Next Article in Journal
The Choice of the Most Appropriate Suture Threads for Pancreatic Anastomoses on the Basis of Their Mechanical Characteristics
Next Article in Special Issue
Loss of the Novel Mitochondrial Membrane Protein FAM210B Is Associated with Hepatocellular Carcinoma
Previous Article in Journal
Plant-Derived Exosome-like Nanoparticles for Biomedical Applications and Regenerative Therapy
Previous Article in Special Issue
Adding MRI as a Surveillance Test for Hepatocellular Carcinoma in Patients with Liver Cirrhosis Can Improve Prognosis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomedicines
Volume 11
Issue 4
10.3390/biomedicines11041054
biomedicines-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Streptomyces Bioactive Metabolites Prevent Liver Cancer through Apoptosis, Inhibiting Oxidative Stress and Inflammatory Markers in Diethylnitrosamine-Induced Hepatocellular Carcinoma

by
Sana M. Alhawsawi
1,†,
Mohamed Mohany
2,†,
Almohannad A. Baabbad
1,
Nawaf D. Almoutiri
1,
Saleh N. Maodaa
1,
Esam M. Al-shaebi
1,
Khadijah N. Yaseen
1,
Mohammed A. M. Wadaan
1 and
Wael N. Hozzein
1,*
1
Department of Zoology, College of Science, King Saud University, P.O. Box 55760, Riyadh 11451, Saudi Arabia
2
Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, P.O. Box 55760, Riyadh 11451, Saudi Arabia
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Biomedicines 2023, 11(4), 1054; https://doi.org/10.3390/biomedicines11041054
Submission received: 14 February 2023 / Revised: 5 March 2023 / Accepted: 9 March 2023 / Published: 29 March 2023
(This article belongs to the Special Issue Diagnosis, Pathogenesis and Treatment of Liver Disease)
Browse Figures
Versions Notes

Abstract

:
A safe and effective treatment for liver cancer is still elusive despite all attempts. Biomolecules produced from natural products and their derivatives are potential sources of new anticancer medications. This study aimed to investigate the anticancer potential of a Streptomyces sp. bacterial extract against diethylnitrosamine (DEN)–induced liver cancer in Swiss albino mice and explore the underlying cellular and molecular mechanisms. The ethyl acetate extract of a Streptomyces sp. was screened for its potential anticancer activities against HepG-2 using the MTT assay, and the IC50 was also determined. Gas chromatography–mass spectrometric analysis was used to identify the chemical constituents of the Streptomyces extract. Mice were administered DEN at the age of 2 weeks, and from week 32 until week 36 (4 weeks), they received two doses of Streptomyces extract (25 and 50 mg/kg body weight) orally daily. The Streptomyces extract contains 29 different compounds, according to the GC-MS analysis. The rate of HepG-2 growth was dramatically reduced by the Streptomyces extract. In the mice model. Streptomyces extract considerably lessened the negative effects of DEN on liver functions at both doses. Alpha-fetoprotein (AFP) levels were significantly (p < 0.001) decreased, and P53 mRNA expression was increased, both of which were signs that Streptomyces extract was suppressing carcinogenesis. This anticancer effect was also supported by histological analysis. Streptomyces extract therapy additionally stopped DEN-induced alterations in hepatic oxidative stress and enhanced antioxidant activity. Additionally, Streptomyces extract reduced DEN-induced inflammation, as shown by the decline in interleukin-1 beta (IL-1β) and tumor necrosis factor-alpha (TNF-α) levels. Additionally, the Streptomyces extract administration dramatically boosted Bax and caspase-3 levels while decreasing Bcl-2 expressions in the liver according to the Immunohistochemistry examination. In summary, Streptomyces extract is reported here as a potent chemopreventive agent against hepatocellular carcinoma through multiple mechanisms, including inhibiting oxidative stress, cell apoptosis, and inflammation.

1. Introduction

Liver cancer is one of the most serious health problems now affecting the world. It is the second-most lethal type of cancer in the world, with a male-to-female ratio of 2.4:1.1 [1]. Hepatocellular carcinoma (HCC) accounts for around 90% of primary liver cancer [2]. HCC is a malignancy brought on by inflammation that results in a malignant neoplasm of the hepatocytes [3]. Hepatitis B virus (HBV), hepatitis C virus (HCV), frequent alcohol use, and non-alcoholic fatty liver disease are a few of the factors that might lead to the development of HCC [4]. Hepatic fibrosis in its advanced stages, smoking, inorganic arsenic in drinking water, aflatoxins, and iron buildup are all known key risk factors for the development of HCC as well [5].
Experimental mice models are being utilized more frequently in HCC studies to investigate the pathogenesis of the illness and to evaluate potential new treatments [6]. Diethylnitrosamine (DEN) is the most often used chemical to generate liver cancer in mice and has been used in the bulk of preclinical studies for some years [7]. When injected into young mice, DEN targets the liver, where it is biologically transformed into alkylating agents that can create mutagenic DNA adducts by centrilobular hepatocytes [8]. Additionally, there is proof that inflammation plays a role in the development of hepatocarcinogenesis brought on by DEN [9]. In addition to being a genotoxic substance, DEN is also hepatotoxic and causes necrotic cell death. This damage sets off an inflammatory response that increases the expression of mitogens such as interleukin-6 (IL-6), which encourages the proliferation of remaining hepatocytes as a form of reparative action [10].
Apoptosis is mediated by intrinsic and extrinsic signaling pathways, which can be triggered by a range of events, including cellular stress and DNA damage [11]. Apoptosis is dysregulated in several illnesses, including cancer, and the equilibrium between prosurvival and proapoptotic proteins regulates this process [12]. Uncontrolled, aberrant cell proliferation is a defining feature of cancer. Evasion of apoptosis is one of the characteristics of malignancies that promote tumor development and progression in addition to unchecked cell proliferation. The majority of anticancer medications work by directly triggering the apoptotic pathways in cancerous cells. Chemotherapeutic drugs such as Sorafenib are the most popular HCC treatments that have been developed over many years [13]. Chemotherapeutic drugs, however, typically target cancer rather than a particular type and frequently show a wide range of toxicities, either systemic and/or neural [14]. Therefore, a better therapeutic option or drug must be developed that specifically targets and inhibits the tumor-specific pathways in HCC. Natural products or their derivatives have drawn more attention in the treatment of cancer than other groups of anticancer medicines since they are abundant in nature and have little to no side effects.
Members of the genus Streptomyces, which belongs to the Streptomycetaceae family of the Actinobacteria (a group of Gram-positive bacteria), can produce several medicinal chemicals, including antibiotics, as well as the novel, naturally occurring secondary metabolites [15], with antitumor antioxidants, antibacterial, antifungal, antimicrobial, anti-hyperglycemic, anti-inflammatory, immunosuppressive activities [16]. According to allegations that Streptomyces species are no longer a significant biological source for new antibiotics, the rediscovery of known secondary metabolites from Streptomyces species has diverted scientists’ attention to the identification of uncommon actinobacteria for discovering new drugs. Streptomyces sp. is previously known to produce a variety of bioactive compounds with anticancer and antitumor characteristics, especially against human lung cancer [17], colorectal cancer [18], and prostate cancer [19]. These compounds showed cytotoxicity against malignant cells but did not harm healthy cells. To our knowledge, there is no information on the anticancer activity of a strain of Streptomyces sp. isolated from a habitat in Saudi Arabia against liver cancer. Therefore, the main goal of this study was to find a promising strategy to treat HCC using natural extract derived from Streptomyces isolated from the Saudi soil habitats and explore the underlying cellular and molecular mechanisms with focusing on the role of oxidative stress, inflammation and cell apoptosis.

2. Materials and Methods

2.1. Preparation of the Bacterial Extract

The pure Streptomyces strain, which was kindly provided by Prof. Wael N. Hozzein, was cultured in yeast extract-malt extract broth (ISP2) [20] and then incubated at 30 °C and 150 rpm for 2 days. Twenty 500 mL-conical flasks, each one containing 100 mL of starch casein broth [21], were then inoculated with 5 mL of the previously prepared inoculum. The flasks were incubated at 30 °C and 150 rpm for 5 days in a shaking incubator. After incubation, ethyl acetate was used for extraction of the metabolites produced by the Streptomyces strain under study.

2.2. Gas Chromatography–Mass Spectrometry (GC-MS) Analysis for the Chemical Constituents of the Streptomyces Extract

The identification of the chemical composition of Streptomyces extract was determined by a coupled Agilent Technologies 7890B GC System combined with Agilent Technologies 5977A MSD. Streptomyces extract was dissolved in ethyl acetate; the GC-MS was performed on: DB- 5 ms column (30 m × 0.32 mm × 0.25 µm), He carrier gas, the column head pressure was 10 psi, the oven temperature was sustained initially at 50 °C for 1 min, and then the programmed temperature was raised at a rate of 5 °C/min from 50 to 280 °C. In the end, the temperature was kept at 280 °C for 10 min. The analysis for each chemical compound was based on its retention time relative to those of authentic samples and matching spectral peaks available with the published data.

