial properties. Despite its potential, research on CGA in largemouth bass is limited. The aim of this research was to investigate the impact of CGA supplementation on juvenile largemouth bass, in order to evaluate its potential as a viable alternative in aquaculture techniques.

2. Materials and Methods

2.1. Diet Formulation

The diets were formulated using fish meal, chicken meal, soy protein concentrate, soybean meal, rapeseed meal, blood meal, and corn gluten meal as the main protein sources, with fish oil serving as the main lipid source. Five basic feed formulations with equal nitrogen and lipid contents were prepared with different levels of CGA (0, 60, 120, 180, and 240 mg/kg) (Table 1). All the raw materials were ground into a powder using 80-mesh screens. Fish oil and water were then thoroughly mixed with the powdered ingredients. The resulting mixture was processed into 1.5 mm pellets using an aquatic feed extruder (TSE65, Beijing, China). After extrusion, the pellets were air-dried and stored at −20 °C until needed.

2.2. Feeding Procedure

The entire experiment was cultured in outdoor cages at Nanjing Agricultural University’s Wuxi Fishery College. Before the main trial, the juvenile largemouth bass were acclimated in floating cages (2 × 2 × 1 m) for two weeks, receiving commercial feed to adapt to the experimental conditions. Following acclimation, 300 juveniles (3.25 ± 0.03 g) were distributed among 15 floating cages (1 × 1 × 1 m), with each cage containing 20 fish. Each level of CGA supplementation was replicated three times. Throughout the eight-week experimental period, the fish were fed twice daily, once at 7:30 AM and again at 5:30 PM, until satiation. The weights and mortality rates of the fish were recorded. The pH of the culture cycle was kept at 7.0–7.8, the dissolved oxygen content in the cages was greater than 6 mg/L, and the water temperature was 25–29 °C during the experiment.

2.3. Sample Collection

At the end of the eight-week feeding period, the juvenile largemouth bass underwent a 24 h fasting period. Following this, the fish were assessed for quantity and weight, and plasma and liver samples were collected from three fish per cage. Blood samples were collected through caudal venipuncture and centrifuged at 1006.2× g for 10 min at 4 °C to isolate the plasma layer. Liver tissues were dissected and extracted, with all the plasma and liver samples stored at −80 °C. Liver RNA was extracted using TRIzol (Nanjing Vazyme BioTech Co., Ltd., Nanjing, China). The tissue was homogenized in TRIzol, 1/5 volume of chloroform was added, and then the sample was vigorously shaken and left for 5 min. After centrifugation, the supernatant was collected, and an equal amount of isopropyl alcohol was added. Following another round of centrifugation, the supernatant was discarded, and the pellet was washed and precipitated with 75% ethanol. After centrifugation, the supernatant was discarded again and the remaining sample was precipitated, dried, dissolved in DEPC water, and transferred to the refrigerator at −80 °C. Additionally, three fish from each cage were preserved at −20 °C for a whole-body composition analysis.

2.4. Laboratory Trial Analysis

The AOAC method was adopted to analyze the feed and whole-body composition [14]. The blood biochemical parameters, including the total cholesterol (TC), aspartate aminotransferase (AST), alanine transaminase (ALT), glucose (GLU), alkaline phosphatase (ALP), albumin (ALB), and triglycerides (TG), were measured using the Mindray BS-400 automatic biochemical analyzer (Shenzhen, China). The intestinal malondialdehyde (MDA) levels and antioxidant markers, including superoxide dismutase (SOD), the total antioxidant capacity (T-AOC), catalase (CAT), glutathione (GSH), and glutathione peroxidase (GPx), were measured using test kits from the Jian Cheng Bioengineering Institute (Nanjing, China).

2.5. Real-Time Quantitative PCR Analysis

A fluorescence analysis quantified the gene expression related to inflammation, immunity, and antioxidants in the livers of the fish. The gene expression was measured using StepOnePlus real-time PCR, following the analytical methodology outlined in a previous study [15]. Table 2 provides the primer sequences utilized in the analysis. Beta-actin (β-actin) was chosen as the stable reference gene due to its expression levels remaining unaffected by dietary factors [16]. Additionally, primers of β-actin, GPx, CAT, Kelch-like ECH-associated protein1 (Keap1), NF-κB, interleukin 8 (IL-8), and Toll-like receptor 2 (TLR2) were designed for this experiment.

2.6. Data Analysis

The data analysis was conducted using a one-way ANOVA and Duncan’s multiple comparison analysis with SPSS version 26.0, and graphical representations were created using GraphPad Prism 9.0. The results are expressed as the mean ± SEM, and statistically significant differences were found when p < 0.05.

3. Results

3.1. Growth Performance

Table 3 summarizes the growth results. The final body weight (FBW), weight gain ratio (WGR), and specific growth rate (SGR) were significantly higher in the 180 and 240 mg/kg CGA groups compared to the control group (p < 0.05). Additionally, the feed conversion ratio (FCR) was notably lower in the 180 mg/kg CGA group compared to the other CGA-supplemented groups (p < 0.05).

3.2. Whole-Body Composition

Table 4 summarizes the whole-body composition results. No significant differences (p > 0.05) were observed in the overall body composition of the largemouth bass across the five experimental groups.

3.3. Plasma Parameters

Table 5 summarizes the biochemical analysis results. There were no significant variations in the levels of TP, ALT, or AST across all the treatment groups (p > 0.05). A trend of decreasing plasma TC and TG levels was observed with higher doses of CGA. Specifically, the TC in the 180 mg/kg CGA group was considerably lower than that in the control group, and the TG levels also showed a significant decrease in this group (p < 0.05). The ALB levels were lowest at 120 and 180 mg/kg of CGA supplementation, although there were no significant differences between these levels and those of the control group (p > 0.05). However, the 180 mg/kg CGA group exhibited the highest GLU levels, significantly differing from the control group (p > 0.05).

