Arene Ruthenium Complexes Specifically Inducing Apoptosis in Breast Cancer Cells

Abstract

Monocationic arene ruthenium complexes (RuL₁–RuL₄) incorporating phenothiazinyl-hydrazinyl-thiazole ligands (L₁–L₄) have been synthesized, characterized and evaluated as anticancer agents. Their cytotoxicity, antiproliferative activity and alteration of apoptotic gene expression were studied on three cancer cell lines, a double positive breast cancer cell line MCF-7 and two triple negative breast cancer cell lines Hs578T and MDA-MB-231. All arene ruthenium complexes were able to reduce the viability of the breast cancer cell lines, with the highest cytotoxicities being recorded for the [(p-cymene)RuL₃Cl]⁺ (RuL₃) complex on the MCF-7 (IC₅₀ = 0.019 µM) and Hs578T cell lines (IC₅₀ = 0.095 µM). In the double positive MCF-7 breast cancer cells, the complexes [(p-cymene)RuL₁Cl]⁺ (RuL₁) and [(p-cymene)RuL₂Cl]⁺ (RuL₂) significantly upregulated pro-apoptotic genes including BAK, FAS, NAIP, CASP8, TNF, XIAP and BAD, while downregulating TNFSF10. In the triple negative breast cancer cell line Hs578T, RuL₁ reduced TNFSF-10 and significantly upregulated BAK, CASP8, XIAP, FADD and BAD, while complex RuL₂ also increased BAK and CASP8 expression, but had limited effects on other genes. The triple negative MDA-MB-231 cancer cells treated with RuL₁ upregulated NOD1 and downregulated p53, while RuL₂ significantly downregulated p53, XIAP and TNFSF10, with minor changes in other genes. The significant alterations in the expression of key apoptotic genes suggest that such complexes have the potential to target cancer cells.

1. Introduction

Human breast cancer, one of the most common types of cancer according to the World Health Organization statistics, has been diagnosed in more than 2.3 million women in 2022 [1]. Triple negative breast cancer (TNBC) is the most aggressive form [2], with patients exhibiting a heightened propensity for early metastasis compared with those with other types of breast cancer [3]. TNBC is defined by a deficiency in progesterone (PR) and estrogen receptors (ER), as well as in human epidermal growth factor receptor 2 (HER2) expression [4,5]. These factors collectively contribute to the TNBC’s distinctive biological features, which makes it challenging to treat with current drugs [6,7,8]. In comparison with TNBC, the double positive breast cancer (ER+/PR+) phenotype is linked to a greater prevalence among older patients, showing smaller tumors and offering a more favorable prognosis in comparison with the ER+/PR- phenotype [9,10,11].

Ruthenium complexes are promising chemotherapeutic agents, and several Ru(II) derivatives have entered clinical trials, with, however, variable outcomes [12,13]. Among biologically active Ru(II) complexes, the arene ruthenium family possesses interesting antitumor activity, showing different mechanisms. Some arene ruthenium complexes have the ability to bind DNA in a covalent or non-covalent manner [14,15], while others showed interactions with cytochrome c [16], as well as other biomolecules [17]. Such diversity in their targets and modes of action is linked to their facility to modify their structures and properties by the introduction of a wide range of ligands, thus tuning their cytotoxic effect. For example, against TNBC, arene ruthenium complexes incorporating the bidentate bis(3,5-dimethylpyrazol-1-yl)methane [18] or iminophosphorane ligands [19] showed a suppression of TNBC growth in vivo, while arene ruthenium complexes with α-amino acid ligands (methionine and tryptophan) were able to induce selective apoptosis of MDA-MB-231 cells through DNA interaction [20].

In a previous study, we reported the synthesis and biological activity of hydrazinyl-thiazolo arene ruthenium complexes [21]. All complexes were more active than cisplatin and oxaliplatin on cervical (HeLa) and ovarian (A2780 and A2780cisR) cancer cells [21], and in vivo, the complexes were well tolerated after oral and intraperitoneal administrations in rats without altering the hematological profile [22]. Moreover, considering the antitumor activity of phenothiazinyl-hydrazinyl-thiazole derivatives on hepatic HepG2 and colorectal CC531S cells [23], we decided to extend our investigation on a new family of arene ruthenium complexes (RuL₁–RuL₄) with phenothiazinyl-hydrazinyl-thiazolo ligands (L₁–L₄) and to evaluate their antiproliferative activity against double positive (MCF-7) and triple negative (Hs578T, MDA-MB-231) breast cancer cell lines, as well as non-cancerous breast cells (fR2).