2.3. Determination of Cell Viability by MTT Assay

The anticancer activities of the natural Streptomyces sp. extract were investigated against HepG-2 (DSM ACC-180), the human hepatocellular carcinoma cancer cell line using the MTT method. The HepG-2 cancer cell line was cultivated and propagated on DMEM high glucose medium supplemented with 10% FBS and 1% penicillin-streptomycin. Cells were seeded into 96-well cell culture plates at a density of 10 × 10⁴ cells per well in 200 µL aliquots of the medium. The untreated cells served as the control. The cells were grown in a 5% CO2 incubator at 37 °C and 90% relative humidity. Cells were treated with Streptomyces sp. extract for 24 h at a concentration of 1 mg/mL dissolved in methanol. The serial dilutions of the extract were tested in triplicates at different concentrations (0, 0.125, 0.25, 0.5, and 1 mg/mL) (Nemati et al., 2013). Then, cell viability was evaluated by the cytotoxicity MTT assay. After 24 h, 20 µL MTT reagent was added for 2 h, as described by Oka et al. (1992). The MTT test is based on the reduction of the MTT reagent (3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide) by living cell dehydrogenases to the violet formazan product, and 200 µL/well of 1X isopropanol-HCL was added after the MTT reagent. The absorbance was measured at 595 nm using a microplate reader (Zenyth 200 ST, Biochrom, UK), and the inhibition of cell growth was calculated. The results have also been plotted to give the cytotoxicity activity curve for each extract, and the LC50 was calculated.
Cell viability was calculated using the following equation [22]:
Cell viability (%) = (O.D of treated sample)/(O.D of untreated sample) × 100%

2.4. Animals and Chemicals

Pregnant female Swiss albino mice were obtained from the Animal House, Zoology Department, College of Science, King Saud University. Animals were housed in stainless steel wire cages under pathogen-free conditions. Before the experiment, all mice were given 7 days to acclimate in polycarbonate cages in a well-ventilated environment. Standard laboratory settings (temperature of 23–24 °C, relative humidity of 50–60%, and a 12-h light/dark cycle) were used to sustain the animals, and they were provided with food and water ad libitum. DEN was purchased from Sigma-Aldrich, CAS No. 55-18-5 (St Louis, MO, USA).

2.5. General Experimental Procedures

A total of 60 male mice, obtained by mating male and female, were given an intraperitoneal (I.P.) injection of 25 mg kg−1 diethylnitrosamine (DEN) at the age of 2 weeks, as previously reported [23], and about 30 weeks later, liver tumors appeared. The mice were then left with their mothers to finish the nursing period. Each set of pups during nursing is assigned a distinct color for their tails to help with organizing. The females were not included once they reached the age of 4 weeks. Because the male gender is a risk factor for human HCC, male mice were used in the current study [24]. At 6 weeks old, mice were randomly assigned to 6 groups based on weight. In each group, there are 10 mice. Once every week, mice were weighed. These were the experimental groups: Group 1 served as the negative control group, receiving 25 mg kg−1 b.w. of normal saline orally for 4 weeks. Group 2 received 25 mg kg−1 b.w. of low Streptomyces sp. extract concentration orally for 4 weeks. Group 3 received 50 mg/kg b.w. of high Streptomyces sp. extract concentration orally for 4 weeks. Group 4: positive control group received only a single I.P. dose of DEN (25 mg/kg b.w) at 2 weeks of age. Group 5: mice received a single I.P. dose of DEN at the age of 2 weeks and the low Streptomyces sp. extract dose (25 mg/kg b.w.) orally for 4 weeks. Group 6: mice received a single I.P. dose of DEN at the age of 2 weeks and the high Streptomyces sp. extract dose (50 mg/kg b.w.) orally for 4 weeks. All of the mice in groups 4, 5 and 6 received a single i.p. injection of DEN (25 mg/kg body weight) at 2 weeks of age. This concentration of Streptomyces sp. was established by prior publications [25], and treatment with the extract of Streptomyces sp. started in week 32 and lasted for 4 weeks until week 36.

2.6. The Toxicity Test for the Natural Extract

Ten mice were given varied concentrations of the extract, ranging from 25 mg/kg body weight to 100 mg/kg body weight, to determine the toxicity of the extract. The toxic symptoms and mortality were noted during the course of the next 7 days.

2.7. Sampling and Biochemical Analysis

After the 36th week, 10% ketamine (Hikma Pharmaceuticals, Jordan, 100 mg/kg) and 2% xylazine (Laboratories Calier, Spain, 10 mg/kg) were combined intraperitoneally to anesthetize all the animals. The blood was collected from the jugular vein, then allowed to coagulate at room temperature, and centrifuged at 3000 rpm for 30 min. The serum was quickly removed and stored at −20 °C for subsequent biochemical analyses. After dissection of the animals, the liver tissues were immediately excised, washed in saline, and fixed in 10% neutral buffer formalin for histopathological examination. Liver samples were homogenized in phosphate-buffered saline (PBS) solution and centrifuged at 3000 rpm for 10 min, and the clear supernatants were kept in a deep freezer at −20 °C for further analyses. The remaining liver tissues were stored at −80 °C. The biochemical investigations, oxidative stress, and antioxidant markers in hepatic tissues were assessed using the Jenway 6300 spectrophotometer. Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were determined using commercial kits (Bio diagnostics, Egypt, CAT No. AL 10 31 (45), 10 61 (45), respectively).

2.8. Oxidative Stress and Antioxidant Markers in Liver Homogenate

As per the manufacturer’s instructions, Bradford reagent was used to calculate the total protein in each liver sample. Malondialdehyde (MDA), which is produced as a byproduct of lipid peroxidation, is a measurement of the degree of oxidative stress. Using biodiagnostic kits, and diagnostic and research reagents, in Egypt, we assessed the hepatic tissue contents of GSH (CAT No. GR 25 11), malondialdehyde (MDA, CAT No. MD 25 29), GST (CAT No. GT 25 19), and GPx (CAT No. GP 25 24) in liver homogenate according to the manufacturer’s guidelines.

2.9. Analysis of Gene Expression: Quantitative PCR (RT-qPCR)

Total RNA was extracted from the liver harvested using TRizol® Reagent (Invitrogen, Paisley, UK) according to standard procedures. The quality and quantity of the purified RNA were determined by a Qubit® 2.0 fluorometer using the Qubit RNA assay kit. To eliminate any contaminating genomic DNA, a gDNA wipeout reaction was undertaken in a wipeout buffer at 42 °C for 2 min. CDNA was synthesized from total RNA using the QuantiTect Reverse Transcription Kit (QIAGEN, QuantiTect®, Germany), according to the manufacturer’s instructions. Gene expression of target genes (AFP, IL-1β, TNF-α, and P53) was determined by QuantiTect SYBER-GREEN PCR kit (QIAGEN, Germany). Amplification reactions of the target genes were performed in 96-well plates containing SYBR® Green Master Mix (QIAGEN, Germany), cDNA, and the specific oligonucleotide primers shown in Table 1. Expression was normalized to GAPDH gene expression, which was used as an internal housekeeping control. Raw data were analyzed using the Rotor-Gene cycler software version 2.3 to calculate the threshold cycle using the second derivative maximum. The obtained data were analyzed using the 2−∆∆Ct method.

2.10. Histopathological Investigations

Harvested liver tissues were promptly fixed in 10% neutral buffer formalin in PBS, followed by a wash in PBS, a series of alcohol dehydration, and fresh paraffin embedding. Microtome slices (5 µm thick) were prepared by cutting them, soaking them in warm distilled water (~40 °C), then picking them up on slides of glass. The slides were stained with hematoxylin and eosin after being incubated on a vertical rack for a whole night at 62 °C. At 100× magnification, slides were captured on a high-resolution digital camera and examined by an experienced pathologist using a light microscope, the Nikon Eclipse E600. To evaluate the degree of liver injury, an injury grading score (Grade 0–4) based on the severity of lesions in the liver parenchyma was carried out, as previously reported [26].

2.11. Immunohistochemistry Procedure of Paraffin Sections

Immunohistochemistry was carried out on formalin-fixed, 3 µm paraffin-embedded liver sections mounted on positively charged slides using the avidin-biotin-peroxidase complex (ABC) technique. Sections were treated with the anti-caspase-3 rabbit pAb antibody, ABclonal Cat# A11953; the anti-Bcl-2 rabbit polyclonal antibody, ABclonal Cat# A16776; and the anti-Bax rabbit polyclonal antibody, Bioss ANTIBDIES Cat# bs-0127R after blocking for 30 min with Rodent Block M. The previously indicated antibodies were applied to the sections of each group before the ABC technique reagents (Vectastain ABC-HRP kit, Vector labs) were added. Marker expression was peroxidase-labeled and diaminobenzidine-colored to detect antigen-antibody complexes (DAB, manufactured by Sigma). Slides were mounted with Eukitt® mounting media and counterstained with Mayer’s hematoxylin. By leaving out the primary antibody on neighboring sections, negative controls were obtained. Light microscopy was used to examine the sections with a Leica microscope (CH9435 Hee56rbrugg) (Leica Microsystems, Switzerland). For each section, at least 20 separate, non-overlapping fields were looked at. The area % of immunohistochemically positive structures was quantified using ImageJ (NIH, Bethesda, MD, USA).

2.12. Statistical Analysis

The data were presented as means ± standard error of the mean (SEM). To determine statistical significance among the experimental groups using GraphPad 8, a one-way ANOVA followed by a Tukey’s test was used. A p-value less than 0.05 was considered statistically significant.

3. Results

3.1. Gas Chromatography–Mass Spectrometry (GC–MS) Analysis of Streptomyces sp. (A16) Extract

By using GC-MS analysis, the chemical composition of the extract of Streptomyces sp. (A16) was identified. The data demonstrate the presence of 29 chemical components. Table 2 and Figure 1 show the concentrations of the primary constituents greater than 1% of the total composition. The chemicals’ mass spectra were analyzed and identified by comparison with the standard library data sources.