3.4. Hepatic Antioxidant Parameters

The liver’s malondialdehyde (MDA) and antioxidant parameter data are shown in Figure 1. Supplementation with 120 mg/kg of CGA significantly reduced the MDA levels compared to the control group (p < 0.05) (Figure 1b). At 180 mg/kg of CGA, the CAT activity was decreased substantially and was noticeably less than that observed in the control group (p < 0.05) (Figure 1d). All the CGA-supplemented groups exhibited a significant reduction in the GPx activity compared to the control group (p < 0.05) (Figure 1c). The fish in the 120 mg/kg CGA group exhibited significantly lower SOD activity (p < 0.05) (Figure 1e). However, the GSH and T-AOC levels did not show significant differences among any of the CGA treatment groups (p > 0.05) (Figure 1a).

3.5. Hepatic Gene Expression

As shown in Figure 2, fish supplemented with 180 mg/kg of CGA exhibited significantly lower mRNA levels of CAT and SOD compared to the non-supplemented group (p < 0.05) (Figure 2a,c). Even at elevated levels of CGA, the mRNA levels of GPx did not differ significantly across the groups (p > 0.05) (Figure 2b). Similarly, the mRNA levels of Nrf2 did not exhibit a significant decrease in comparison to the control group, regardless of the CGA concentration (p > 0.05) (Figure 2e). However, the mRNA levels of Keap1 decreased significantly with increasing CGA levels up to 180 mg/kg (p < 0.05) (Figure 2d), before exhibiting a non-significant increase (p > 0.05). The mRNA levels of NF-κB did not show significant differences across groups (p > 0.05) (Figure 3a). Furthermore, the mRNA levels of TLR2 and IL-8 showed a pattern of increase followed by a decrease, with no significant inter-group differences (p > 0.05) (Figure 3c,b). Notably, the mRNA levels of RelA were significantly elevated in the 180 mg/kg CGA group compared to the control group (p < 0.05) (Figure 3d).