2. Results

The monocationic arene ruthenium complexes (RuL₁–RuL₄) were synthesized by reacting [(p-cymene)RuCl₂]₂ with two equivalents of phenothiazinyl-hydrazinyl-thiazole derivatives (L₁–L₄) in methanol at room temperature (Scheme 1). All complexes were isolated as their chloride salts in good yield, as racemic mixtures. Accordingly, the complexes showed the characteristic diastereotopic protons of the p-cymene group in the ¹H NMR spectra, which was emphasized by the presence of four doublets between 4 and 5 ppm (aromatic protons of p-cymene) and two doublets around 1 ppm (methyl groups of the isopropyl moiety). In addition to the p-cymene signals, a triplet and a quadruplet can be associated with the N-ethyl group of the phenothiazine moiety at 1.5 and 4.0 ppm, respectively. In the ESI-MS spectra (positive mode), the parent signal is always associated with the cationic complex [(p-cymene)RuLCl]⁺ after the loss of the counteranion.

Then, the antiproliferative activity of all complexes was determined on various cell lines using MTT assays, the NBC cell lines (MDA-MB-231, Hs578T and MCF-7) as well as the non-cancerous breast cells (fR2). The complexes were initially dissolved in DMSO, and stock solutions of 1.0 M concentration were used to prepare biological solutions (concentrations ranging from 10 nM to 10⁴ nM) for the in vitro tests, thus never exceeding 1% of DMSO. The stability of the complexes under physiological conditions was not studied in detail, however, aquation cannot be excluded [24], and the chelating ligand (L) is more strongly coordinated than the chloride, thus ensuring that the active complexes have an arene ruthenium phenothiazinyl-hydrazinyl-thiazolo structure. All cell lines were incubated for 24 h with the complexes RuL1–RuL4. The MTT values after 24 h incubation expressed as % of control according to the log(concentration, nM) were determined (Figure 1). The IC₅₀ values for each compound are presented in

Table 1. IC₅₀ values of RuL1–RuL4 determined from the MTT assays.

Cell Line Name	Compound	IC50 [µM]
MDA-MB-231	RuL1	1.496
	RuL2	0.449
	RuL3	14.125
	RuL4	0.229
Hs578T	RuL1	1.186
	RuL2	0.705
	RuL3	0.095
	RuL4	0.228
MCF-7	RuL1	14.514
	RuL2	0.654
	RuL3	0.019
	RuL4	0.247
fR2	RuL1	0.51
	RuL2	0.144
	RuL3	1.26
	RuL4	12.55

.

The MTT assays show that all complexes reduced the viability of breast cancer cell lines after 24 h of incubation at low μM concentrations. For the MCF-7 and MDA-MB-231 cancer cell lines, complexes RuL₁ and RuL₂ showed cell viability below 35% compared with the control experiment (cells incubated in the absence of complexes), while for the Hs578T cell lines, only RuL₂ reduced cell viability below 15%, with the other complexes having a lower inhibitory activity. Based on these MTT assays, the IC₅₀ values for each complex were determined (Table 1).

The lowest IC₅₀ value was recorded for RuL₃ (0.019 µM) on the double positive breast cancer cell line MCF-7, followed by the same complex on the triple negative breast cancer cell line Hs578T (0.095 µM). This complex showed the highest cytotoxicity among all complexes investigated but remained less cytotoxic on the triple negative breast cancer cell line MDA-MB-231 (14.125 µM). On the other hand, RuL₂ showed a high degree of cytotoxicity on all cancer cell lines, MCF-7 (0.654 µM), MDA-MB-231 (0.449 µM) and Hs578T (0.705 µM), compared with RuL₁, but was less cytotoxic than RuL₃ on the MCF-7 and Hs578T breast tumor cell lines. Overall, for complexes RuL₁ and RuL₂, the IC₅₀ values were much more homogenous and showed a superior correlation coefficient (R²), thus encouraging us to select RuL₁ and RuL₂ for further investigations.