3.2. Antiproliferative Effects of Streptomyces sp. (A16) HepG2 Cells Viability

By using the MTT test, the aqueous methanol extract of Streptomyces sp. (A16) was evaluated for its ability to suppress the growth of HpG2 human liver cancer cell lines. The anti-proliferation impact of the microbial extract was demonstrated by the MTT test findings. The experiment was run three more times at different doses (0, 2.5, 5, 10, 15, 20, 25 g/mg). For 24 h, the Streptomyces sp. (A16) extract was incubated with the HpG2 cell line. (Figure 2) The control groups are represented by 0 g/mg (only methanol was added to the HpG2 cell line). The IC50 values (9.3 g/mL) for Streptomyces sp. (A16) extract on HpG2 human cell lines provide evidence of its effects.

3.3. Acute Toxicity Test

Within 24 h of the extract’s oral treatment, no dead mice were seen. No toxicity sign effects, such as paw licking, hair erection, decrease in feeding activity, and an increase in respiration rate, were observed in the mice’s behavior. At a dosage of 60 mg/kg body weight, Streptomyces extract started to show signs of toxicity.

3.4. The Impact of Streptomyces sp. (A16) Extract on the Architecture, Weight, and Serum AST and ALT Levels of the Liver Tissues in DEN-Induced Hepatocarcinogenesis

The formation of HCC was investigated using macro-alterations in the liver tissues. The liver tissue of the normal control group revealed no clear macroscopic alterations (Figure 3A), but six months later, the DEN-treated group exhibited gray nodules of variable sizes, which was a sign of the development of HCC. Small quantities and different sizes of nodules were displayed (Figure 3C). However, the same group experienced an increase in tumor size and number nine months later. Nine months following the injection of DEN, the group showed clear signs of liver enlargement, cirrhosis, and unequally sized gray and white cancer nodules (Figure 3D).
The average final body weight of mice, including their liver weight, is shown in Table 2. The body weight of the mice group that received only DEN was significantly decreased in comparison to the normal control group (41 ± 0.9 vs. 44.4 ± 1.6, p < 0.001). In comparison to the mice group that received only DEN, mice treated with either DEN + A16 (L) or DEN + A16 (H) Streptomyces sp. had significantly (p < 0.01 or p < 0.001, respectively) higher body weights. Additionally, the liver weight of the mice that received only DEN was significantly higher than the liver weight of the normal control group (3.3 ± 0.08 vs. 2.3 ± 0.06, p < 0.01). The average liver weight was significantly lower in the mice group given either a low dose of 25 mg/kg b.w. of Streptomyces sp. extract or a high dose of 50 mg/kg b.w. of Streptomyces sp. extract (p < 0.01 or p < 0.001, respectively) after receiving DEN injections. There were no adverse effects of Streptomyces sp. extract (A16) on mice body and liver weight in groups that received the bacterial extract only.
ALT and AST blood tests are usually used in the laboratory as sensitive parameters to examine the presence of a liver injury. In the current study, we investigated the effects of Streptomyces sp. (A16) extract, which was administrated orally for 4 weeks, on the activities of ALT and AST in mice (Table 3). A significant increase in ALT (37.35 ± 0.5 U/L vs. 125.5 ± 1.5 U/L, p < 0.001) and AST (106.4 ± 1.11 U/L vs. 227.9 ± 5.74 U/L, p < 0.001) activities was detected in mice that received only intraperitoneal administration of DEN compared to the normal control group. In comparison to mice in the group that received only DEN, a significant reduction (p < 0.001) in ALT and AST levels was observed in the group that received (DEN+ A16 (L) and (DEN + A16 (H) doses of Streptomyces sp. (A16) extract. The levels of ALT in groups (DEN+ A16 (L) and (DEN + A16 (H) were 48.76 ± 0.53 and 41.00 ± 1.11 U/L, respectively, whereas AST values in these two groups were 116.7 ± 0.88 and 109.0 ± 2.17 U/L, respectively.

3.5. Effects of Streptomyces sp. Extract on Oxidative Stress and Antioxidant Defense Markers in DEN-Treated Mice

Hepatic oxidative stress was observed in DEN-treated mice, which was related to higher levels of TBARs than in control mice (DEN, 12.9 nmol/mg vs. Control, 9.8 nmol/mg; p < 0.01). On the other hand, after 4 weeks of treatment with a high dose of Streptomyces sp. (A16) extract, the elevated TBARs levels brought on by the DEN injection were markedly reduced (DEN+ A16 (H), 9.9 nmol/mg vs. DEN, 12.9 nmol/mg; p < 0.01) compared with DEN-treated mice (Figure 4A). Additionally, it was shown that the mice treated with DEN had significantly (p < 0.001) lower levels of GST, GPx, and GSH than the mice in the normal control group. Treatment with both dosages of Streptomyces sp. (A16) extract significantly decreased (p < 0.05, p < 0.001) the effects of the DEN injection on GST, GPx, and GSH levels, with DEN + A16 (H) being more efficient than DEN + A16 (L) in enhancing antioxidant parameters (Figure 4B–D).

3.6. Effects of Streptomyces sp.(A16) Extract on mRNA Expressions of AFP, IL-1β, TNF-α and P53 in DEN-Induced Hepatocarcinogenesis

All experimental groups’ liver tissues underwent gene expression analysis using qPCR to measure the levels of AFP, TNF-α, IL-1β, and P53 expressions, and values were standardized to the mRNA expression of hepatic GAPDH (Figure 5). Data on the expression of earlier genes in mice treated exclusively at 2 weeks of age with DEN showed a significant up-regulation (p < 0.001) compared to untreated control mice.
In DEN-treated mice, the expression of AFP was significantly higher by 4.4-fold compared to the normal control group (4.886 ± 0.53 vs. 0.9767 ± 0.07, p < 0.001). The expression level of AFP was significantly (p < 0.001) down-regulated in the mice treated with low or high doses of Streptomyces sp. (A16) extract and DEN by 3.5-fold and 1.5-fold respectively, compared to the group that received DEN only, and the high dose of Streptomyces sp. (A16) extract was more effective (p < 0.001) than the low dose of Streptomyces sp. (A16) extract in reducing AFP expression. Similarly, the expression level of IL-1β was elevated (p < 0.001) by 5.6-fold in the DEN-treated group compared to the control group, while these expressions were reduced 4.5-fold and 1.7-fold in the groups treated with low or high doses of Streptomyces sp. (A16) extract compared to the group that received DEN alone (Figure 5B). The expression level of TNF-α was also higher by 3.5-fold in DEN-treated mice compared to the control group (DEN, 3.58 ± 0.17 vs. control, 0.94 ± 0.03, p < 0.001) (Figure 5C). In contrast, TNF-α expression was significantly reduced in mice treated with low or high doses of Streptomyces sp. (A16) extract (1.6-fold and 0.8-fold, respectively) compared to the group that received DEN alone. The fold of gene expression change in the P53 gene was significantly lower by 6.1 (p < 0.001) in DEN-treated mice compared to the control group, while the P53 expression level was significantly augmented (p < 0.001) in groups treated with low or high doses of Streptomyces sp. (A16) extract, respectively (Figure 5D).

3.7. Effects of Streptomyces sp.(A16) Extract on Pathological Changes in DEN-Induced Hepatocarcinogenesis

All sections of mice livers were stained with hematoxylin and eosin (H&E) for histopathological examination to study the effect of oral administration of Streptomyces sp. (A16) extract for 4 weeks after receiving a single I.P. DEN injection (Figure 6). The section of liver tissue of the normal control mice showed the normal appearance of hepatic lobules. The hepatocytes were arranged radiating outward from a central vein. Sinusoid capillaries separatie the plates of hepatocytes. Kupffer cells are located adjacent to the liver sinusoids (Figure 6A). Mice that received solely Streptomyces sp. (A16) extract at low doses of 25 mg/kg b.w. and high dosages of 50 mg/kg b.w. were found to have a similar normal liver architecture in sections. The extract has no negative effects on the liver tissues (Figure 6B,C). The liver sections of the DEN-treated group showed abnormal liver tissue characteristics, such as loss of hepatic lobule architecture, inflammation, necrosis, apoptosis, fatty change (steatosis), variable nuclei size, loss of cell membrane, and absence of hepatic sinusoids capillaries. Hyaline altered in addition to the Kupffer cells, showing signs of hyperplasia. Lastly, it has been demonstrated that connective tissue can be ruptured (Figure 7D). Co-administration of low or high doses of Streptomyces sp. (A16) extract after DEN injection attenuated these histopathological changes (Figure 6E,F). The reduction in severe liver lesions in the group treated with a low dose of Streptomyces sp. (A16) extract was observed. In the mice sections of the group of DEN + high dose of the Streptomyces sp. (A16) extract, distortion of hepatocytes was reduced as well as rejuvenation of hepatic architecture. Less fatty change, the least pleomorphism, and re-establishment of hepatocyte morphology have been recorded in comparison to the HCC control group. These histological alterations were lessened by co-administration of low or high doses of Streptomyces sp. (A16) extract following DEN injection (Figure 6E,F). It was noticed that the group given a low dose of Streptomyces sp. (A16) extract had fewer serious liver lesions. The deformation of the hepatocytes as well as the regeneration of the hepatic architecture were reduced in the mouse sections of the group of DEN + high dose of the Streptomyces sp. (A16) extract. In comparison to the HCC control group, less fatty alteration, less pleomorphism, and re-establishment of hepatocyte morphology have been observed. The semiquantitative histological analysis findings showed that the liver slides from the DEN-treated group had significantly (p < 0.001) more damage than those from the healthy control group. Intriguingly, most of the hepatic histological changes brought on by DEN injection were significantly attenuated (p < 0.001) in the treated groups after 4 weeks of treatment with low or high doses of Streptomyces sp. (A16) extract. Treatment with the high dose of Streptomyces sp. (A16) extract was more effective in reducing the induced hepatic lesions (Figure 6G).