4. Discussion

CGA supplementation in feed has been reported to improve the growth performance of aquatic animals [6,7]. This study similarly observed improved growth metrics in largemouth bass, as evidenced by an increased FBW, WGR, and SGR, along with a reduced FCR. Previous research supports these findings; for instance, supplementation with 200 mg/kg of CGA significantly increased the WGR and SGR and promoted the growth of crucian carps [7]. Meanwhile, Wang et al. discovered that 200 and 400 mg/kg of CGA significantly enhanced L. vannamei’s resistance to the combined stress of low salinity and nitrites, as evidenced by the noteworthy increased survival [20]. Ghafarifarsani et al. observed similar effects in rainbow trout, where dosages of 600 and 800 mg/kg of CGA led to a significant increase in the WGR and a corresponding reduction in the FCR [6]. This enhancement in growth metrics may be attributed to CGA’s potential to stimulate central nervous system excitation, improve gastrointestinal contraction function, and enhance nutrient uptake and utilization [21]. Additionally, CGA might protect the liver and bile, and it exhibits antibacterial, anti-inflammatory, and immune-regulating properties [22,23,24], contributing to overall animal health and growth [25,26].
In contrast, the inclusion of CGA in this study had no discernible effect on the whole-body composition. This contrasts with the findings of Sun et al., who reported a significant reduction in the muscle crude fat content of grass carp when the CGA concentration in their feed exceeded 200 mg/kg [27]. These differences might be attributed to differences in species, feeding behavior, or environmental factors. Plasma biochemical markers are crucial indicators of metabolic state and overall health. ALT and AST serve as key biological markers for liver function tests in fish [28]. Elevated levels of these enzymes are associated with liver impairment and potential liver disease [29]. Research has demonstrated that CGA can exert a hepatoprotective effect by regulating the homeostasis of the enterohepatic axis, including improving the structure of intestinal flora and enhancing the intestinal barrier function to significantly reduce AST and ALT in mice, thus alleviating alcoholic liver injury [30]. Similarly, our study observed that CGA supplementation decreased the plasma ALT and AST levels, suggesting that CGA doses up to 240 mg/kg might protect liver function. Consistent findings were reported in channel catfish, where CGA supplementation mitigated liver damage caused by an oxidized fish oil feed [11]. All of these results indicate that CGA has great potential to protect animal livers. The mechanism may also be that CGA inhibits inflammation and enhances the antioxidant defense system by regulating the MAPK, TLR3/4, and NF-κB signaling pathways in animals [31,32]. However, the hepatoprotective effect in largemouth bass needs to be validated in a broader study to determine the specific effects of CGA on largemouth bass liver health. Furthermore, this study found a regulatory effect of CGA on lipid metabolism. Notably, CGA supplementation significantly diminished the TC and TG plasma levels, underscoring its beneficial modulation and hypolipidemic potential. CGA is absorbed as a prototype in the stomach and small intestine, exerting its lipid-lowering effects upon entering the bloodstream [33,34]. Yan et al. found that CGA improved the glucose tolerance, lipid metabolism, inflammation, and composition of gut microbiota in mice [35]. CGA supplementation similarly showed a positive effect in a rat model. Shimoda et al. reported that an oral administration of CGA reduced the visceral fat and lipid content in rats [36], while De Sotillo et al. found that intravenous CGA significantly decreased the TG content in the liver and plasma of rats [37], confirming its positive regulatory effect on lipid metabolism. However, the plasma glucose levels in the 180 and 240 mg/kg CGA groups were significantly higher, suggesting that excessive supplementation may elevate the risk of hyperglycemia. In conclusion, CGA may be a potent modulator of lipid metabolism, but its effect on blood glucose levels requires more careful assessment and may need to be adjusted for species and dosage.
CGA, a phenolic acid compound that is abundant in foods, is known for its potent antioxidant properties [31]. Fish tissue, rich in polyunsaturated fatty acids, is highly susceptible to damage from free radicals. An imbalance between reactive oxygen species (ROS) generation and antioxidant availability can lead to oxidative stress [38]. MDA is a reliable marker of oxidative stress, indicating lipid peroxidation in cell membranes and reflecting cellular integrity [39]. Our experiment demonstrates that CGA possesses an antioxidant capacity, reducing oxidative stress on hepatic tissues and cell membranes, as the MDA levels in the CGA-supplemented groups were considerably lower than those in the control group. Meanwhile, the scavenging of reactive oxygen species (ROS) and the functioning of antioxidant enzymes such as CAT, SOD, GPx, and T-AOC in fish may represent a protective mechanism against oxidative damage [40]. Our research revealed that CGA supplementation led to lower liver antioxidant enzyme activity, such as the activity of GPx, CAT, and SOD, contrasting with the findings reported by Jin et al. [7], which may be due to the fact that oxidative stress in the liver is alleviated under the action of CGA and, thus, the need for the activity of these antioxidant enzymes is reduced. The antioxidant enzyme activity in aquatic animals is closely related to their mRNA abundance [41]. In our study, the reduced functions of CAT and SOD in the liver of largemouth bass aligned with decreased mRNA levels, which is consistent with observations in juvenile blunt snout bream [42]. This might be because of CGA’s strong anti-inflammatory and antioxidant capabilities, enhancing cell membrane integrity by scavenging free radicals in the liver [43]. Keap1 is normally a negative regulatory protein of Nrf2, inhibiting its transcriptional activity by binding to its amino-terminal regulatory domain [44]. Other research has shown that stressful conditions or exposure to unfavorable nutrients, such as dairy cows under heat stress [45] or largemouth bass fed inappropriate starch sources [46], can lead to higher oxidative stress. In some cases, however, even in the absence of obvious oxidative stress, cells can prepare for the potential activation of Nrf2 by cells, possibly by increasing Keap1 expression, a preventive regulation to respond quickly to possible oxidative challenges. In addition, Keap1 expression may be regulated by various factors, including hormone levels, the nutritional status, the cell cycle, and the differentiation status [47]. Therefore, the high level of Keap1 mRNA in the control group may have resulted from the combined effect of these factors, and the specific mechanism needs to be further studied. As a polyphenol compound, CGA has powerful antioxidant properties, which can reduce oxidative stress and free radical damage to cells [31]. It is possible that CGA supplementation through its antioxidant effect reduces the oxidative stress in cells and, thus, reduces the level of Keap1 mRNA. This is consistent with the finding that the mRNA levels of SOD and CAT were decreased, though Nrf2 expression itself did not show significant changes. This might be because Nrf2 protein levels are tightly regulated by Keap1, and rapidly degrade under normal conditions, but stabilize under stress conditions [48,49]. Furthermore, CGA supplementation resulted in the decreased activity of antioxidant enzymes (e.g., GPx, CAT, and SOD) in the liver, probably because CGA reduces oxidative and inflammatory stress by regulating the expression of antioxidant and cytoprotective genes. Although there is no direct evidence on how CGA affects Keap1′s sensitive cysteine residue modification, it is reasonable to speculate that CGA may influence the Keap1 function directly or indirectly, thereby affecting Nrf2 activity and the antioxidant response of cells. Future studies should further investigate the specific mechanisms of the interaction between CGA and Keap1.
Tissue damage in fish can lead to inflammation, which is often characterized by the elevated mRNA expression of cytokines [50]. NF-κB is a crucial transcription factor involved in inflammatory responses [51]. In this study, the mRNA levels of NF-κB tended to decline with increasing doses of CGA supplementation, although they did not change significantly. These findings suggest that CGA might suppress the increase in the NF-κB abundance, potentially mitigating the hepatic inflammatory response by preventing the activation of the NF-κB signaling pathway. Several research works have demonstrated the anti-inflammatory characteristics of CGA [9,12,52]. Additionally, the mRNA levels of RelA, TLR2, and IL-8 initially increased and then decreased, with significant elevations in the RelA mRNA levels observed at CGA supplementation levels of 120–240 mg/kg. This suggests that CGA may have an effect on the immune status of largemouth bass at specific doses by modulating the signaling pathways related to immune responses. Specifically, CGA may affect the maturation and activation of immune cells, as well as the production of inflammatory factors, through the activation of pattern recognition receptors (e.g., TLR 2) and transcription factors (e.g., RelA, a component of NF-κB). Despite the observed effects, CGA had no significant impact on NF-κB, indicating that CGA might regulate inflammatory responses through mechanisms beyond the NF-κB signaling pathway. This is consistent with other findings, such as CGA’s ability to ameliorate inflammatory liver damage by inhibiting HSP60-mediated inflammatory signaling pathways [53]. However, there is a lack of research on the specific regulatory mechanisms of CGA on inflammatory factors, and further investigation is needed to elucidate these mechanisms.

5. Conclusions

Adding CGA to the diet of largemouth bass can improve their growth and antioxidant status and weaken their inflammatory response, while also regulating their lipid metabolism and showing potential to protect their liver. As a natural feed additive, CGA is expected to be an effective alternative to antibiotics in aquaculture due to its multifaceted benefits.

Author Contributions

Methodology, H.M. and M.R.; formal analysis, Z.X.; investigation, D.H.; data curation, H.M. and D.H.; writing—original draft preparation, Z.X.; writing—review and editing, L.Z., H.L. and A.M.A.; project administration, L.Z. and H.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financially supported by the National Key R & D Program of China (2023YFD2400601), the earmarked fund for CARS (CARS-46), the National Natural Science Foundation of China (32102806), the Central Public-interest Scientific Institution Basal Research Fund, Freshwater Fisheries Research Center, CAFS (No. 2024JBFR01), and the Academy of Scientific Research and Technology (ASRT) (ASRT-STAR cycle 1).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

This study was approved by the Laboratory Animal Ethics Committee of the Freshwater Fisheries Research Center (LAECFFRC-2023-03-28).

Data Availability Statement

The data are contained within the article.

Conflicts of Interest

The authors Lu Zhang and Haifeng Mi are employed by Tongwei Agricultural Development Co., Ltd. The remaining authors declare that this research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest. Lu Zhang made important contributions to writing—review and editing and project administration. Haifeng Mi made important contributions to the methodology and data curation.