The MTT results showed a decrease in cell proliferation, which could be associated with an increase in the number of apoptotic cells. Therefore, we evaluated the apoptosis rate of normal and breast cancer cell lines exposed to RuL₁ and RuL₂, at their respective IC₅₀ concentrations (Figure 2). Twenty-four hours after treatment, cell death was assessed via fluorescence microscopy after staining with DAPI (4′,6-diamidino-2-phenylindole), a dye that specifically stains cell nuclei. As shown in Figure 2A, DAPI staining of the control group displayed intact and round nuclei, indicating that cells were not undergoing apoptosis. In treated cells, the number of viable cells decreased and fragmented nuclei were observed. In addition, both compounds exhibited visible pro-apoptotic effects on breast cell lines at 24 h post-treatment. Interestingly, RuL₂ showed a higher percentage of apoptotic cells than RuL₁ (Figure 2B), with the most pronounced effect observed in fR2 cells for RuL₂, being in agreement with the MTT data.

We also evaluated the mode of action of RuL₁ and RuL₂ at the IC₅₀ concentrations. Based on the MTT and apoptosis results, we selected for the qRT-PCR (real-time quantitative reverse transcription PCR) genes, which were strongly involved in apoptotic processes including TNFSF10 (Tumor Necrosis Factor Superfamily Member 10), NOD1 (Nucleotide Binding Oligomerization Domain Containing 1), CASP8 (Caspase 8), FADD (Fas Associated via Death Domain), NAIP (NLR Family Apoptosis Inhibitory Protein), FAS (Fas Cell Surface Death Receptor), BAD (BCL2 Associated Agonist of Cell Death), p53 (tumor protein p53), TNF (Tumor Necrosis Factor), BAK1 (BCL2-antagonist/killer 1) and XIAP (X-Linked Inhibitor of Apoptosis).

In the normal cell line fR2, treatment with RuL₁ and RuL₂ led to specific changes in apoptotic gene expression, with RuL₁ causing downregulation of CASP8 and p53, while RuL₂ upregulated BAK; however, changes in NAIP, FAS, FADD and TNFSF10 were not statistically significant. In double positive MCF-7 cells, both complexes significantly increased the levels of pro-apoptotic genes including BAK, FAS, NAIP, CASP8, TNF, XIAP and BAD, although changes in p53, FADD and NOD1 lacked statistical significance, and TNFSF10 expression decreased without statistical relevance. For triple negative Hs578T cells, RuL₁ reduced TNFSF10 expression and enhanced levels of BAK, CASP8, XIAP, FADD, BAD and TNF, while RuL₂ similarly increased BAK, NAIP, CASP8 and TNF but caused only a slight and non-significant decrease in FAS expression. In triple negative MDA-MB-231 cells, RuL₁ treatment resulted in increased NOD1 and decreased p53 expression, with other genes showing non-significant changes, whereas RuL₂ significantly lowered p53, XIAP and TNFSF10 levels, with slight upregulation of BAK and non-significant alterations in NAIP, TNF, FADD and BAD.

In the case of the triple negative breast cancer cell line Hs578T, we observed that RuL₁ inhibited the relative gene expression of TNFSF10 in comparison with the control group. In addition, the expression levels of BAK1, CASP8, XIAP, FADD, BAD and TNF were statistically overexpressed compared with the control group. In the case of the FAS gene, the expression level was slightly decreased but not statistically significant. Otherwise, gene expression profiling in RuL₂ was statistically overexpressed compared with control (

Table 2. Gene expression assessments, as an effect of RuL₁ and RuL₂ treatment on breast cell lines (cut-off value of expression fold change FC ± 1.25 and p-value ≤ 0.05).

Cell Line	Compound	Gene	FC	p-Value
fR2	RuL1	CASP8	−2.36	0.0032
		p53	−1.72	0.0025
		TNFSF10	−2.21	0.0043
	RuL2	BAK	1.48	0.048
		CASP8	−1.84	5.12
		p53	−1.35	0.0080
MCF-7	RuL1	BAK	4.04	0.019
		FAS	3.43	0.0091
		NAIP	2.27	0.0013
		CASP8	4.51	0.0099
		TNF	18.51	0.0036
		XIAP	2.11	0.011
		BAD	2.27	0.021
	RuL2	BAK	4.04	0.011
		FAS	20.28	0.0043
		NAIP	3.98	0.0057
		CASP8	2.4	0.0069
		TNF	24.93	0.0069
		p53	1.56	0.16
		XIAP	2.13	0.0019
		FADD	1.91	0.10
		BAD	7.22	0.0044
Hs578T	RuL1	BAK	3.09	0.0044
		CASP8	2.02	0.019
		TNF	2.12	1.77
		XIAP	1.65	0.0056
		FADD	2.41	0.0091
		BAD	2.24	0.027
		TNFSF10	−5.5	0.035
	RuL2	BAK	5.79	8.86
		NAIP	3.15	0.022
		CASP8	3.37	0.0011
		TNF	12.36	0.00011
		p53	1.89	0.0034
		NOD1	2.31	0.0060
		XIAP	4.44	3.61
		FADD	5.34	0.0015
		BAD	2.92	0.0068
MDA-MB-231	RuL1	NOD1	1.44	0.030
		p53	−2.09	0.0021
	RuL2	p53	−1.58	0.0056
		XIAP	−1.72	0.0047
		TNFSF10	−2.32	0.014

, Figure 3). The second triple negative breast cancer cell line, MDA-MB-231, treated with RuL₁, did not alter the expression levels of the selected genes. The NOD1 gene exhibited a statistically upregulated level, while the p53 gene exhibited a statistically downregulated level compared with the control group. BAK and TNF genes showed an increased expression level and XIAP, FADD, TNFSF10 and BAD and a decreased profiling with no significant p values. RuL₂ statistically decreased significantly the expression of p53, XIAP and TNFSF10. However, RuL₂ slightly upregulated the BAK1 level and respectively decreased the NAIP, TNF, FADD and BAD levels, with no significant p values compared with the control group (Table 2, Figure 3).

3. Discussion

Ruthenium complexes trigger cell-specific responses with variable toxicity and subsequent cell fate depending on the type of breast cancer cells. The ruthenium complexes, in particular RuL₃ and RuL₂, showed potent cytotoxic effects against various breast cancer cell lines, with RuL₃ showing the highest cytotoxicity in both MCF-7 and Hs578T cells. The mechanism of action involves the induction of apoptosis, with variations in apoptotic gene expression profiles across the cell lines. This highlights the complex nature of ruthenium interactions with cancer cells.

The treatment of breast cancer cell lines with ruthenium complexes RuL₁ and RuL₂ resulted in significant alterations in the expression of key apoptotic genes, reflecting their potential as therapeutic agents. In normal fR2 cells, RuL₁ and RuL₂ predominantly affected CASP8 and p53, while RuL₂ also upregulated BAK. In the MCF-7 breast carcinoma cell line, both complexes notably increased the expression of pro-apoptotic genes such as BAK, FAS, NAIP, CASP8, TNF, XIAP and BAD, while reducing TNFSF10 levels. Similarly, in the triple negative breast cancer cell line Hs578T, RuL₁ decreased TNFSF10 and significantly upregulated BAK, CASP8, XIAP, FADD and BAD, while RuL₂ also enhanced BAK and CASP8 expression but had variable effects on the other genes. MDA-MB-231 cells treated with RuL₁ showed upregulation of NOD1 and downregulation of p53, while RuL₂ led to significant decreases in p53, XIAP and TNFSF10, with minor changes in other genes. These findings highlight the ability of ruthenium complexes incorporating phenothiazinyl-hydrazinyl-thiazolo ligands to modulate apoptotic pathways in a cell type-specific manner, confirming their potential utility in targeted cancer therapy.

4. Materials and Methods

All chemicals, reagents and solvents were purchased from commercial suppliers and used without further purification unless otherwise stated. The ¹H NMR spectra were recorded in solution (CDCl₃) at room temperature on a Bruker Avance II 400 spectrometer, using an internal standard. Elemental analyses were performed by the Mikroelementarisches Laboratorium, ETH Zürich. Mass spectra (electrospray ionization, positive-ion mode) were recorded with a Bruker FTMS 4.7T BioAPEX II mass spectrometer. The phenothiazinyl-hydrazinyl-thiazole derivatives (L1–L4) were prepared according to published method [23].

4.1. Synthesis and Characterization of Compounds RuL₁–RuL₄

The dinuclear complex [(p-cymene)RuCl₂]₂ (100 mg; 0.163 mmol) and the corresponding L₁–L₄ phenothiazinyl-hydrazinyl-thiazole (0.327 mmol) were dissolved in methanol (50 mL) and stirred at room temperature for 10 h. Then, the solvent was removed under vacuum. The residue was dissolved in dichloromethane (5 mL), and 200 mL of n-hexane was added to initiate the precipitation of the salts. The precipitate was filtered, washed several times with n-hexane, and dried under vacuum to give the corresponding product in good yield.

RuL₁: [(p-cymene)RuL₁Cl]Cl, yellow-green powder, yield 75%. ¹H NMR (CDCl_3, 400 MHz): δ = 1.02 (d, ³J_H-H = 6.6 Hz, 3H), 1.07 (d, ³J_H-H = 6.6 Hz, 3H), 1.52 (t, ³J_H-H = 7.0 Hz, 3H), 2.25 (s, 3H), 2.50 (sept, ³J_H-H = 6.6 Hz, 1H), 4.03 (q, ³J_H-H = 7.0 Hz, 2H), 4.05 (d, ³J_H-H = 5.7 Hz, 1H), 4.75 (d, ³J_H-H = 5.7 Hz, 1H), 4.82 (d, ³J_H-H = 5.7 Hz, 1H), 4.86 (d, ³J_H-H = 5.7 Hz, 1H), 6.76 (s, 1H), 6.98–7.01 (m, 3H), 7.20–7.22 (m, 2H), 7.58–7.60 (m, 3H), 7.83 (m, 1H), 7.97–7.98 (m, 2H), 8.32 (s, 1H), 9.14 (s, 1H), 15.35 (s, 1H) ppm. IR (KBr pellet): 2918 (m), 1575 (m), 1466 (s), 1384 (m), 1243 (m), 1053 (w), 752 (w) cm⁻¹. ESI-MS m/z (+): 699.1 [M-Cl]⁺. Anal. Calcd for C₃₄H₃₄N₄S₂Cl₂Ru: C, 55.65; H, 4.53; N, 7.64; S, 8.74. Found: C, 55.23; H, 4.33; N, 7.56; S, 8.64.

RuL₂: [(p-cymene)RuL₂Cl]Cl, yellow-orange powder, yield 77%. ¹H NMR (CDCl_3, 400 MHz): δ = 1.12 (d, ³J_H-H = 6.7 Hz, 3H), 1.21 (d, ³J_H-H = 6.7 Hz, 3H), 1.52 (t, ³J_H-H = 6.8 Hz, 3H), 2.35 (s, 3H), 2.46 (s, 3H), 2.86 (s, 3H), 3.18 (sept, ³J_H-H = 6.7 Hz, 1H), 4.03 (q, ³J_H-H = 6.8 Hz, 2H), 4.94 (d, ³J_H-H = 5.9 Hz, 1H), 5.27 (d, ³J_H-H = 5.9 Hz, 1H), 5.47 (d, ³J_H-H = 5.9 Hz, 1H), 5.58 (d, ³J_H-H = 5.9 Hz, 1H), 6.97–6.98 (m, 4H), 7.18–7.19 (m, 2H), 8.25 (s, 1H), 9.06 (s, 1H) ppm, 15.23 (s, 1H) ppm. IR (KBr pellet): 2921 (m), 1624 (s), 1468 (s), 1245 (m), 1110 (m), 751 (m) cm⁻¹. ESI-MS m/z (+): 679.1 [M-Cl]⁺. Anal. Calcd for C₃₁H₃₄N₄OS₂Cl₂Ru: C, 52.17; H, 4.66; N, 7.85; S, 8.99. Found: C, 52.12; H, 4.58; N, 7.71; S, 8.89.

RuL₃: [(p-cymene)RuL₃Cl]Cl, yellow-green powder, yield 68%. ¹H NMR (CDCl_3,400 MHz): δ = 1.08 (d, ³J_H-H = 6.5 Hz, 3H), 1.18 (d, ³J_H-H = 6.5 Hz, 3H), 1.48 (t, ³J_H-H = 6.7 Hz, 3H), 2.34 (s, 3H), 2.46 (s, 3H), 2.65 (sept, ³J_H-H = 6.5 Hz, 1H), 3.99 (q, ³J_H-H = 6.7 Hz, 2H), 4.93 (d, ³J_H-H = 5.6 Hz, 1H), 5.22 (m, 2H), 5.47 (d, ³J_H-H = 5.6 Hz, 1H), 6.46 (s, 1H), 6.95–6.96 (m, 4H), 7.16–7.17 (m, 2H), 8.25 (s, 1H), 9.11 (s, 1H), 15.02 (s, 1H) ppm. IR (KBr pellet): 2921 (m), 1623 (s), 1466 (s), 1242 (m), 1136 (m), 753 (m) cm⁻¹. ESI-MS m/z (+): 637.1 [M-Cl]⁺. Anal. Calcd for C₂₉H₃₂N₄S₂Cl₂Ru: C, 51.86; H, 4.65; N, 8.34; S, 9.55. Found: C, 51.77; H, 4.57; N, 8.24; S, 9.43.

RuL₄: [(p-cymene)RuL₄Cl]Cl, yellow-orange powder, yield 82%. ¹H NMR (CDCl_3, 400 MHz): δ = 1.09 (d, ³J_H-H = 6.7 Hz, 3H), 1.18 (d, ³J_H-H = 6.7 Hz, 3H), 1.33 (t, ³J_H-H = 7.1 Hz, 3H), 1.49 (t, ³J_H-H = 6.9 Hz, 3H), 2.37 (s, 3H), 2.62 (sept, ³J_H-H = 6.7 Hz, 1H), 2.82 (s, 3H), 4.00 (q, ³J_H-H = 6.9 Hz, 2H), 4.30 (q, ³J_H-H = 7.1 Hz, 2H), 4.93 (d, ³J_H-H = 5.6 Hz, 1H), 5.24 (m, 2H), 5.47 (d, ³J_H-H = 5.6 Hz, 1H), 6.96–6.97 (m, 4H), 7.14–7.15 (m, 2H), 8.25 (s, 1H), 9.08 (s, 1H), 15.92 (s, 1H) ppm. IR (KBr pellet): 2969 (m), 1599 (s), 1465 (s), 1372 (m), 1271 (m), 1098 (s), 753 (m) cm⁻¹. ESI-MS m/z (+): 709.1 [M-Cl]⁺. Anal. Calcd for C₃₂H₃₆N₄O₂S₂Cl₂Ru: C, 51.68; H, 4.74; N, 7.53; S, 8.62. Found: C, 50.05; H, 4.68; N, 7.41; S, 8.55.

4.2. Cell Lines and Cell Culture

Two human triple negative breast cancer cell lines, MDA-MB-231 and Hs578T, a double positive breast cancer cell line, MCF-7, and a normal breast cell line, fR2, were purchased from the American Type Culture Collection (ATCC). MDA-MB-231 cells were cultured in RPMI-1640 medium (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin-streptomycin (Gibco). The Hs578T cell line was maintained in D-MEM high glucose supplemented (Gibco) with 10% FBS, 1% penicillin-streptomycin, 2 mM L-glutamine (Gibco), 0.01 mg/mL insulin, 1% MEM-NEEA (MEM Non-Essential Amino Acids Solution, Gibco) and 1% penicillin-streptomycin. The MCF-7 cell line was cultured in MEM (Minimum Essential Medium Eagle, Gibco) supplemented with 10% FBS, 2 mM L-glutamine, 1% MEM-NEEA and 1% penicillin-streptomycin. Normal breast cells, fR2, were cultured in RPMI-1640, 10% FBS, 0.01 mg/mL insulin and 1% penicillin-streptomycin. The cells were grown in a humidified atmosphere at 37 °C with 5% CO₂.

4.3. Cell Viability Assay

Cell viability was assessed by the MTT assay (MTT = 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide) in accordance with the manufacturer’s protocol. At a seeding density of 10⁴ cells/well, cells were seeded in a 96-well plate and incubated at 37 °C with 5% CO₂. Twenty-four hours after incubation, the cells were treated with the appropriate therapeutic dose of the RuL₁–RuL₄ and incubated for 24 h. The complexes were initially dissolved in DMSO, and stock solutions of 1.0 M concentration were used to prepare the biological solutions (concentrations ranging from 10 nM to 10⁴ nM). To evaluate the proliferative activity of the cells, 1 mg/mL MTT solution was added and incubated for 1 h. The formazan obtained after intracellular reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide was spectrophotometrically quantified by dissolving formazan in dimethyl sulfoxide and measuring the absorbance after 15 min using a plate reader at a wavelength of 570 nm.

4.4. DAPI Staining

Nucleus traits were assessed using DAPI staining, 10⁴ cells/well were seeded and treated with RuL₁ or RuL₂ 24 h later, and after incubation, DAPI solution was added to each well and incubated for a further 5 min at 37 °C. After rinsing with 1X PBS, fluorescence microscopy was used to visualize nucleus features.

4.5. RNA Extraction, cDNA Synthesis and RT-PCR

Cells (seeding density of 5 × 10⁵ cells/well) were treated with the appropriate IC₅₀ doses of RuL₁–RuL₄, determined for each cell line, and incubated for 24 h. Total RNA was extracted from all cell lines using TriReagent (Invitrogen) in agreement with the producer’s procedure. RNA concentration and quality were assessed using a Nanodop-1000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). The amount of 1000 ng of total RNA was reversed transcribed into cDNA using a Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland) based on the producer’s guidelines.

The gene expression evaluation was conducted using a TaqMan Fast Advanced Master Mix (Applied Biosystems, Waltham, MA, USA) based on the producer’s guidelines and qRT-PCR was performed on a ViiA7 System (Applied Biosystems). Each sample was analyzed in duplicate in a 10 µL volume using a 384-well plate.

The internal standard controls used were 18S and GAPDH rRNA, and the genes evaluated were BAK, FAS, NAIP, CASP8, TNF, p53, NOD1, XIAP, FACC, TNFSF10 and BAD. Data analysis was performed using the Qiagen online tool based on the ΔΔCt method. (https://www.qiagen.com/us/service-and-support/learning-hub/technologies-and-research-topics/rna-universe/gene-expression/data-analysis/, accessed on 1 November 2022).

TNFSF10: right CAGAGCCTTTTCATTCTTGGA: left CCTCAGAGAGTAGCAGCTCACA

NOD1: right GGCGAGATACTTCCCTCCTT: left GAATGCAAAGGCCTCACG

CASP8: right TTTCTGCTGAAGTCCATCTTTTT: left TAGGGGACTCGGAGACTGC

FADD: right AGGTCTAGGCGCTCTGC: left CCGAGCTCAAGTTCCTATGC

NAIP: right TGGGAGAATCCTCTCGTCAGA: left CTGGCCAGCATTCTCCTCTA

FAS: right GAGACGAAGCTCACGAAAAGC: left GGCCAAGTTGCTGAATCAAT

BAD: right GCTTCCTCTCCCACCGTAG: left ACCCGGAGACAGATGAG

p53: left TCAACAAGATGTTTTGCCAACTG: right TGTGCTGTGACTGCTTGTAGATG

TNF right GGGGAACTCTTCCCTCTG: left CAGCCTCTTCTCCTTCCTGAT

BAK1: right CCGCGAGACTCCAGTGAT: left GGCCCACAGAGCAACTTCC

GAPDH: right CACCTTCCCCATGGTGTCT: left CCCCGGTTTCTATAAATTGAGC

18S: right CGCTCCACCAACTAAGAACG: left CTCAACACGGGAAACCTCAC

4.6. Statistical Analysis

Results are reported as mean ± SD (standard deviation). The differences between the analyzed RuL₁–RuL₄ activity on cancer cells and controls were analyzed using the t-test (p ≤ 0.005 was considered statistically significant). Statistical analyses were performed using GraphPad Prism version 6 software [26] and STRING 8.0 free version [25].

5. Conclusions

Four new monocationic arene Ru(II) complexes with bidentate phenothiazinyl-hydrazinyl-thiazolo ligands were prepared and their cytotoxicity, antiproliferative activity and alteration of apoptotic gene expression were investigated on three cancer cell lines, a double positive breast cancer cell line, MCF-7, and two triple negative breast cancer cell lines, Hs578T and MDA-MB-231. Two complexes, RuL₁ and RuL₂, have shown significant alterations in the expression of key apoptotic genes, highlighting the ability of such complexes to modulate apoptotic pathways in a cell type-specific manner, thus confirming their potential as anticancer agents. Future research should focus on elucidating the detailed mechanisms of cellular internalization in view of generating ruthenium complexes with enhanced selectivity and efficacy toward tumor cells, while minimizing off-target effects on normal cells.