3.8. Immunohistochemical Analysis of Bcl2, Bax, and Caspase-3 after Streptomyces sp.(A16) Extract Treatment of DEN-Induced Hepatocarcinogenesis

We conducted an immunohistochemistry study for the apoptosis markers to clarify the potential proapoptotic effect of the Streptomyces sp.(A16) extract. According to the immunohistochemical analysis in the present study, caspase-3 expression in DEN-treated mice significantly decreased (p < 0.05) and was significantly augmented by Streptomyces sp.(A16) extract in a dose-dependent manner, demonstrating the capacity of Streptomyces sp.(A16) to induce apoptosis of cancers liver cells (Figure 7). The expression of Bax in the hepatic tissue of mice treated with DEN decreased significantly (p < 0.05) when compared to samples from control animals. These modifications were dramatically increased (p < 0.001) by administering low or high dosages of Streptomyces sp. (A16) extract, which led to positive foci Bax responses. Higher positive cells in Bax expression were seen in DEN-treated mice treated with high doses of Streptomyces sp. (A16) extract compared to animals treated with low doses of Streptomyces sp. (A16) extract (p < 0.01) (Figure 8).
On the other hand, hepatic sections from the DEN-treated group showed considerably more Bcl-2 expression than those from control animals (p < 0.001). Although the expression of Bcl-2 was significantly reduced following treatment with low or high doses of Streptomyces sp. (A16) extract (p < 0.05, p < 0.001, respectively), the high dose effect of Streptomyces sp. (A16) was superior to that of the low-dose treatment (p < 0.05) (Figure 9). The current immunohistochemistry data indicate that Streptomyces sp. (A16) extract could cause malignant liver cells to undergo apoptosis.

4. Discussion

This study aimed to identify a promising method for treating HCC by using newly isolated actinobacteria from Saudi soil habitats. We used HepG2 cell lines, which are frequently used as human HCC lines, to further analyze the anti-HCC properties of Streptomyces sp. (A16) extract. Streptomyces sp. (A16) extract suppressed the growth of the HepG2 cell line, as demonstrated by the MTT assay results, demonstrating a broad spectrum of Streptomyces sp. (A16) extract inhibitory effects on human HCC cell growth, as previously reported [27,28]. As a result of these results, we decided to test Streptomyces sp. (A16) extract on an HCC animal model.
In the present study, we found that the body weight of the mice group that received only DEN decreased significantly in comparison to the normal control group. According to earlier research, liver malignancy leads to a reduction in the body, and some of the solid cancer characteristics cause obligatory weight loss [29]. Regarding increasing the relative liver weight in cancer, the group that only received DEN in the current study had a higher liver weight than the other groups. A rise in the amount of water in the liver may be the cause of the increased liver weight. An increase in passive reserve materials, such as fat and glycogen, is thought to reflect the work the organ has performed. Therefore, an increase in liver weight could result from the identical activity being undertaken in this organ [30]. Additionally, the injection of DEN into mice in the current study at the age of two weeks resulted in hepatic injury and, as a result, changes in liver functions, as seen by the elevated levels of AST and ALT. Increased serum levels of AST and ALT in response to DEN treatment have been shown in numerous investigations [31,32]; these effects, which are linked to the development of HCC, may have been caused by leakage from damaged or necrotic cells as well as rising cell membranes permeability. Liver function indices significantly improved when Streptomyces sp. (A16) extract was administered to DEN-treated mice. The antioxidant content of the extract used in these treatments may be the cause of their hepatoprotective benefits.
Oxidative stress can damage DNA or alter protein expression, which can result in a variety of illnesses, including cancer. Because oxidative stress increases oxidative damage to DNA in the hepatocytes, it may be one of the risk factors for the development of HCC [33]. According to our findings, DEN-treated animals produced more hepatic TBARs and had lower levels of GPx, GST, and GSH, which indicated a degree of cell damage and an overt oxidative stress condition. Healthy cells frequently use antioxidant defense mechanisms, including GST, GPx, and GSH, to fend against ROS. However, this antioxidant defense system was severely halted by the injection of DEN [34]. The major finding in this study was that Streptomyces sp. (A16) extract significantly decreased liver TBARs, enhanced GPx and GST activity, and raised hepatic GSH levels in DEN-treated mice. The potential of Streptomyces sp. (A16) extract to shield the liver from oxidative stress is demonstrated by decreased TBAR levels, improvements in liver GSH content, and antioxidant enzyme activities [35]. Actinomycetes extracts have been demonstrated to improve liver structure and function after exposure to carcinogens and to restore antioxidant enzymes [16]. The bioactive compound 9-Octadecenamide, which has been demonstrated to have anti-inflammatory and antioxidant actions [36], is present in Streptomyces sp. (A16) extract, which may be in charge of the recovery of antioxidant enzymes and the generation of an anti-inflammatory action to prevent oxidative stress and restore normal liver architecture after DEN toxicity. We examined the mRNA expression of AFP, IL-1β, TNF-α, and P53 to validate the development of HCC and explore the mechanism underlying the anticancer action of Streptomyces sp. (A16) extract. HCC is routinely diagnosed, prognosed, and screened using the tumor biomarker AFP [37]. In response to chronic liver damage or the formation of HCC, hepatic progenitor cells release AFP; increased AFP levels indicate the proliferation of these cells [38]. After injection of DEN, mRNA expression of AFP was shown to be considerably higher than in normal control mice. These increased values show the beginning of HCC in addition to liver damage. This result is in line with earlier research [39,40]. Notably, the Streptomyces sp. (A16) extract therapy of DEN-treated mice resulted in a decrease in AFP mRNA levels, demonstrating the anticancer effects of these therapies [41]. The presence of persistent inflammation promotes and exacerbates most types of cancer, including HCC [42].
In the current investigation, the presence of DEN as a carcinogen-induced the production of all essential proinflammatory cytokines, and this increased immune system aggression led to significant liver inflammation, as shown by the histopathological analysis and higher levels of TNF-α and IL-1β mRNA expression. The HCC was thoroughly established in this study, according to the current cytokine data and the thorough histological investigation as well. Similar findings on the harmful role of chronic inflammation in HCC have been documented in many preclinical and clinical studies [43,44]. Pro-tumorigenic inflammation, which is seen in chronic hepatitis and is characterized by the infiltration of Th2 cells, regulatory T cells (Tregs), and M2 macrophages, as well as the expression of TNF-α and IL-1β, may lead to persistent hepatocyte generation and survival, accelerating the neoplastic transformation of hepatocytes [45]. The current work demonstrates that Streptomyces sp. (A16) extract mediates IL-1β and TNF-α downregulation, which may contribute to the reduction in the inflammatory cascade in the DEN-treated mice. Thus, it appeared that the hepatic tissues’ improvement after being treated with Streptomyces sp. (A16) extract was caused by the inhibition of proinflammatory cytokines. The bioactive compounds that demonstrated anti-inflammatory effects, such as trans-Cinnamaldehyde [46] and Cinnamamide [47], may be responsible for this hepatoprotective activity of Streptomyces sp. (A16) extract.
The findings of this investigation demonstrate that treatment with Streptomyces sp. (A16) extract enhanced the histological architecture and shielded the liver from malignant histological lesions brought on by DEN. Clear hepatocellular cancerous foci, damage to the structural integrity of the hepatic lobules, necrotic liver cells with multiple inflammatory infiltrations, fatty changes (steatosis), variable nuclei sizes, loss of cell membrane, and the absence of the capillaries in the hepatic sinusoids are some of the cancerous lesions that are present in these lesions. Kupffer cell hyperplasia was also present. These pathological abnormalities are strong indications that DEN-induced hepatocarcinogenesis was a successful model.
The current study’s observation is that the levels of p53 increased after treatment with Streptomyces sp. (A16) extract, which is consistent with a previous study [48]. The activation of tumor cell apoptosis is one of the key mechanisms employed by chemotherapy medicines [49]. Two important pro- and anti-apoptotic proteins, Bax and Bcl-2, control the permeabilization of the mitochondrial outer membrane and the release of cytochrome C into the cytosol, which results in caspase activation and ultimately apoptosis [50]. According to our results, treatment with Streptomyces sp. (A16) extract up-regulated the expression of caspase-3 and Bax while down-regulating the expression of Bcl-2 in mice with DEN-induced HCC. This suggests that the regulation of Streptomyces sp. (A16) extract-induced hepatoma cell apoptosis may depend on increased Bax and decreased Bcl-2 expression. Studies have shown that caspase activity is essential for Streptomyces sp.-induced apoptosis [48]. The activation and induction of caspase-3 cleavage by Streptomyces sp. (A16) extract in this work suggests that this intrinsic-dependent pathway is also implicated in the mechanism of Streptomyces sp.-induced apoptosis. Notably, treatment with Streptomyces sp. (A16) triggered the apoptotic pathways in DEN-induced hepatocarcinogenesis. This was accomplished through the activation of caspase-3, up-regulation of p53 and Bax, and down-regulation of Bcl2. As a result, the primary mechanism behind the anticancer actions mediated by Streptomyces sp. (A16) is the activation of these common apoptotic signaling pathways. In conclusion, and according to the results of the current investigation, Streptomyces sp. is a significant source of bioactive substances that can be employed to treat HCC. These substances may be responsible for the recovery of antioxidant enzymes, induction of apoptosis, and production of an anti-inflammatory effect to prevent oxidative stress and restore regular liver architecture in DEN-induced hepatocarcinogenesis, which accounts for the anticancer effect of Streptomyces sp. extract seen in this study. Our findings support the idea that Streptomyces bioactive metabolites may be effective therapeutic drugs for HCC inhibition, but more research is needed to evaluate and compare the effects of these agents on human HCC xenografts. Additionally, clinical studies are needed to determine the safety and effectiveness of these drugs in human beings.

Author Contributions

All authors participated in the design and interpretation of studies, the analysis of the data, and the review of the manuscript. S.M.A. and M.M. conducted the experiments and collected the data, S.M.A. and M.M. were responsible for the analysis and mapping of the data. M.A.M.W. provided methodological and technical guidance. M.M. wrote the manuscript, and W.N.H. reviewed the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

The Researchers Supporting Project number (RSP2023R466), King Saud University, Riyadh, Saudi Arabia.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Institutional Review Board (or Ethics Committee) of King Saud University (KSU-SE-22-72).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data used to support the findings of this study are included within the article.

Acknowledgments

The authors extend their appreciation to the Researchers Supporting Project number (RSP2023R466), King Saud University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. EASL. EASL Clinical Practice Guidelines: Management of hepatocellular carcinoma. J. Hepatol. 2018, 69, 182–236. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. El-Nakeep, S. Molecular and genetic markers in hepatocellular carcinoma: In silico analysis to clinical validation (current limitations and future promises). World J. Gastrointest. Pathophysiol. 2022, 13, 1. [Google Scholar] [CrossRef] [PubMed]
  3. Zajkowska, M.; Mroczko, B. Chemokines in Primary Liver Cancer. Int. J. Mol. Sci. 2022, 23, 8846. [Google Scholar] [CrossRef] [PubMed]
  4. Fujiwara, N.; Friedman, S.L.; Goossens, N.; Hoshida, Y. Risk factors and prevention of hepatocellular carcinoma in the era of precision medicine. J. Hepatol. 2018, 68, 526–549. [Google Scholar] [CrossRef] [Green Version]
  5. Poustchi, H.; Sepanlou, S.; Esmaili, S.; Mehrabi, N.; Ansarymoghadam, A. Hepatocellular carcinoma in the world and the middle East. Middle East J. Dig. Dis. 2010, 2, 31–41. [Google Scholar]
  6. Brown, Z.J.; Heinrich, B.; Greten, T.F. Mouse models of hepatocellular carcinoma: An overview and highlights for immunotherapy research. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 536–554. [Google Scholar] [CrossRef] [PubMed]
  7. Márquez-Quiroga, L.V.; Arellanes-Robledo, J.; Vásquez-Garzón, V.R.; Villa-Treviño, S.; Muriel, P. Models of nonalcoholic steatohepatitis potentiated by chemical inducers leading to hepatocellular carcinoma. Biochem. Pharmacol. 2022, 195, 114845. [Google Scholar] [CrossRef]
  8. Verna, L.; Whysner, J.; Williams, G.M. N-nitrosodiethylamine mechanistic data and risk assessment: Bioactivation, DNA-adduct formation, mutagenicity, and tumor initiation. Pharmacol. Ther. 1996, 71, 57–81. [Google Scholar] [CrossRef]
  9. Xu, X.; Lei, Y.; Chen, L.; Zhou, H.; Liu, H.; Jiang, J.; Yang, Y.; Wu, B. Phosphorylation of NF-κBp65 drives inflammation-mediated hepatocellular carcinogenesis and is a novel therapeutic target. J. Exp. Clin. Cancer Res. 2021, 40, 253. [Google Scholar] [CrossRef]
  10. Naugler, W.E.; Sakurai, T.; Kim, S.; Maeda, S.; Kim, K.; Elsharkawy, A.M.; Karin, M. Gender disparity in liver cancer due to sex differences in MyD88-dependent IL-6 production. Science 2007, 317, 121–124. [Google Scholar] [CrossRef] [Green Version]
  11. Carneiro, B.A.; El-Deiry, W.S. Targeting apoptosis in cancer therapy. Nat. Rev. Clin. Oncol. 2020, 17, 395–417. [Google Scholar] [CrossRef] [PubMed]
  12. Singh, R.; Letai, A.; Sarosiek, K. Regulation of apoptosis in health and disease: The balancing act of BCL-2 family proteins. Nat. Rev. Mol. Cell Biol. 2019, 20, 175–193. [Google Scholar] [CrossRef] [PubMed]
  13. Kim, D.W.; Talati, C.; Kim, R. Hepatocellular carcinoma (HCC): Beyond sorafenib—Chemotherapy. J. Gastrointest. Oncol. 2017, 8, 256. [Google Scholar] [CrossRef] [Green Version]
  14. Sioka, C.; Kyritsis, A.P. Central and peripheral nervous system toxicity of common chemotherapeutic agents. Cancer Chemother. Pharmacol. 2009, 63, 761–767. [Google Scholar] [CrossRef]
  15. Donald, L.; Pipite, A.; Subramani, R.; Owen, J.; Keyzers, R.A.; Taufa, T. Streptomyces: Still the biggest producer of new natural secondary metabolites, a current perspective. Microbiol. Res. 2022, 13, 418–465. [Google Scholar] [CrossRef]
  16. Elsayed, T.R.; Galil, D.F.; Sedik, M.Z.; Hassan, H.; Sadik, M.W. Antimicrobial and anticancer activities of actinomycetes isolated from Egyptian soils. Int. J. Curr. Microbiol. Appl. Sci. 2020, 9, 2020. [Google Scholar] [CrossRef]
  17. Balachandran, C.; Sangeetha, B.; Duraipandiyan, V.; Raj, M.K.; Ignacimuthu, S.; Al-Dhabi, N.; Balakrishna, K.; Parthasarathy, K.; Arulmozhi, N.; Arasu, M.V. A flavonoid isolated from Streptomyces sp.(ERINLG-4) induces apoptosis in human lung cancer A549 cells through p53 and cytochrome c release caspase dependant pathway. Chem. Biol. Interact. 2014, 224, 24–35. [Google Scholar] [CrossRef]
  18. Kouroshnia, A.; Zeinali, S.; Irani, S.; Sadeghi, A. Induction of apoptosis and cell cycle arrest in colorectal cancer cells by novel anticancer metabolites of Streptomyces sp. 801. Cancer Cell Int. 2022, 22, 235. [Google Scholar] [CrossRef] [PubMed]
  19. Lin, H.-Y.; Lin, Y.-S.; Shih, S.-P.; Lee, S.-B.; El-Shazly, M.; Chang, K.-M.; Yang, Y.-C.S.; Lee, Y.-L.; Lu, M.-C. The anti-proliferative activity of secondary metabolite from the marine streptomyces sp. against prostate cancer cells. Life 2021, 11, 1414. [Google Scholar] [CrossRef]
  20. Shirling, E.T.; Gottlieb, D. Methods for characterization of Streptomyces species. Int. J. Syst. Bacteriol. 1966, 16, 313–340. [Google Scholar] [CrossRef] [Green Version]
  21. Arai, T.; Tamotsu, F.; Masa, H.; Akihiro, M.; Yuzuru, M. Culture Media for Actinomycetes; The Society for Actinomycetes Japan: Tokyo, Japan, 1975; pp. 1–20. [Google Scholar]
  22. Azmi, M.N.; Sian, T.A.; Suhaimi, M.; Kamarudin, M.N.A.; Din, M.F.M.; Nafiah, M.A.; Thomas, N.F.; Kadir, H.A.; Awang, K. Synthesis of Indolostilbenes via FeCl3-promoted Oxidative Cyclisation and their Biological Effects on NG108-15 Cell Viability and H2O2-induced Cytotoxicity. J. Phys. Sci. 2021, 32, 69–89. [Google Scholar] [CrossRef]
  23. Lim, J.Y.; Liu, C.; Hu, K.Q.; Smith, D.E.; Wu, D.; Lamon-Fava, S.; Ausman, L.M.; Wang, X.D. Xanthophyll β-Cryptoxanthin Inhibits Highly Refined Carbohydrate Diet–Promoted Hepatocellular Carcinoma Progression in Mice. Mol. Nutr. Food Res. 2020, 64, 1900949. [Google Scholar] [CrossRef] [PubMed]
  24. Uehara, T.; Pogribny, I.P.; Rusyn, I. The DEN and CCl4-Induced Mouse Model of Fibrosis and Inflammation-Associated Hepatocellular Carcinoma. Curr. Protoc. 2021, 1, e211. [Google Scholar] [CrossRef] [PubMed]
  25. Haque, M.U.; Rahman, M.A.; Haque, M.A.; Sarker, A.K.; Islam, M.A.U. Antimicrobial and anticancer activities of ethyl acetate extract of co-culture of Streptomyces sp. ANAM-5 and AIAH-10 Isolated from Mangrove Forest of Sundarbans, Bangladesh. J. Appl. Pharm. Sci. 2016, 6, 051–055. [Google Scholar] [CrossRef] [Green Version]
  26. Li, S.-Q.; Wang, D.-M.; Shu, Y.-J.; Wan, X.-D.; Xu, Z.-S.; Li, E.-Z. Proper heat shock pretreatment reduces acute liver injury induced by carbon tetrachloride and accelerates liver repair in mice. J. Toxicol. Pathol. 2013, 26, 365–373. [Google Scholar] [CrossRef] [Green Version]
  27. Krishnan, K.; Mani, A.; Jasmine, S. Cytotoxic activity of bioactive compound 1, 2-benzene dicarboxylic acid, mono 2-ethylhexyl ester extracted from a marine derived Streptomyces sp. VITSJK8. Int. J. Mol. Cell. Med. 2014, 3, 246. [Google Scholar]
  28. Al-Enazi, N.M.; Abdel-Raouf, N.; Alharbi, R.M.; Sholkamy, E.N. Metabolic Profiling of Streptomyces sp. Strain ess_amH1 Isolated from Apis mellifera yemintica’s Gut Microbiome, and Its Anticancer Activity against Breast Cancer (MCF7) and Hepatocarcinoma (HepG2) Cell Lines, as Well as Antimicrobial Activity. Appl. Sci. 2022, 12, 12257. [Google Scholar] [CrossRef]
  29. Tawfek, N.S.; Al Azhary, D.B.; Hussien, B.K.A.; Abd Elgeleel, D.M. Effects of Cassia fistula and Ficus carica leaf extracts on hepatocarcinogenesis in rats. Middle East J. Appl. Sci. 2015, 5, 462–479. [Google Scholar]
  30. Tisdale, M.J. Metabolic abnormalities in cachexia and anorexia. Nutrition 2000, 16, 1013–1014. [Google Scholar] [CrossRef]
  31. Wang, J.; Chu, H.; Wang, Z.; Wang, X.; Liu, X.; Song, Z.; Liu, F. In vivo study revealed pro-tumorigenic effect of CMTM3 in hepatocellular carcinoma involving the regulation of peroxisome proliferator-activated receptor gamma (PPARγ). Cell. Oncol. 2022, 46, 49–64. [Google Scholar] [CrossRef] [PubMed]
  32. Wei, Y.; Yi, J.-K.; Chen, J.; Huang, H.; Wu, L.; Yin, X.; Wang, J. Boron attenuated diethylnitrosamine induced hepatocellular carcinoma in C3H/HeN mice via alteration of oxidative stress and apoptotic pathway. J. Trace Elem. Med. Biol. 2022, 74, 127052. [Google Scholar] [CrossRef] [PubMed]
  33. Abdel-Hamid, N.M.; Abass, S.A.; Mohamed, A.A.; Hamid, D.M. Herbal management of hepatocellular carcinoma through cutting the pathways of the common risk factors. Biomed. Pharmacother. 2018, 107, 1246–1258. [Google Scholar] [CrossRef]
  34. Adebayo, O.A.; Akinloye, O.; Adaramoye, O.A. Cerium oxide nanoparticles attenuate oxidative stress and inflammation in the liver of diethylnitrosamine-treated mice. Biol. Trace Elem. Res. 2020, 193, 214–225. [Google Scholar] [CrossRef]
  35. El-Nekeety, A.A.; Salman, A.S.; Hathout, A.S.; Sabry, B.A.; Abdel-Aziem, S.H.; Hassan, N.S.; Abdel-Wahhab, M.A. Evaluation of the bioactive extract of actinomyces isolated from the Egyptian environment against aflatoxin B1-induce cytotoxicity, genotoxicity and oxidative stress in the liver of rats. Food Chem. Toxicol. 2017, 105, 241–255. [Google Scholar] [CrossRef] [PubMed]
  36. Rashwan, H.M.; Mohammed, H.E.; El-Nekeety, A.A.; Hamza, Z.K.; Abdel-Aziem, S.H.; Hassan, N.S.; Abdel-Wahhab, M.A. Bioactive phytochemicals from Salvia officinalis attenuate cadmium-induced oxidative damage and genotoxicity in rats. Environ. Sci. Pollut. Res. Int. 2021, 28, 68498–68512. [Google Scholar] [CrossRef] [PubMed]
  37. Nguyen, H.B.; Le, X.-T.T.; Nguyen, H.H.; Vo, T.T.; Le, M.K.; Nguyen, N.T.; Do-Nguyen, T.M.; Truong-Nguyen, C.M.; Nguyen, B.-S.T. Diagnostic Value of hTERT mRNA and in Combination With AFP, AFP-L3%, Des-γ-carboxyprothrombin for Screening of Hepatocellular Carcinoma in Liver Cirrhosis Patients HBV or HCV-Related. Cancer Inform. 2022, 21, 11769351221100730. [Google Scholar] [CrossRef]
  38. Lee, T.K.-W.; Guan, X.-Y.; Ma, S. Cancer stem cells in hepatocellular carcinoma—From origin to clinical implications. Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 26–44. [Google Scholar] [CrossRef] [PubMed]
  39. Jiang, J.; Turpin, C.; Qiu, G.; Xu, M.; Lee, E.; Hinds, T.D., Jr.; Peterson, M.L.; Spear, B.T. Zinc fingers and homeoboxes 2 is required for diethylnitrosamine-induced liver tumor formation in C57BL/6 mice. Hepatol. Commun. 2022, 6, 3550–3562. [Google Scholar] [CrossRef]
  40. Xu, S.-H.; Luo, H.-X.; Huang, B.-J.; Yu, L.; Luo, S.-J.; Hu, H.; Li, Y.; Lin, X.-T.; Cao, Z.-R.; Deng, Y.-J. Therapeutic Effect of Catgut Implantation at Acupoint in a Mouse Model of Hepatocellular Carcinoma by Suppressing Immune Escape. Evid. Based Complement. Altern. Med. 2022, 2022, 5572869. [Google Scholar] [CrossRef] [PubMed]
  41. Ibrahim, N.A.; Anwar, H.M.; Moghazy, A.M.; El Malah, T.; Ragab, W.M.; El-Aal, A.; Hassan, R.A.; Saleh, N.A.; Eldosoki, D.E. Heme oxygenase–1 Expression in Liver and Colon of Rats Exposed to Oxidative stress and Dysplasia by a Carcinogen Diethylnitrosamine and the Possible Therapeutic Effects of Probiotic Versus Pyridazine Derivative and Chemotherapy. Egypt. J. Chem. 2022, 65, 1–2. [Google Scholar] [CrossRef]
  42. Bishayee, A. The role of inflammation and liver cancer. Adv. Exp. Med. Biol. 2014, 816, 401–435. [Google Scholar] [CrossRef] [PubMed]
  43. Li, H.; Liu, N.-N.; Li, J.-R.; Wang, M.-X.; Tan, J.-L.; Dong, B.; Lan, P.; Zhao, L.-M.; Peng, Z.-G.; Jiang, J.-D. Bicyclol ameliorates advanced liver diseases in murine models via inhibiting the IL-6/STAT3 signaling pathway. Biomed. Pharmacother. 2022, 150, 113083. [Google Scholar] [CrossRef] [PubMed]
  44. Muhammed, A.; Fulgenzi, C.A.M.; Dharmapuri, S.; Pinter, M.; Balcar, L.; Scheiner, B.; Marron, T.U.; Jun, T.; Saeed, A.; Hildebrand, H. The systemic inflammatory response identifies patients with adverse clinical outcome from immunotherapy in hepatocellular carcinoma. Cancers 2022, 14, 186. [Google Scholar] [CrossRef]
  45. Arvanitakis, K.; Koletsa, T.; Mitroulis, I.; Germanidis, G. Tumor-Associated Macrophages in Hepatocellular Carcinoma Pathogenesis, Prognosis and Therapy. Cancers 2022, 14, 226. [Google Scholar] [CrossRef]
  46. Kim, M.E.; Na, J.Y.; Lee, J.S. Anti-inflammatory effects of trans-cinnamaldehyde on lipopolysaccharide-stimulated macrophage activation via MAPKs pathway regulation. Immunopharmacol. Immunotoxicol. 2018, 40, 219–224. [Google Scholar] [CrossRef]
  47. Gaikwad, N.; Nanduri, S.; Madhavi, Y.V. Cinnamamide: An insight into the pharmacological advances and structure-activity relationships. Eur. J. Med. Chem. 2019, 181, 111561. [Google Scholar] [CrossRef]
  48. Balthazar, J.D.; Soosaimanickam, M.P.; Emmanuel, C.; Krishnaraj, T.; Sheikh, A.; Alghafis, S.F.; Ibrahim, H.-I.M. 8-Hydroxyquinoline a natural chelating agent from Streptomyces spp. inhibits A549 lung cancer cell lines via BCL2/STAT3 regulating pathways. World J. Microbiol. Biotechnol. 2022, 38, 1–12. [Google Scholar] [CrossRef]
  49. Farghadani, R.; Naidu, R. Curcumin as an enhancer of therapeutic efficiency of chemotherapy drugs in breast cancer. Int. J. Mol. Sci. 2022, 23, 2144. [Google Scholar] [CrossRef]
  50. Green, D.R. The mitochondrial pathway of apoptosis Part II: The BCL-2 protein family. Cold Spring Harb. Perspect. Biol. 2022, 14, a041046. [Google Scholar] [CrossRef]
Biomedicines 11 01054 g001 550
Figure 1. Chromatogram of Streptomyces sp. (A16) compounds in extract Ethyl acetate extract. The major compounds were Benzeneacetamide, trans-Cinnamaldehyde, Pyrrole-2-carboxamide and Cinnamamide.
Figure 1. Chromatogram of Streptomyces sp. (A16) compounds in extract Ethyl acetate extract. The major compounds were Benzeneacetamide, trans-Cinnamaldehyde, Pyrrole-2-carboxamide and Cinnamamide.
Biomedicines 11 01054 g001
Biomedicines 11 01054 g002 550
Figure 2. The percentage cytotoxicity on the HepG2 cell line was determined by MTT assay. Cells were cultured in 96-well plates and then treated with different concentration doses of Streptomyces sp. (A16) extract. The data are presented as mean  ±  SEM of three independent experiments and statistically analyzed by the unpaired t-test. The IC50 value was determined.
Figure 2. The percentage cytotoxicity on the HepG2 cell line was determined by MTT assay. Cells were cultured in 96-well plates and then treated with different concentration doses of Streptomyces sp. (A16) extract. The data are presented as mean  ±  SEM of three independent experiments and statistically analyzed by the unpaired t-test. The IC50 value was determined.
Biomedicines 11 01054 g002
Biomedicines 11 01054 g003 550
Figure 3. Representative images of mice livers showing tumor progression over time, control group (A), DEN-treated group after 3 months (B), DEN-treated group after 6 months showing unequal sized gray nodules, which was a signal for HCC formation (C), DEN-treated group after 9 months showing showed liver swelling, cirrhosis, unequal size, white tumor nodules (arrow) (D).
Figure 3. Representative images of mice livers showing tumor progression over time, control group (A), DEN-treated group after 3 months (B), DEN-treated group after 6 months showing unequal sized gray nodules, which was a signal for HCC formation (C), DEN-treated group after 9 months showing showed liver swelling, cirrhosis, unequal size, white tumor nodules (arrow) (D).
Biomedicines 11 01054 g003
Biomedicines 11 01054 g004 550
Figure 4. Effects of Streptomyces sp. (A16) extract on antioxidant enzyme activities and lipid peroxidation in mice liver samples following DEN injection, including TBARS (A), GST (B), GPx (C), and GSH (D). Data are presented as mean ± SEM (n = 6) and statistically analyzed by one-way ANOVA followed by the Tukey–Kramer post hoc test. ** p < 0.01, *** p < 0.001 were significant compared with the control group, # p < 0.05, ## p < 0.01, ### p < 0.001 were significant compared with DEN-treated mice and + p < 0.05, +++ p < 0.001 were significant compared with DEN+ A16 (L)-treated mice. Abbreviations: TBARS, thiobarbituric acid reaction substances; GST, glutathione-S-transferase; GPx, glutathione peroxidase; GSH, glutathione.
Figure 4. Effects of Streptomyces sp. (A16) extract on antioxidant enzyme activities and lipid peroxidation in mice liver samples following DEN injection, including TBARS (A), GST (B), GPx (C), and GSH (D). Data are presented as mean ± SEM (n = 6) and statistically analyzed by one-way ANOVA followed by the Tukey–Kramer post hoc test. ** p < 0.01, *** p < 0.001 were significant compared with the control group, # p < 0.05, ## p < 0.01, ### p < 0.001 were significant compared with DEN-treated mice and + p < 0.05, +++ p < 0.001 were significant compared with DEN+ A16 (L)-treated mice. Abbreviations: TBARS, thiobarbituric acid reaction substances; GST, glutathione-S-transferase; GPx, glutathione peroxidase; GSH, glutathione.
Biomedicines 11 01054 g004
Biomedicines 11 01054 g005 550
Figure 5. Assessment of mRNA expressions of AFP (A), IL-1β (B), TNF-α (C) and P53 (D) genes in hepatic tissues following treatment with Streptomyces sp. (A16) extract in DEN-administered mice. Data are presented as mean ± SEM (n = 6) and statistically analyzed by one-way ANOVA followed by the Tukey–Kramer post hoc test. *** p < 0.001 were significant compared with control group, ### p < 0.001 were significant compared with DEN-treated mice and +++ p < 0.001 was significant compared with DEN + A16 (L)-treated mice. Abbreviations: AFP, alpha-fetoprotein; IL-1β, interleukin-1β; TNF-α, tumor necrosis factor-α.
Figure 5. Assessment of mRNA expressions of AFP (A), IL-1β (B), TNF-α (C) and P53 (D) genes in hepatic tissues following treatment with Streptomyces sp. (A16) extract in DEN-administered mice. Data are presented as mean ± SEM (n = 6) and statistically analyzed by one-way ANOVA followed by the Tukey–Kramer post hoc test. *** p < 0.001 were significant compared with control group, ### p < 0.001 were significant compared with DEN-treated mice and +++ p < 0.001 was significant compared with DEN + A16 (L)-treated mice. Abbreviations: AFP, alpha-fetoprotein; IL-1β, interleukin-1β; TNF-α, tumor necrosis factor-α.
Biomedicines 11 01054 g005
Biomedicines 11 01054 g006 550
Figure 6. Histological examination of hepatic tissues following treatment with Streptomyces sp. (A16) extract in DEN-administered mice. (H&E, scale bar = 50 µm). (A) Liver tissue from the control group displaying typical hepatic cells. (B,C) Liver sections taken from mice that received a low dose (25 mg/kg body weight) or a high dose (50 mg/kg body weight) of Streptomyces sp. (A16) extract showing normal hepatic cells. (D) Liver tissue from the DEN-treated group exhibited abnormal liver tissue characteristics, such as the destruction of the hepatic lobules’ structural integrity, necrotic hepatic cells with multiple inflammatory infiltrations (blue arrow), fatty change (steatosis) (green head arrows), variable nuclei size, loss of cell membrane, and absence of the hepatic sinusoids’ capillaries. Along with the Kupffer cell hyperplasia, other changes included hyaline changes, bile duct dilatation, and hepatic artery and portal vein enlargement. (E,F) Liver tissue from the DEN+ A16 (L) and DEN + A16 (H) groups showed a significant improvement in liver architecture in the form of decreased hepatic necrosis, fewer inflammatory cells, reduced steatosis, and modest cytoplasmic vacuolization of hepatocytes. (G) Semiquantitative histological scoring of the liver injuries. Data are presented as mean ± SEM (n = 5) and statistically analyzed by the Kruskal-Wallis test and Dunn’s multiple comparison post hoc test. *** p < 0.001 were significant compared with the control group, ### p < 0.001 were significant compared with DEN-treated mice, and +++ p < 0.001 were significant compared with DEN+ A16 (L)-treated mice.
Figure 6. Histological examination of hepatic tissues following treatment with Streptomyces sp. (A16) extract in DEN-administered mice. (H&E, scale bar = 50 µm). (A) Liver tissue from the control group displaying typical hepatic cells. (B,C) Liver sections taken from mice that received a low dose (25 mg/kg body weight) or a high dose (50 mg/kg body weight) of Streptomyces sp. (A16) extract showing normal hepatic cells. (D) Liver tissue from the DEN-treated group exhibited abnormal liver tissue characteristics, such as the destruction of the hepatic lobules’ structural integrity, necrotic hepatic cells with multiple inflammatory infiltrations (blue arrow), fatty change (steatosis) (green head arrows), variable nuclei size, loss of cell membrane, and absence of the hepatic sinusoids’ capillaries. Along with the Kupffer cell hyperplasia, other changes included hyaline changes, bile duct dilatation, and hepatic artery and portal vein enlargement. (E,F) Liver tissue from the DEN+ A16 (L) and DEN + A16 (H) groups showed a significant improvement in liver architecture in the form of decreased hepatic necrosis, fewer inflammatory cells, reduced steatosis, and modest cytoplasmic vacuolization of hepatocytes. (G) Semiquantitative histological scoring of the liver injuries. Data are presented as mean ± SEM (n = 5) and statistically analyzed by the Kruskal-Wallis test and Dunn’s multiple comparison post hoc test. *** p < 0.001 were significant compared with the control group, ### p < 0.001 were significant compared with DEN-treated mice, and +++ p < 0.001 were significant compared with DEN+ A16 (L)-treated mice.
Biomedicines 11 01054 g006
Biomedicines 11 01054 g007 550
Figure 7. Liver caspase-3 immunohistochemistry. Photomicrographs of sections of liver samples taken from (A) the control. (B,C) Liver sections taken from mice that received a low dose (25 mg/kg body weight) and a high dose (50 mg/kg body weight) of Streptomyces sp. (A16) extract, respectively. (D) DEN-treated group. (E,F) Liver tissue from the DEN+ A16 (L) and DEN + A16 (H) Streptomyces sp. extract. The area percent of positive caspase-3 immunoreactivity (head arrows) was quantified (G). Values are presented as mean ± SEM (n = 3) and statistically analyzed by one-way ANOVA followed by the Tukey–Kramer post hoc test. * p < 0.05 versus control group, ## p < 0.01, #### p < 0.0001 versus DEN-treated mice and + p < 0.05 versus DEN+ A16 (L)-treated mice.
Figure 7. Liver caspase-3 immunohistochemistry. Photomicrographs of sections of liver samples taken from (A) the control. (B,C) Liver sections taken from mice that received a low dose (25 mg/kg body weight) and a high dose (50 mg/kg body weight) of Streptomyces sp. (A16) extract, respectively. (D) DEN-treated group. (E,F) Liver tissue from the DEN+ A16 (L) and DEN + A16 (H) Streptomyces sp. extract. The area percent of positive caspase-3 immunoreactivity (head arrows) was quantified (G). Values are presented as mean ± SEM (n = 3) and statistically analyzed by one-way ANOVA followed by the Tukey–Kramer post hoc test. * p < 0.05 versus control group, ## p < 0.01, #### p < 0.0001 versus DEN-treated mice and + p < 0.05 versus DEN+ A16 (L)-treated mice.
Biomedicines 11 01054 g007
Biomedicines 11 01054 g008 550
Figure 8. Liver Bax immunohistochemistry. Photomicrographs of sections of liver samples from the following groups: (A) Control group, (B,C) liver sections taken from mice that were given a low dose (25 mg/kg body weight) and a high dose (50 mg/kg body weight) of Streptomyces sp. (A16) extract respectively, (D) DEN-treated group, (E,F) liver tissue from the DEN+ A16 (L) and DEN + A16 (H) Streptomyces sp. extract. The area percent of positive Bax immunoreactivity (head arrows) was quantified (G). Data are expressed as mean ± SEM (n = 3) and statistically analyzed by one-way ANOVA followed by the Tukey–Kramer post hoc test. * p < 0.05 versus control group, ### p < 0.001 versus DEN-treated mice and ++ p < 0.01 versus DEN+ A16 (L)-treated mice.
Figure 8. Liver Bax immunohistochemistry. Photomicrographs of sections of liver samples from the following groups: (A) Control group, (B,C) liver sections taken from mice that were given a low dose (25 mg/kg body weight) and a high dose (50 mg/kg body weight) of Streptomyces sp. (A16) extract respectively, (D) DEN-treated group, (E,F) liver tissue from the DEN+ A16 (L) and DEN + A16 (H) Streptomyces sp. extract. The area percent of positive Bax immunoreactivity (head arrows) was quantified (G). Data are expressed as mean ± SEM (n = 3) and statistically analyzed by one-way ANOVA followed by the Tukey–Kramer post hoc test. * p < 0.05 versus control group, ### p < 0.001 versus DEN-treated mice and ++ p < 0.01 versus DEN+ A16 (L)-treated mice.
Biomedicines 11 01054 g008
Biomedicines 11 01054 g009 550
Figure 9. Liver Bcl-2 immunohistochemistry. Photomicrographs of sections of liver samples from the following groups: (A) Control group, (B,C) liver sections taken from mice that were given a low dose (25 mg/kg body weight) and a high dose (50 mg/kg body weight) of Streptomyces sp. (A16) extract, respectively, (D) DEN-treated group, (E,F) liver tissue from the DEN+ A16 (L) and DEN + A16 (H) Streptomyces sp. extract. The area percent of positive Bcl-2 immunoreactivity (head arrows) was quantified (G). Data are expressed as mean ± SEM (n = 3) and statistically analyzed by one-way ANOVA followed by the Tukey–Kramer post hoc test. *** p < 0.001 versus control group, # p < 0.05, ### p < 0.001 versus DEN-treated mice and + p < 0.05 versus DEN+ A16 (L)-treated mice.
Figure 9. Liver Bcl-2 immunohistochemistry. Photomicrographs of sections of liver samples from the following groups: (A) Control group, (B,C) liver sections taken from mice that were given a low dose (25 mg/kg body weight) and a high dose (50 mg/kg body weight) of Streptomyces sp. (A16) extract, respectively, (D) DEN-treated group, (E,F) liver tissue from the DEN+ A16 (L) and DEN + A16 (H) Streptomyces sp. extract. The area percent of positive Bcl-2 immunoreactivity (head arrows) was quantified (G). Data are expressed as mean ± SEM (n = 3) and statistically analyzed by one-way ANOVA followed by the Tukey–Kramer post hoc test. *** p < 0.001 versus control group, # p < 0.05, ### p < 0.001 versus DEN-treated mice and + p < 0.05 versus DEN+ A16 (L)-treated mice.
Biomedicines 11 01054 g009
Table
Table 1. Primers used for qRT-PCR.
Table 1. Primers used for qRT-PCR.
Gene Forward Primer (5′-3′)Reverse Primer (5′-3′)
AFPCCAGGAAGTCTGTTTCACAGAAGCAAAAGGCTCACACCAAAGAG
P53TGAAACGCCGACCTATCCTTAGGCACAAACACGAACCTCAAA
IL-1βCTATGGCAACTGTCCCTGAAGGCTTGGAAGCAATCCTT
TNF-αGCTTGGTGGTTTGCTACGACACTGAACTTCGGGGTGATTG
GAPDHAAGGTGGAAGAATGGGAGTTGGAAAGCTGTGGCGTGAT
Table
Table 2. Phytoconstituents of ethyl acetate extract of Streptomyces sp. (A16) using GC-MS.
Table 2. Phytoconstituents of ethyl acetate extract of Streptomyces sp. (A16) using GC-MS.
No.Detected CompoundFormulaRetention Time (min)Peak AreaAbundance (%)
1Ethyl AcetateC4H8O21.8086,851,42944.307
2Propanoic acid, ethyl esterC5H10O22.372,576,3971.314
3p-XyleneC8H104.651,201,1820.613
41,3,5-CyclooctatrieneC8H105.18345,9790.176
5BenzaldehydeC7H6O6.80194,1010.099
55-Methyl-2-furaldehydeC6H6O26.95321,2370.164
62-Methyl-5-hexanone oximeC7H15NO8.152,498,5501.275
7CorylonC6H8O28.64230,3470.118
8Phenylethyl AlcoholC8H10O11.05366,4720.187
9Larixic acidC6H6O311.20331,4180.169
10PyranoneC6H8O411.95150,6140.077
112,4,4-Trimethyl-1-pentyl methylphosphonofluoridateC9H20FO2P13.62460,0080.235
12Pyrrole-2-carboxylic acidC5H5NO214.206,297,7823.213
14trans-CinnamaldehydeC9H8O15.4314,191,8877.240
15Pyrrole-2-carboxamideC5H6N2O16.5914,191,8877.240
16BenzamideC7H7NO17.551,141,9670.583
17α-ylangeneC15H2418.23257,6530.131
18BenzeneacetamideC8H9NO19.1222,818,27511.641
19PhenylpropanamideC9H11NO22.061,628,0200.831
20CinnamamideC9H9NO25.2310,206,5055.207
21Uric acidC5H4N4O326.451,488,7220.759
223-(Hydroxymethyl)-5-methoxyphenolC8H10O328.651,955,7280.998
23Cyclo(leucyloprolyl)C11H18N2O230.938,920,2334.551
24Chiapin BC19H26O631.823,618,3921.846
25cis-13-Eicosenoic acidC20H38O233.68880,5710.449
262,5-Piperazinedione, 3,6-bis(2-methylpropylC12H22N2O235.501,801,6120.919
27(Z)-9-OctadecenamideC18H35NO38.615,237,3852.672
28DihydroergotamineC33H37N5O538.954,316,0022.202
29cis-5,8,11,14,17-Eicosapentaenoic acidC20H30O239.361,542,2830.787
Table
Table 3. Effect of Streptomyces sp. (A16) extracts on body weight (g), liver weights (g), and liver enzymes in DEN-administered mice.
Table 3. Effect of Streptomyces sp. (A16) extracts on body weight (g), liver weights (g), and liver enzymes in DEN-administered mice.
Parameters/GroupsControlA16 (L)A16 (H)DENDEN+ A16 (L)DEN + A16 (H)
Body weight(g) week3243 ± 1.643.6 ± 1.643.5 ± 338.8 ± 0.8 ***39.6 ± 1.6 ###38.9 ± 0.6 ##
Body weight(g) week3644.4 ± 1.643.8 ± 1.944.8 ± 1.941.0 ± 0.9 ***43.0 ± 2.0 ###43.6 ± 0.6 ##
Absolute liver weight (g)2.3 ± 0.062.3 ± 0.12.1 ± 0.13.3 ± 0.08 **2.9 ± 0.08 ##2.7 ± 0.08 ###
AST (U/L)106.4 ± 1.11112.6 ± 2.72112.8 ± 0.44227.9 ± 5.74 ***116.7 ± 0.88 ###109.0 ± 2.17 ###
ALT (U/L)37.35 ± 0.540.51 ± 0.4642.32 ± 0.43125.5 ± 1.5 ***48.76 ± 0.53 ###41.00 ± 1.11 ###
Data are presented as mean values ± SEM and statistically analyzed by one-way ANOVA followed by Tukey–Kramer post hoc test. ** p < 0.01, *** p < 0.001 were significant compared with the control group, and ## p < 0.01, ### p < 0.001 were significant compared with DEN-treated mice.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Alhawsawi, S.M.; Mohany, M.; Baabbad, A.A.; Almoutiri, N.D.; Maodaa, S.N.; Al-shaebi, E.M.; Yaseen, K.N.; Wadaan, M.A.M.; Hozzein, W.N. Streptomyces Bioactive Metabolites Prevent Liver Cancer through Apoptosis, Inhibiting Oxidative Stress and Inflammatory Markers in Diethylnitrosamine-Induced Hepatocellular Carcinoma. Biomedicines 2023, 11, 1054. https://doi.org/10.3390/biomedicines11041054

AMA Style

Alhawsawi SM, Mohany M, Baabbad AA, Almoutiri ND, Maodaa SN, Al-shaebi EM, Yaseen KN, Wadaan MAM, Hozzein WN. Streptomyces Bioactive Metabolites Prevent Liver Cancer through Apoptosis, Inhibiting Oxidative Stress and Inflammatory Markers in Diethylnitrosamine-Induced Hepatocellular Carcinoma. Biomedicines. 2023; 11(4):1054. https://doi.org/10.3390/biomedicines11041054

Chicago/Turabian Style

Alhawsawi, Sana M., Mohamed Mohany, Almohannad A. Baabbad, Nawaf D. Almoutiri, Saleh N. Maodaa, Esam M. Al-shaebi, Khadijah N. Yaseen, Mohammed A. M. Wadaan, and Wael N. Hozzein. 2023. "Streptomyces Bioactive Metabolites Prevent Liver Cancer through Apoptosis, Inhibiting Oxidative Stress and Inflammatory Markers in Diethylnitrosamine-Induced Hepatocellular Carcinoma" Biomedicines 11, no. 4: 1054. https://doi.org/10.3390/biomedicines11041054

APA Style

Alhawsawi, S. M., Mohany, M., Baabbad, A. A., Almoutiri, N. D., Maodaa, S. N., Al-shaebi, E. M., Yaseen, K. N., Wadaan, M. A. M., & Hozzein, W. N. (2023). Streptomyces Bioactive Metabolites Prevent Liver Cancer through Apoptosis, Inhibiting Oxidative Stress and Inflammatory Markers in Diethylnitrosamine-Induced Hepatocellular Carcinoma. Biomedicines, 11(4), 1054. https://doi.org/10.3390/biomedicines11041054

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop