Discrimination of Spatial Distribution of Aquatic Organisms in a Coastal Ecosystem Using eDNA

Round 1

Reviewer 1 Report

In this manuscript by Hyunbin Jo et al, outline that that eDNA monitoring based on NGS holds great potential as a complementary monitoring tool to identify spatial taxonomic distribution patterns in Korean coastal areas. I found this paper interesting to read, however I’d like to request some changes. 

 

2.1 study area- statements are missing references. 

2.2. If sampling permits were required to obtain samples please mention them here. Please indicate how filters were stored between sampling and DNA extraction. I am missing information about positive and negative controls.  

2.3 Indicate if you used the whole or part of the filter for DNA extraction.

Authors mention that from all sites 1 L has been obtained. Please justify why sampling has not been performed more than once, or in higher quantities. (For example, sampling more than 1 L at the same time). 

3.2 ~160,000 NGS reads per sample seems a bit low. I’d be interested to learn if authors see similar # mentioned in the literature to give these results some context. 

Figure 2: Increase font size in A and B. It is hard to read.

Line 149: Please explain why Q30 was chosen as cutoff.  

 

Figure 3: The authors report genus-level authentification in Figure 3. Did authors attempt species- level authentification? The text in line 227 indicated that species level identification has been performed. Would it be possible to provide this data as supplementary material? Would it be possible to deposit sequencing files as supplementary information as well? 

 

225: Add traditional methods of biodiversity detection. 

229: “golden region of barcoding” replace with standard region of barcoding and cite appropriate papers to support this statement.

230  Vs 262: Authors present conflicting views regarding costing time commitment of NGS. Please update accordingly. 

Throughout the manuscript: I would find it helpful if common names for mentioned genera in text are included as well. Not every reader is familiar with marine biodiversity. For example: The dominant OTU was assigned to corals Acropora sp. and the sub-dominant OTU was copepods Acartia sp. 

I suggest authors to review and potentially include the following publications, if appropriate: 

 

Stoeckle MY, Soboleva L, Charlop-Powers Z (2017) Aquatic environmental DNA detects seasonal fish abundance and habitat preference in an urban estuary. PLoS ONE 12(4): e0175186. https://doi.org/10.1371/journal.pone.0175186

 

Valentini A, Taberlet P, Miaud C, Civade R, Herder J, Thomsen PF, et al. Next-generation monitoring of aquatic biodiversity using environmental DNA barcoding. Mol Ecol. 2016;25: 929–942. pmid:26479867

 

Kelly RP, Port JA, Yamahara KM, Crowder LB. Using environmental DNA to census marine fish in a large mesocosm. PLOS ONE. 2014;9: e86175 pmid:24454960

 

Kelly RP, Closek CJ, O’Donnell JL, Kralj JE, Shelton AO, Samhouri JF. Genetic and manual survey methods yield different and complementary views of an ecosystem. Front Marine Sci. 2017;3: 283.

 

O’Donnell JL, Kelly RP, Shelton AO, Samhouri JF, Lowell NC, Williams GD. Spatial distribution of environmental DNA in a nearshore marine habitat. Peer J. 2017; 5: e3044. pmid:28265513

 

Djurhuus A, Pitz K, Sawaya NA, Rojas-Márquez J, Michaud B, Montes E, et al. Evaluation of marine zooplankton community structure through environmental DNA metabarcoding. Limnol Oceanography: Methods. 2018;10: 1–13

 

Goldberg CS, Turner CR, Deiner K, Klymus KE, Thomsen PF, Murphy MA, et al. Critical considerations for the application of environmental DNA methods to detect aquatic species. Methods Ecol Evol. 2016;7: 1299–1307.

 

 

Author Response

Reviewer 1.

In this manuscript by Hyunbin Jo et al, outline that that eDNA monitoring based on NGS holds great potential as a complementary monitoring tool to identify spatial taxonomic distribution patterns in Korean coastal areas. I found this paper interesting to read, however I’d like to request some changes. 

--> We appreciate your kind consideration of our paper.  We tried to do our best to revise our paper according to your comments.  Changes are marked in RED.

 

2.1 study area- statements are missing references. 

--> We added references which describe our study area.  Please see the line 81.

 

2.2. If sampling permits were required to obtain samples please mention them here. Please indicate how filters were stored between sampling and DNA extraction. I am missing information about positive and negative controls.  

--> Thank you for your kind suggestion.  We added permission number (line 83) and mentioned how to filter and store the eDNA sample and information of negative controls at line 90-94. 

 

2.3 Indicate if you used the whole or part of the filter for DNA extraction.

Authors mention that from all sites 1 L has been obtained. Please justify why sampling has not been performed more than once, or in higher quantities. (For example, sampling more than 1 L at the same time). 

--> We justified protocol for obtaining eDNA sample according to your comments (line 90-92).

 

3.2 ~160,000 NGS reads per sample seems a bit low. I’d be interested to learn if authors see similar # mentioned in the literature to give these results some context. 

--> It is filtered and cleaned paired-end reads number.  We provided reference which mentioned similar amount of reads (mean 161,421) [36] at line 154.

 

Figure 2: Increase font size in A and B. It is hard to read.

--> To improve readability, we changed rotation of figure (line 168). 

 

Line 149: Please explain why Q30 was chosen as cutoff. 

--> We justified cutoff value at line 152.

 

Figure 3: The authors report genus-level authentification in Figure 3. Did authors attempt species- level authentification? The text in line 227 indicated that species level identification has been performed. Would it be possible to provide this data as supplementary material? Would it be possible to deposit sequencing files as supplementary information as well? 

--> Yes, we have a species-level identification data and provided data as supplementary information (line 227) as your suggestion.  However, we would like to explain that incompleteness of references data in Korean species and short length of sequences make limitation to identify species at species level identification.  Therefore, we used genus level identification data.  We deposited sequencing file at DRYAD entry doi:10.5061/dryad.41b1dp3.

 

225: Add traditional methods of biodiversity detection. 

--> We added traditional method of biodiversity detection at line 230.

 

229: “golden region of barcoding” replace with standard region of barcoding and cite appropriate papers to support this statement.

--> We cited appropriate paper in our paper (line 236).

 

230  Vs 262: Authors present conflicting views regarding costing time commitment of NGS. Please update accordingly. 

--> We agree with your comments and revised conflicting views in discussion (line 235-239).

 

Throughout the manuscript: I would find it helpful if common names for mentioned genera in text are included as well. Not every reader is familiar with marine biodiversity. For example: The dominant OTU was assigned to corals Acropora sp. and the sub-dominant OTU was copepods Acartia sp. 

--> Thank you for your suggestion.  We provided common names for mentioned genera throughout the paper.

 

I suggest authors to review and potentially include the following publications, if appropriate: 

--> We appreciate your kind suggested references for improving our paper.  We have reviewed all of the references you provided and included appropriate references.

Stoeckle MY, Soboleva L, Charlop-Powers Z (2017) Aquatic environmental DNA detects seasonal fish abundance and habitat preference in an urban estuary. PLoS ONE 12(4): e0175186. https://doi.org/10.1371/journal.pone.0175186

 Valentini A, Taberlet P, Miaud C, Civade R, Herder J, Thomsen PF, et al. Next-generation monitoring of aquatic biodiversity using environmental DNA barcoding. Mol Ecol. 2016;25: 929–942. pmid:26479867

 Kelly RP, Port JA, Yamahara KM, Crowder LB. Using environmental DNA to census marine fish in a large mesocosm. PLOS ONE. 2014;9: e86175 pmid:24454960

 Kelly RP, Closek CJ, O’Donnell JL, Kralj JE, Shelton AO, Samhouri JF. Genetic and manual survey methods yield different and complementary views of an ecosystem. Front Marine Sci. 2017;3: 283.

 O’Donnell JL, Kelly RP, Shelton AO, Samhouri JF, Lowell NC, Williams GD. Spatial distribution of environmental DNA in a nearshore marine habitat. Peer J. 2017; 5: e3044. pmid:28265513

 Djurhuus A, Pitz K, Sawaya NA, Rojas-Márquez J, Michaud B, Montes E, et al. Evaluation of marine zooplankton community structure through environmental DNA metabarcoding. Limnol Oceanography: Methods. 2018;10: 1–13

 Goldberg CS, Turner CR, Deiner K, Klymus KE, Thomsen PF, Murphy MA, et al. Critical considerations for the application of environmental DNA methods to detect aquatic species. Methods Ecol Evol. 2016;7: 1299–1307.

Reviewer 2 Report

The manuscript submitted focuses on a relevant and interesting theme but needs several revisions before publication, notably in terms of:

     1. Clarification on how were chosen the sample locations, along a transect or randomly, Not clearly presented in the Methodology.

      2.DNA amplification was not used, why?

      3. Please explain why 

diversity and   species richness       4.Shannon diversity and species richness was calculated? If yes ho

Additional comment

    The Conclusions need to be rewritten to highlight two key points emerging from the article viz.,

- Why improved biodiversity monitoring programs are crucial for maintaining the integrity of casual marine ecosystems. How by evaluating the potential of eDNA to identify species and understanding the dynamics of eDNA distribution in coastal environments are both timely and important goals for improving biodiversity monitoring in Korea

Improved biodiversity monitoring programs are  crucial    for  main -taining the   integrity of  coastal marine ecosystems. Evaluating the potential of  eDNA     to  identify Arctic    species and   understanding the dynamics of  eDNA distribution in  coastal environments are   both timely     and   important  goals    for   improving  biodiversity  monitor-ingImproved biodiversity monitoring programs are  crucial    for  main -taining the   integrity of  coastal marine ecosystems. Evaluating the potential of  eDNA     to  identify Arctic    species and   understanding the dynamics of  eDNA distribution in  coastal environments are   both timely     and   important  goals    for   improving  biodiversity  monitor-ing

The authors should add Data Accessibility statement

Author Response

Reviewer 2.

The manuscript submitted focuses on a relevant and interesting theme but needs several revisions before publication,

--> We appreciate your positive consideration of our paper.  We tried to do our best to revise our paper according to your comments.  Changes are marked in RED.

 

notably in terms of:

Clarification on how were chosen the sample locations, along a transect or randomly, Not clearly presented in the Methodology.

--> We mentioned reasons for chosen the sampling location throughout the introduction (line 52-62) and the method part (line 71-81).  We followed methodology for sampling by Kim et al (2019; reference number [25]).  Please see the [25].

 

DNA amplification was not used, why? Please explain why 

--> We revised PCR protocol.  The primer sequences are as follows: 18S V9 primer including adaptor sequence (Forward Primer: 5' TCGTCGGCAGCGTCAGATGTGTATAA GAGACAGCCCTGCCHTTTGTACACAC 3' / Reverse Primer: 5' GTCTCGTGGGCTCGGAGATG TGTATAAGAGACAGCCTTCYGCAGGTTCACCTAC 3'). To amplify the target region attached with adapters, as a first PCR process, the extracted DNA was amplified by 18S V9 primers with one cycle of 3 minutes at 95°C, 25 cycles of 30 seconds at 95°C, 30 seconds at 55°C, 30 seconds at 72°C, and a final step of 5 minutes at 72°C for amplicon PCR product. As a second process, to produce indexing PCR, the first PCR product was subsequently amplified with one cycle of 3 minutes at 95°C, 8 cycles of 30 seconds at 95°C, 30 seconds at 55°C, 30 seconds at 72°C, and a final step of 5 minutes at 72°C.

 

Shannon diversity and species richness was calculated? If yes ho

--> We used a-diversity (number of species) and transformed species data according to habitat types, trophic level, and indigenous rate which have valuable ecological information instead of Shannon diversity and species richness.

 

Additional comment

- The Conclusions need to be rewritten to highlight two key points emerging from the article viz.,

- Why improved biodiversity monitoring programs are crucial for maintaining the integrity of casual marine ecosystems. How by evaluating the potential of eDNA to identify species and understanding the dynamics of eDNA distribution in coastal environments are both timely and important goals for improving biodiversity monitoring in Korea

--> We highlighted improving biodiversity monitoring capacity (line 218-222) and holding great potential for supplementary monitoring tool such as detection (line 223) of non-indigenous species based on eDNA approach at the discussion part.

 

- The authors should add Data Accessibility statement

--> We stored data as supplementary information (DRYAD entry doi:10.5061/dryad.41b1dp3) as you suggestion.

Round 2

Reviewer 1 Report

Dear Hyunbin Jo et al., I highly appreciate the modification of the manuscript. 

Some more minor points below:

2.2. I assume “deep freighter” is a typo. It’s fine to just mention samples were stored at -80C.

Line 93: I suggest to modify the sentence in Line 93-94 to be more clear, such as “Negative controls were included for every study site.”

2.3 Thanks for expanding this section by including primer sequences and a description of the PCR process. Please clarify if lines 123-125 and 125-126 describe the same process? If yes, please shorten this section to mention indexing only once.  

Line 233: I have pointed this out in my previous review - Line 235: Please replace “ golden region of barcoding” with a more appropriate term.                                                                                                 When searching for the newly added DRYAD entry the search did not return any results. Please verify if the included doi link is correct. DRYAD entry doi:10.5061/dryad.41b1dp3

Author Response

Reviewer 1.

Dear Hyunbin Jo et al., I highly appreciate the modification of the manuscript.

--> We appreciate your kind and positive comments for improving our paper. Changes are marked in RED.

 

Some more minor points below:

2.2. I assume “deep freighter” is a typo. It’s fine to just mention samples were stored at -80C.

--> We changed expression. Please see the line 93.

Line 93: I suggest to modify the sentence in Line 93-94 to be more clear, such as “Negative controls were included for every study site.”

--> We changed sentences according to your suggestion (line 93-94).

2.3 Thanks for expanding this section by including primer sequences and a description of the PCR process. Please clarify if lines 123-125 and 125-126 describe the same process? If yes, please shorten this section to mention indexing only once.

--> Thank you for your kind suggestion. We deleted repeated sentences at line 125-126.

Line 233: I have pointed this out in my previous review - Line 235: Please replace “ golden region of barcoding” with a more appropriate term.                                                                                                

--> We changed sentence according to your suggestion (line 234-235).

When searching for the newly added DRYAD entry the search did not return any results. Please verify if the included doi link is correct. DRYAD entry doi:10.5061/dryad.41b1dp3

--> According to policy of DRYAD, doi link will be available after the publication appears. Please see the link for the review (https://datadryad.org/review?doi=doi:10.5061/dryad.41b1dp3)

Author Response File: Author Response.docx