References

  1. The State of World Fisheries and Aquaculture 2022; FAO: Rome, Italy, 2022; ISBN 978-92-5-136364-5.
  2. Hoseinifar, S.H.; Sun, Y.-Z.; Caipang, C.M. Short-Chain Fatty Acids as Feed Supplements for Sustainable Aquaculture: An Updated View. Aquac. Res. 2017, 48, 1380–1391. [Google Scholar] [CrossRef]
  3. Dawood, M.A.O.; Koshio, S. Recent Advances in the Role of Probiotics and Prebiotics in Carp Aquaculture: A Review. Aquaculture 2016, 454, 243–251. [Google Scholar] [CrossRef]
  4. Tang, Y.; Lou, X.; Yang, G.; Tian, L.; Wang, Y.; Huang, X. Occurrence and Human Health Risk Assessment of Antibiotics in Cultured Fish from 19 Provinces in China. Front. Cell. Infect. Microbiol. 2022, 12, 964283. [Google Scholar] [CrossRef] [PubMed]
  5. Azuma, K.; Ippoushi, K.; Nakayama, M.; Ito, H.; Higashio, H.; Terao, J. Absorption of Chlorogenic Acid and Caffeic Acid in Rats after Oral Administration. J. Agric. Food Chem. 2000, 48, 5496–5500. [Google Scholar] [CrossRef] [PubMed]
  6. Ghafarifarsani, H.; Nedaei, S.; Hoseinifar, S.H.; Van Doan, H. Effect of Different Levels of Chlorogenic Acid on Growth Performance, Immunological Responses, Antioxidant Defense, and Disease Resistance of Rainbow Trout (Oncorhynchus mykiss) Juveniles. Aquacult. Nutr. 2023, 3679002. [Google Scholar] [CrossRef]
  7. Jin, X.; Su, M.; Liang, Y.; Li, Y. Effects of Chlorogenic Acid on Growth, Metabolism, Antioxidation, Immunity, and Intestinal Flora of Crucian Carp (Carassius auratus). Front. Microbiol. 2023, 13, 1084500. [Google Scholar] [CrossRef]
  8. Li, S.; Bian, H.; Liu, Z.; Wang, Y.; Dai, J.; He, W.; Liao, X.; Liu, R.; Luo, J. Chlorogenic Acid Protects MSCs against Oxidative Stress by Altering FOXO Family Genes and Activating Intrinsic Pathway. Eur. J. Pharmacol. 2012, 674, 65–72. [Google Scholar] [CrossRef]
  9. Bao, L.; Li, J.; Zha, D.; Zhang, L.; Gao, P.; Yao, T.; Wu, X. Chlorogenic Acid Prevents Diabetic Nephropathy by Inhibiting Oxidative Stress and Inflammation through Modulation of the Nrf2/HO-1 and NF-ĸB Pathways. Int. Immunopharmacol. 2018, 54, 245–253. [Google Scholar] [CrossRef]
  10. Sato, Y.; Itagaki, S.; Kurokawa, T.; Ogura, J.; Kobayashi, M.; Hirano, T.; Sugawara, M.; Iseki, K. In Vitro and in Vivo Antioxidant Properties of Chlorogenic Acid and Caffeic Acid. Int. J. Pharm. 2011, 403, 136–138. [Google Scholar] [CrossRef]
  11. Zhang, J.; Wang, Z.; Shi, Y.; Xia, L.; Hu, Y.; Zhong, L. Protective Effects of Chlorogenic Acid on Growth, Intestinal Inflammation, Hepatic Antioxidant Capacity, Muscle Development and Skin Color in Channel Catfish Ictalurus Punctatus Fed an Oxidized Fish Oil Diet. Fish Shellfish Immunol. 2023, 134, 108511. [Google Scholar] [CrossRef]
  12. Shi, H.; Dong, L.; Jiang, J.; Zhao, J.; Zhao, G.; Dang, X.; Lu, X.; Jia, M. Chlorogenic Acid Reduces Liver Inflammation and Fibrosis through Inhibition of Toll-like Receptor 4 Signaling Pathway. Toxicology 2013, 303, 107–114. [Google Scholar] [CrossRef] [PubMed]
  13. Hemmerle, H.; Burger, H.-J.; Below, P.; Schubert, G.; Rippel, R.; Schindler, P.W.; Paulus, E.; Herling, A.W. ChemInform Abstract: Chlorogenic Acid and Synthetic Chlorogenic Acid Derivatives: Novel Inhibitors of Hepatic Glucose-6-phosphate Translocase. ChemInform 1997, 28, chin.199718118. [Google Scholar] [CrossRef]
  14. Horwitz, W.; Association of Official Analytical Chemists (Eds.) Official Methods of Analysis of the Association of Official Analytical Chemists, 13th ed.; Association of Official Analytical Chemists: Washington, DC, USA, 1980; ISBN 978-0-935584-14-1. [Google Scholar]
  15. Liang, H.; Mokrani, A.; Ji, K.; Ge, X.; Ren, M.; Xie, J.; Liu, B.; Xi, B.; Zhou, Q. Dietary Leucine Modulates Growth Performance, Nrf2 Antioxidant Signaling Pathway and Immune Response of Juvenile Blunt Snout Bream (Megalobrama amblycephala). Fish Shellfish Immunol. 2018, 73, 57–65. [Google Scholar] [CrossRef]
  16. Ren, M. Role of Dietary Isoleucine Supplementation in Facilitating Growth Performance and Muscle Growth in Juvenile Largemouth Bass (Micropterus salmoides). Aquacult. Rep. 2023, 33, 101783. [Google Scholar] [CrossRef]
  17. Gu, J.; Liang, H.; Ge, X.; Xia, D.; Pan, L.; Mi, H.; Ren, M. A Study of the Potential Effect of Yellow Mealworm (Tenebrio molitor) Substitution for Fish Meal on Growth, Immune and Antioxidant Capacity in Juvenile Largemouth Bass (Micropterus salmoides). Fish Shellfish Immunol. 2022, 120, 214–221. [Google Scholar] [CrossRef] [PubMed]
  18. Liang, H.; Ren, M.; Zhang, L.; Mi, H.; Yu, H.; Huang, D.; Gu, J.; Teng, T. Excessive Replacement of Fish Meal by Soy Protein Concentrate Resulted in Inhibition of Growth, Nutrient Metabolism, Antioxidant Capacity, Immune Capacity, and Intestinal Development in Juvenile Largemouth Bass (Micropterus salmoides). Antioxidants 2024, 13, 809. [Google Scholar] [CrossRef]
  19. Yang, P.; Wang, W.; Chi, S.; Mai, K.; Song, F.; Wang, L. Effects of Dietary Lysine on Regulating GH-IGF System, Intermediate Metabolism and Immune Response in Largemouth Bass (Micropterus salmoides). Aquacult. Rep. 2020, 17, 100323. [Google Scholar] [CrossRef]
  20. Wang, Y.; Li, Z.; Li, J.; Duan, Y.-F.; Niu, J.; Wang, J.; Huang, Z.; Lin, H.-Z. Effects of Dietary Chlorogenic Acid on Growth Performance, Antioxidant Capacity of White Shrimp Litopenaeus vannamei under Normal Condition and Combined Stress of Low-Salinity and Nitrite. Fish Shellfish Immunol. 2015, 43, 337–345. [Google Scholar] [CrossRef]
  21. Clayton, G. Herbs and Plant Extracts as Growth Enhancers. Feed. Manag. 1999, 50, 29–32. [Google Scholar]
  22. Wang, L.; Bi, C.; Cai, H.; Liu, B.; Zhong, X.; Deng, X.; Wang, T.; Xiang, H.; Niu, X.; Wang, D. The Therapeutic Effect of Chlorogenic Acid against Staphylococcus Aureus Infection through Sortase A Inhibition. Front. Microbiol. 2015, 6, 1031. [Google Scholar] [CrossRef]
  23. Wu, Y.; Liu, W.; Li, Q.; Li, Y.; Yan, Y.; Huang, F.; Wu, X.; Zhou, Q.; Shu, X.; Ruan, Z. Dietary Chlorogenic Acid Regulates Gut Microbiota, Serum-Free Amino Acids and Colonic Serotonin Levels in Growing Pigs. Int. J. Food Sci. Nutr. 2018, 69, 566–573. [Google Scholar] [CrossRef] [PubMed]
  24. Gong, X.X.; Su, X.S.; Zhan, K.; Zhao, G.Q. The Protective Effect of Chlorogenic Acid on Bovine Mammary Epithelial Cells and Neutrophil Function. J. Dairy Sci. 2018, 101, 10089–10097. [Google Scholar] [CrossRef] [PubMed]
  25. Vukelić, I.; Detel, D.; Pučar, L.B.; Potočnjak, I.; Buljević, S.; Domitrović, R. Chlorogenic Acid Ameliorates Experimental Colitis in Mice by Suppressing Signaling Pathways Involved in Inflammatory Response and Apoptosis. Food Chem. Toxicol. 2018, 121, 140–150. [Google Scholar] [CrossRef] [PubMed]
  26. Liang, N.; Kitts, D. Role of Chlorogenic Acids in Controlling Oxidative and Inflammatory Stress Conditions. Nutrients 2015, 8, 16. [Google Scholar] [CrossRef]
  27. Sun, W.T.; Li, X.Q.; Xu, H.B.; Chen, J.N.; Xu, X.Y.; Leng, X.J. Effects of Dietary Chlorogenic Acid on Growth, Flesh Quality and Serum Biochemical Indices of Grass Carp (Ctenopharyngodon idella). Aquac. Nutr. 2017, 23, 1254–1263. [Google Scholar] [CrossRef]
  28. Li, F.; Liu, L.; Chen, X.; Zhang, B.; Li, F. Dietary Copper Supplementation Increases Growth Performance by Increasing Feed Intake, Digestibility, and Antioxidant Activity in Rex Rabbits. Biol. Trace Elem. Res. 2021, 199, 4614–4623. [Google Scholar] [CrossRef]
  29. Sugawara, N.; Li, D.; Sugawara, C.; Miyake, H. Response of Hepatic Function to Hepatic Copper Deposition in Rats Fed a Diet Containing Copper. Biol. Trace Elem. Res. 1995, 49, 161–169. [Google Scholar] [CrossRef]
  30. Zhu, H.; Jiang, W.; Liu, C.; Wang, C.; Hu, B.; Guo, Y.; Cheng, Y.; Qian, H. Ameliorative Effects of Chlorogenic Acid on Alcoholic Liver Injury in Mice via Gut Microbiota Informatics. Eur. J. Pharmacol. 2022, 928, 175096. [Google Scholar] [CrossRef]
  31. Naveed, M.; Hejazi, V.; Abbas, M.; Kamboh, A.A.; Khan, G.J.; Shumzaid, M.; Ahmad, F.; Babazadeh, D.; FangFang, X.; Modarresi-Ghazani, F.; et al. Chlorogenic Acid (CGA): A Pharmacological Review and Call for Further Research. Biomed. Pharmacother. 2018, 97, 67–74. [Google Scholar] [CrossRef]
  32. Dungubat, E.; Watabe, S.; Togashi-Kumagai, A.; Watanabe, M.; Kobayashi, Y.; Harada, N.; Yamaji, R.; Fukusato, T.; Lodon, G.; Sevjid, B.; et al. Effects of Caffeine and Chlorogenic Acid on Nonalcoholic Steatohepatitis in Mice Induced by Choline-Deficient, L-Amino Acid-Defined, High-Fat Diet. Nutrients 2020, 12, 3886. [Google Scholar] [CrossRef]
  33. Olthof, M.R.; Hollman, P.C.; Katan, M.B. Chlorogenic Acid and Caffeic Acid Are Absorbed in Humans. J. Nutr. 2001, 131, 66–71. [Google Scholar] [CrossRef] [PubMed]
  34. Lafay, S.; Gil-Izquierdo, A.; Manach, C.; Morand, C.; Besson, C.; Scalbert, A. Chlorogenic Acid Is Absorbed in Its Intact Form in the Stomach of Rats. J. Nutr. 2006, 136, 1192–1197. [Google Scholar] [CrossRef] [PubMed]
  35. Yan, Y.; Li, Q.; Shen, L.; Guo, K.; Zhou, X. Chlorogenic Acid Improves Glucose Tolerance, Lipid Metabolism, Inflammation and Microbiota Composition in Diabetic Db/Db Mice. Front. Endocrinol. 2022, 13, 1042044. [Google Scholar] [CrossRef]
  36. Shimoda, H.; Seki, E.; Aitani, M. Inhibitory Effect of Green Coffee Bean Extract on Fat Accumulation and Body Weight Gain in Mice. BMC Complement. Altern. Med. 2006, 6, 9. [Google Scholar] [CrossRef]
  37. Rodriguez De Sotillo, D.V.; Hadley, M. Chlorogenic Acid Modifies Plasma and Liver Concentrations of: Cholesterol, Triacylglycerol, and Minerals in (Fa/Fa) Zucker Rats. J. Nutr. Biochem. 2002, 13, 717–726. [Google Scholar] [CrossRef]
  38. Marrocco, I.; Altieri, F.; Peluso, I. Measurement and Clinical Significance of Biomarkers of Oxidative Stress in Humans. Oxid. Med. Cell. Longev. 2017, 2017, 6501046. [Google Scholar] [CrossRef] [PubMed]
  39. Buege, J.A.; Aust, S.D. [30] Microsomal Lipid Peroxidation. In Methods in Enzymology; Elsevier: Amsterdam, The Netherlands, 1978; Volume 52, pp. 302–310. ISBN 978-0-12-181952-1. [Google Scholar]
  40. Wang, B.; Feng, L.; Chen, G.-F.; Jiang, W.-D.; Liu, Y.; Kuang, S.-Y.; Jiang, J.; Tang, L.; Wu, P.; Tang, W.-N.; et al. Jian Carp (Cyprinus carpio Var. Jian) Intestinal Immune Responses, Antioxidant Status and Tight Junction Protein mRNA Expression Are Modulated via Nrf2 and PKC in Response to Dietary Arginine Deficiency. Fish Shellfish Immunol. 2016, 51, 116–124. [Google Scholar] [CrossRef]
  41. Fontagné-Dicharry, S.; Lataillade, E.; Surget, A.; Larroquet, L.; Cluzeaud, M.; Kaushik, S. Antioxidant Defense System Is Altered by Dietary Oxidized Lipid in First-Feeding Rainbow Trout (Oncorhynchus mykiss). Aquaculture 2014, 424–425, 220–227. [Google Scholar] [CrossRef]
  42. Yang, Q.; Liang, H.; Mokrani, A.; Ji, K.; Yu, H.; Ge, X.; Ren, M.; Xie, J.; Pan, L.; Sun, A. Dietary Histidine Affects Intestinal Antioxidant Enzyme Activities, Antioxidant Gene Expressions and Inflammatory Factors in Juvenile Blunt Snout Bream (Megalobrama amblycephala). Aquacult. Nutr. 2019, 25, 249–259. [Google Scholar] [CrossRef]
  43. Kono, Y.; Kobayashi, K.; Tagawa, S.; Adachi, K.; Ueda, A.; Sawa, Y.; Shibata, H. Antioxidant Activity of Polyphenolics in Diets. Biochim. Biophys. Acta (BBA)—Gen. Subj. 1997, 1335, 335–342. [Google Scholar] [CrossRef]
  44. Timme-Laragy, A.R.; Karchner, S.I.; Franks, D.G.; Jenny, M.J.; Harbeitner, R.C.; Goldstone, J.V.; McArthur, A.G.; Hahn, M.E. Nrf2b, Novel Zebrafish Paralog of Oxidant-Responsive Transcription Factor NF-E2-Related Factor 2 (NRF2). J. Biol. Chem. 2012, 287, 4609–4627. [Google Scholar] [CrossRef] [PubMed]
  45. Wang, H.; Shen, Z.; Xiao, H.; Liu, X.; Ai, Y.; Zhang, Y. Effects of heat stress on Keap1-Nrf2-ARE signal pathway of liver in dairy cows. J. Nanjing Agric. Univ. 2017, 40, 151–156. [Google Scholar]
  46. Huang, D.; Gu, J.; Xue, C.; Zhang, L.; Chen, X.; Wang, Y.; Liang, H.; Ren, M. Different Starch Sources Affect the Growth Performance and Hepatic Health Status of Largemouth Bass (Micropterus salmoides) in a High-Temperature Environment. Animals 2023, 13, 3808. [Google Scholar] [CrossRef] [PubMed]
  47. Baird, L.; Yamamoto, M. The Molecular Mechanisms Regulating the KEAP1-NRF2 Pathway. Mol. Cell. Biol. 2020, 40, e00099-20. [Google Scholar] [CrossRef] [PubMed]
  48. McMahon, M.; Itoh, K.; Yamamoto, M.; Hayes, J.D. Keap1-Dependent Proteasomal Degradation of Transcription Factor Nrf2 Contributes to the Negative Regulation of Antioxidant Response Element-Driven Gene Expression. J. Biol. Chem. 2003, 278, 21592–21600. [Google Scholar] [CrossRef]
  49. Kobayashi, M.; Yamamoto, M. Molecular Mechanisms Activating the Nrf2-Keap1 Pathway of Antioxidant Gene Regulation. Antioxid. Redox Signal. 2005, 7, 385–394. [Google Scholar] [CrossRef]
  50. Defaix, R.; Lokesh, J.; Frohn, L.; Le Bechec, M.; Pigot, T.; Véron, V.; Surget, A.; Biasutti, S.; Terrier, F.; Skiba-Cassy, S.; et al. Exploring the Effects of Dietary Inulin in Rainbow Trout Fed a High-Starch, 100% Plant-Based Diet. J. Anim. Sci. Biotechnol. 2024, 15, 6. [Google Scholar] [CrossRef]
  51. Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB Signaling in Inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [PubMed]
  52. Bhandarkar, N.S.; Brown, L.; Panchal, S.K. Chlorogenic Acid Attenuates High-Carbohydrate, High-Fat Diet–Induced Cardiovascular, Liver, and Metabolic Changes in Rats. Nutr. Res. 2019, 62, 78–88. [Google Scholar] [CrossRef] [PubMed]
  53. Hu, F.; Guo, Q.; Wei, M.; Huang, Z.; Shi, L.; Sheng, Y.; Ji, L. Chlorogenic Acid Alleviates Acetaminophen-Induced Liver Injury in Mice via Regulating Nrf2-Mediated HSP60-Initiated Liver Inflammation. Eur. J. Pharmacol. 2020, 883, 173286. [Google Scholar] [CrossRef]
Animals 14 02871 g001aAnimals 14 02871 g001b
Figure 1. The effects of CGA on antioxidant parameters and MDA in the liver: (a) T-AOC; (b) MDA; (c) Gpx; (d) CAT; (e) GSH; (f) SOD. Bars marked with different letters are significantly different from each other (p < 0.05).
Figure 1. The effects of CGA on antioxidant parameters and MDA in the liver: (a) T-AOC; (b) MDA; (c) Gpx; (d) CAT; (e) GSH; (f) SOD. Bars marked with different letters are significantly different from each other (p < 0.05).
Animals 14 02871 g001aAnimals 14 02871 g001b
Animals 14 02871 g002aAnimals 14 02871 g002b
Figure 2. The effects of CGA on the mRNA levels of Nrf2 signaling pathway in the liver: (a) SOD; (b) Gpx; (c) CAT; (d) Keap1; (e) Nrf2. Bars marked with different letters are significantly different from each other (p < 0.05).
Figure 2. The effects of CGA on the mRNA levels of Nrf2 signaling pathway in the liver: (a) SOD; (b) Gpx; (c) CAT; (d) Keap1; (e) Nrf2. Bars marked with different letters are significantly different from each other (p < 0.05).
Animals 14 02871 g002aAnimals 14 02871 g002b
Animals 14 02871 g003aAnimals 14 02871 g003b
Figure 3. The effects of CGA on the mRNA levels of inflammatory factors: (a) NF-κB; (b) IL-8; (c) TLR2; (d) RelA. Bars marked with different letters are significantly different from each other (p < 0.05).
Figure 3. The effects of CGA on the mRNA levels of inflammatory factors: (a) NF-κB; (b) IL-8; (c) TLR2; (d) RelA. Bars marked with different letters are significantly different from each other (p < 0.05).
Animals 14 02871 g003aAnimals 14 02871 g003b
Table 1. Experimental basic formula (% dry matter).
Table 1. Experimental basic formula (% dry matter).
Ingredients (g/kg)Level (%)Ingredients (g/kg)Level (%)
Fish meal 130.00 Fish oil 6.66
Chicken meal 15.00 Cassava starch5.00
Soy concentrated protein 18.00 Choline chloride 0.50
Soybean meal 111.00 Vitamin premix 21.00
Rapeseed meal 17.20 Mineral premix 21.00
Blood meal 15.00 Monocalcium phosphate3.46
Corn gluten meal 17.70 Vitamin C0.05
Wheat gluten 13.00 L-lysine 30.28
Wheat meal5.00 L-methionine 30.15
Analyzed proximate composition (dry matter)
Crude protein (%)47.50 ± 0.08
Crude lipid (%)10.86 ± 0.08
Gross energy (KJ/g)20.23 ± 0.23
Note: 1 The crude protein contents of fish meal, chicken meal, soy concentrated protein, soybean meal, rapeseed meal, blood meal, corn gluten meal, and wheat gluten were 65.80%, 62.00%, 63.00%, 46.00%, 39.00%, 90.00%, 60.57%, and 80.00%, and the crude lipid contents were 9.50%, 9.00%, 4.10%, 4.25%, 6.00%, 0.00%, 3.30%, and 2.00%, respectively. Biomar Tongwei Biotech Co., Ltd. (Wuxi, China) provided them. 2 Hanove Animal Health Products Co., Ltd. (Wuxi, China) provided the vitamin premix and mineral premix. 3 Feeer Co., Ltd. (Shanghai, China) provided L-lysine and L-methionine.
Table 2. Real-time PCR primer sequences.
Table 2. Real-time PCR primer sequences.
Target GeneForward (5′-3′) Reverse (5′-3′)GenBank
β-actinGGTGTGATGGTTGGTATGGCTCGTTGTAGAAGGTGTGATMH018565.1
GPxGAAGGTGGATGTGAATGGACCAACCAGGAACTTCTCAAMK614713.1
SODTGGCAAGAACAAGAACCACACCTCTGATTTCTCCTGTCACC[17]
CATCTATGGCTCTCACACCTTCTCCTCTACTGGCAGATTCTMK614708.1
Nrf2CCACACGTGACTCTGATTTCTCTCCTCCATGACCTTGAAGCAT[18]
Keap1CGTACGTCCAGGCCTTACTCTGACGGAAATAACCCCCTGCXP_018520553.1
NF-κBCCACTCAGGTGTTGGAGCTTTCCAGAGCACGACACACTTCXP_027136364.
RelAGCTGGTGTCTGGTTCATT GCCTCCTCTTCCATCTCT [19]
IL-8GAGGGTACATGTCTGGGGGACCTTGAAGGTTTGTTCTTCATCGTXM_038713529.1
TLR2TCGCTGTTCACCAATCTG TAGTTCTCCTCTCCATCTGT MN807054
Note: GPx, glutathione peroxidase; Nrf2, nuclear factor erythroid 2-related factor 2; RelA, V-rel avian reticuloendotheliosis viral oncogene homolog A; SOD, superoxide dismutase; CAT, catalase; IL-8, interleukin 8; Keap1, Kelch-like ECH-associated protein1; NF-κB, nuclear factor kappa B; TLR2, Toll-like receptor 2.
Table 3. Effects of CGA on the growth performance (mean ± SEM).
Table 3. Effects of CGA on the growth performance (mean ± SEM).
ParametersCGA Addition Levels
0 mg/kg60 mg/kg120 mg/kg180 mg/kg240 mg/kg
IBW (g)3.25 ± 0.013.24 ± 0.013.24 ± 0.013.24 ± 0.013.26 ± 0.01
FBW (g)21.82 ± 2.40 b25.26 ± 0.37 ab25.80 ± 1.50 ab28.10 ± 1.18 a27.60 ± 1.05 a
WGR (%)570.38 ± 75.15 b680.34 ± 12.52 ab700.29 ± 49.01 ab767.96 ± 36.88 a746.53 ± 32.95 a
SGR (%/day)3.39 ± 0.20 b3.67 ± 0.03 ab3.71 ± 0.11 ab3.86 ± 0.08 a3.81 ± 0.07 a
FCR1.46 ± 0.07 a1.31 ± 0.01 b1.20 ± 0.02 bc1.16 ± 0.02 c1.18 ± 0.05 c
Note: Data are expressed as mean ± SEM. Statistical significance of differences is indicated by distinct letters (a, b, c) on same line (p < 0.05). IBW, initial body weight. WGR (%) = × 100 (W2 (g) − W1 (g))/W1 (g). SGR (%/d) = 100 × [(Ln (W2 (g)) − Ln (W1 (g)))/days]. FCR = W3 (g)/W4 (g), where W1 is initial body weight, W2 is final body weight, W3 is dry feed fed, and W4 is wet weight gain.
Table 4. Effects of CGA on whole-body composition.
Table 4. Effects of CGA on whole-body composition.
Parameters CGA Addition Levels
0 mg/kg60 mg/kg120 mg/kg180 mg/kg240 mg/kg
Moisture (%)72.47 ± 0.2272.32 ± 0.1072.48 ± 0.2772.18 ± 0.0372.41 ± 0.12
Crude protein (%) 16.30 ± 0.2116.95 ± 0.3016.61 ± 0.0917.06 ± 0.3717.03 ± 0.44
Crude lipid (%) 7.48 ± 0.386.87 ± 0.517.40 ± 0.307.06 ± 0.197.31 ± 0.58
Ash (%) 3.80 ± 0.073.59 ± 0.023.86 ± 0.143.93 ± 0.143.82 ± 0.09
Note: Data are presented as mean ± SEM.
Table 5. Effects of CGA on plasma parameters.
Table 5. Effects of CGA on plasma parameters.
Parameters CGA Addition Levels
0 mg/kg60 mg/kg120 mg/kg180 mg/kg240 mg/kg
TC (mmol/L)8.37 ± 0.39 a7.57 ± 0.22 ab7.53 ± 0.35 ab7.04 ± 0.30 b7.85 ± 0.38 ab
TP (g/L) 33.23 ± 1.1731.69 ± 0.9831.59 ± 1.0530.68 ± 1.1833.21 ± 1.67
TG (mmol/L)7.19 ± 0.68 a7.36 ± 0.60 a6.27 ± 0.50 ab5.37 ± 0.29 b6.84 ± 0.67 ab
AST (U/L) 15.64 ± 1.1416.80 ± 3.9813.66 ± 3.2012.54 ± 2.1611.23 ± 6.41
ALT (U/L)1.73 ± 0.451.46 ± 0.371.56 ± 0.451.20 ± 0.331.34 ± 0.52
ALB (g/L) 9.98 ± 0.41 ab9.92 ± 0.40 ab9.83 ± 0.40 ab9.90 ± 0.42 b10.46 ± 0.48 a
GLU (mmol/L)5.80 ± 0.61 c5.99 ± 0.45 c5.88 ± 0.42 c8.79 ± 0.52 a7.53 ± 0.48 b
Note: Data are expressed as mean ± SEM. Statistical significance of differences is indicated by distinct letters (a, b, c) on the same line (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xia, Z.; Mi, H.; Ren, M.; Huang, D.; Aboseif, A.M.; Liang, H.; Zhang, L. Chlorogenic Acid Plays an Important Role in Improving the Growth and Antioxidant Status and Weakening the Inflammatory Response of Largemouth Bass (Micropterus salmoides). Animals 2024, 14, 2871. https://doi.org/10.3390/ani14192871

AMA Style

Xia Z, Mi H, Ren M, Huang D, Aboseif AM, Liang H, Zhang L. Chlorogenic Acid Plays an Important Role in Improving the Growth and Antioxidant Status and Weakening the Inflammatory Response of Largemouth Bass (Micropterus salmoides). Animals. 2024; 14(19):2871. https://doi.org/10.3390/ani14192871

Chicago/Turabian Style

Xia, Zetian, Haifeng Mi, Mingchun Ren, Dongyu Huang, Ahmed Mohamed Aboseif, Hualiang Liang, and Lu Zhang. 2024. "Chlorogenic Acid Plays an Important Role in Improving the Growth and Antioxidant Status and Weakening the Inflammatory Response of Largemouth Bass (Micropterus salmoides)" Animals 14, no. 19: 2871. https://doi.org/10.3390/ani14192871

APA Style

Xia, Z., Mi, H., Ren, M., Huang, D., Aboseif, A. M., Liang, H., & Zhang, L. (2024). Chlorogenic Acid Plays an Important Role in Improving the Growth and Antioxidant Status and Weakening the Inflammatory Response of Largemouth Bass (Micropterus salmoides). Animals, 14(19), 2871. https://doi.org/10.3390/ani14192871

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop