A Phylogenetic and Taxonomic Revision of Discula theae-sinensis, the Causal Agents of Anthracnose on Camellia sinensis
College of Life Science, Capital Normal University, Xisanhuanbeilu 105, Haidian, Beijing 100048, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
J. Fungi 2024, 10(2), 141; https://doi.org/10.3390/jof10020141
Submission received: 18 December 2023
/
Revised: 21 January 2024
/
Accepted: 7 February 2024
/
Published: 9 February 2024
(This article belongs to the Special Issue Plant Pathogenic Fungi: Taxonomy, Phylogeny and Morphology)
Abstract
:Tea (Camellia sinensis (L.) Kuntze) is one of the most important economic plants in China, and has many benefits for human health. Anthracnose is one of the most serious diseases of tea in China, and control of the fungus is important since most Chinese cultivars are susceptible to it. The agent of tea anthracnose was initially described as Gloeosporium theae-sinensis I. Miyake in Japan, which was later transferred to Discula, but this taxonomic position remains problematic. To shed light on these taxonomic and phylogenetic issues, the tea anthracnose pathogens were re-studied. Combining the morphological characteristics and a multigene phylogenetic analysis of nrITS, nrLSU, rpb2, and tef1 sequence data, a new genus Sinodiscula was proposed to accommodate the causal fungi of tea anthracnose, including a new species Sinodiscula camellicola and a new combination Sinodiscula theae-sinensis. Furthermore, the pathogenicity of the pathogens was determined according to Koch’s postulates. This study thoroughly resolves the long-standing taxonomic and phylogenetic problems of the tea anthracnose pathogens.
1. Introduction
Tea (Camellia sinensis (L.) Kuntze), as one of the most popular non-alcoholic beverages, contains various chemical ingredients that are beneficial to human health, which can effectively reduce the risk of human diseases [1,2,3,4,5,6], and is loved by consumers worldwide. At present, China is home to 18 major tea-producing provinces, with a total tea plantation area of approximately 3.3303 hectares [6,7]. In 2022, China’s total output of tea reached 3.1810 million tons, with a national total output value of CNY 318.068 billion, making it the leading producer and exporter of tea worldwide [7]. Camellia sinensis has emerged as one of the most crucial economic crops in southern China, particularly in mountainous regions [6,8].
Anthracnose is a highly detrimental disease affecting tea plants in both Japan and China [8,9,10], and has also been reported in Sri Lanka [11]. In Japan, tea anthracnose is regarded as one of the three major diseases affecting tea plantations, together with the tea exobasidium blight and the tea white scab [11]. Anthracnose causes extensive necrosis and abscission of tea leaves, leading to adverse effects on tea plant growth, as well as decreased yield and quality of tea [8,12].
The causal fungus of anthracnose was first described as Gloeosporium theae-sinensis I. Miyake (Dilocarpon, Drepanopezizaceae, Helotiales, Leotiomycetidae, Leotiomycetes, Pezizomycotina) in Japan [13]. Yamamoto [14] transferred G. theae-sinensis to the genus Colletotrichum Corda (Glomerellaceae, Glomerellales). This combination, however, was invalid because Yamamoto did not cite its basionym (ICBN, Vienna Art 33.4). Moriwaki and Sato [9] transferred G. theae-sinensis to Discula (Gnomoniaceae, Diaporthales) based on morphological and molecular data. However, Discula species are known as polyphyletic, and Discula theae-sinensis is phylogenetically distant from the type species of Discula; the taxonomic position of Discula theae-sinensis is still unclear [15,16].
In China, the pathogen of tea anthracnose was initially reported as Gloeosporium theae-sinensis [17], and this name continues to be used to this day [5,8,10,18]. Until 2023, the name Discula theae-sinensis has been adopted [18]. Recently, tea anthracnose has been on the rise in high-humidity and low-lying tea areas in Hunan, Fujian, Zhejiang, Guizhou, and other provinces, resulting in substantial economic losses for tea plantations and posing a serious threat to the tea industry [7,19,20].
The objective of this study is to revise the taxonomy and phylogenetics of the causal agent of tea anthracnose. A total of 32 strains of the pathogens of tea anthracnose were obtained from diseased leaves of the tea in Anhui, Hubei, and Zhejiang Provinces, China. Based on morphological characteristics and multigene phylogenetic analysis (nrITS, nrLSU, rpb2, and tef1), a new genus Sinodiscula is introduced and a novel species and a new combination are proposed. We expect our findings to provide a reference for the effective prevention and control of tea anthracnose on Camellia sinensis.
2. Materials and Methods
2.1. Fungal Collection and Isolation
Disease leaves of tea anthracnose were collected from the tea leaves collected in Anhui, Hubei, and Zhejiang Provinces, China. Each sample was marked and placed in kraft bags, brought back to the lab, and preserved at room temperature before being processed. The tissues at the junction of disease and health were cut into 5 mm2 fragments and disinfected in 75% ethanol for 30 s followed by 10% sodium hypochlorite for 5 min and washed in sterile water three times. The fragments were then placed on potato dextrose agar (PDA) and incubated at room temperature for a month. The cultures are deposited in the China Forestry Culture Collection Center (CFCC) and the Mycology Laboratory of Capital Normal University (CNUML), Beijing, China.
2.2. Morphological Studies
Cultures were transferred to PDA culture medium at room temperature under a dark light environment and growth rates were observed daily for a month, including colony color, texture, and the conidiomata; the cultures’ color was described according to the color charts of Rayner [21]. Spores were produced at room temperature, naturally. Cultures were examined periodically for sporulation. Conidia were taken from pycnidium and placed in sterilized water. The diseased tissues with large black small spots were picked out from the tea leaves, then 3–5 mm2 small fragments were cut out and placed under a stereo microscope to be cut as thin as possible. The cut fragments were placed in sterile water, and the darker part was picked for microscopic examination of the cross-section of the conidioma. Aniline blue (cotton blue) was used to stain colorless structures (conidiomata, conidiogenous cells, and conidia). The shape and size of microscopic structures were observed and noted using a light microscope (Olympus DP71, Tokyo, Japan).
2.3. DNA Extraction, PCR Amplification, and Sequencing
The diseased leaves with conidiomata were picked out from the dried tea leaves, then 2 mm2 small fragments were cut out and crushed by shaking for 45 s at 30 Hz 2–4 times (Mixer Mill MM301, Retsch, Haan, Germany) in a 1.5 mL tube together with 3 mm diam. tungsten carbide balls, and total genomic DNA was extracted using M5 Plant Genomic DNA Kit (Mei5 Bioservices Co., Ltd., Beijing, China) following the manufacturer’s instructions. Total genomic DNA was extracted from fresh mycelium that was gained by scraping the surface of 7-day-old colony on PDA, using M5 Plant Genomic DNA Kit following the manufacturer’s instructions. This result is consistent with the positive control result, which proves the accuracy of the experimental data. PCR amplification and sequencing of the LSU nrDNA region using the primer pair LROR/LR5 [22,23], ITS nrDNA region using primer pair ITS1F/ITS4 [24,25], rpb2 region using the primer pair fRPB2-5f/ fRPB2-7cR [26], and tef1 region using primer pair EF1-728f/EF2 [27,28] were performed (Table 1).
In order to accurately identify pathogenic fungi, the sequences of ITS, nrLSU, rpb2, and tef1 were amplified from the type strain of Discula theae-sinensis (MAFF 752003) for further research.
The temperature profile for both ITS nrDNA and LSU nrDNA was an initial denaturing step for 2 min at 94 °C, followed by 35 amplification cycles of denaturation at 94 °C for 60 s, annealing at 58 °C for 60 s and extension at 72 °C for 90 s, and a final extension step of 72 °C for 10 min [29]. The temperature profile for the rpb2 was initial denaturation at 94 °C for 120 s, followed by 35 amplification cycles of denaturation at 95 °C for 45 s, annealing at 57 °C for 50 s, and extension at 72 °C for 90 s [24]. The temperature profile for tef1 was initial denaturation at 94 °C for 120 s, followed by 35 amplification cycles of denaturation at 95 °C for 30 s, 58 °C for 50 s, 72 °C 60 s [30]. PCR productions were estimated visually in agarose electrophoresis gel by comparing band intensity with a DNA ladder of 200 bp, purified and sequenced by Zhongkexilin Biotechnology Co., Ltd. (Beijing, China).
2.4. Phylogenetic Analyses
The new sequences were submitted to the GenBank database and additional sequences of ITS, nrLSU, rpb2, and tef1 included in this study were downloaded from GenBank (Table 2). Sequences of further taxa were included, and isolates were selected to represent each of the 31 known families in the Diaporthales based on the latest available literature. The ITS, nrLSU, rpb2, and tef1 datasets were aligned with MAFFT [31], and then manually corrected visually in Se-Al v.2.03a [32]. Ambiguously aligned regions were not used in the analyses. A combined dataset of ITS, nrLSU, rpb2, and tef1 sequences was prepared and analyzed using the maximum parsimony method performed with PAUP * 4.0b10 [33]. Maximum parsimony analysis was conducted using heuristic searches with 1000 replicates of random-addition sequence, tree bisection reconnection (TBR) branch swapping, and no maxtree limit. All characteristics were equally weighted and unordered. Gaps were treated as missing data to minimize homology assumptions. A bootstrap analysis was performed with 1000 replicates, each with 100 random taxon addition sequences. Maxtree was set to 1000, and TBR branch swapping was employed. For the Bayesian analysis, MrModeltest 2.3 with the Akaike information criterion (AIC) was used to choose the substitution model for each gene: GTR + I + G for ITS, nrLSU, and rpb2, HKY + I + G for tef1. The Bayesian analysis was performed with MrBayes 3.1.2 [34,35]. The analyses of four chains were conducted for 100,000,000 generations with the default settings and sampled every 100 generations, halting the analyses at an average standard deviation of split frequencies of 0.01. The first 25% of trees were removed as burn-in. Bayesian posterior probabilities (PP) were obtained from the 50% majority rule consensus of the remaining trees. Maximum likelihood (ML) analysis was performed with IQ-TREE 2.2.0 [36], the substitution model for each gene: TIM2e + I + G4 for ITS, TIM3e + I + I + R3 for nrLSU, TN + F + I + G4 for rpb2, and HKY + F + I + I + R4 for tef1, respectively. ML bootstrap replicates (1000) were computed in IQ-TREE using a rapid bootstrap analysis and search for the best-scoring ML tree. We only considered clades supported by bootstrap values (MLB) ≥70% for the ML analysis, supported by bootstrap values (MPB) ≥ 70% for the MP analysis, and supported by PP ≥ 95% for Bayesian inference. The final alignments and the retrieved topologies were deposited in TreeBASE (http://www.treebase.org, accessed on 13 January 2024), under accession ID: 31091.
2.5. Pathogenicity Tests
The isolates CFCC 1914-2-2 and CFCC 107-4-1 were selected to fulfill Koch’s postulates. Healthy one-year-old seedlings of Camellia sinensis with a height of approximately 0.2 m were obtained from Anhui Province. Each isolate was inoculated on three separate seedlings and three leaves were selected on each seedling for inoculation. Before the pathogenicity experiment, the surfaces of the leaves were sprayed with 75% alcohol 2–3 times, and then the above operation was repeated with sterile water to remove the residual alcohol; then, they were dried with absorbent paper, or we waited for the surfaces to dry [37]. Sterilized needles (0.5 mm diam.) were used to wound five times in the middle parts of each disinfected leaf close to the margins on both sides. The 5 mm PDA medium plugs with mycelia from a 5-day-old culture were inoculated on the left side of the wounded leaves, and sterile PDA plugs without mycelia were inoculated in parallel on the right side of the wounded leaves as control, and repeated three times. A conidial suspension was also used for inoculation. When testing conidial suspensions (106 per mL in sterile distilled water), 10 μL of the suspension was deposited on one side of the tested leaves using a syringe, with 10 μL of sterile water acting as control on the opposite side. However, like the results obtained by Li et al. [18], the spore suspension could not bring about obvious disease spots. Each inoculated tea plant was placed in a light incubator at 28 °C and 75% relative humidity with a 12/12 h light/dark photoperiod, and the disease progression of the leaves was regularly observed. The experiment was repeated three times. To complete Koch’s postulates, as previously mentioned, the fungi were reisolated from the margin tissue of the diseased lesions that developed from the inoculated tissue and were identified via molecular and phylogenetic analysis.
3. Results
3.1. Molecular Phylogeny
The sequence dataset of Diaporthales including 32 strains from this study and 114 reference strains from recent studies was analyzed based on ITS, nrLSU, rpb2, and tef1 [38,39,40,41,42,43,44,45,46], and Ceratosphaeria aquatica Z.L. Luo, K.D. Hyde and H.Y. Su and Pyricularia grisea Cooke ex Sacc. as the outgroups. The multi-gene dataset (gene boundaries of ITS: 1–534, nrLSU: 535–1317, rpb2: 1318–2228, tef1: 2229–3132) comprised 3132 characters including the alignment gaps, of which 1647 were parsimony-informative, 213 parsimony-uninformative, and 1272 constant. The MP analysis of sequences resulted in one most parsimonious tree (Figure 1) with a length (TL) of 13,431 steps, consistency index (CI) of 0.280, retention index (RI) of 0.714, rescaled consistency index (RC) of 0.200, and homoplasy index (HI) of 0.720.
Based on the combined four-gene (ITS-nrLSU-rpb2-tef1) analysis, all Diaporthales species are supported as one clade (MLB = 100, MPB = 100, PP = 1.00). The 147 isolates clustered in 32 clades corresponding to 31 families in Diaporthales.
The isolates of the pathogen of tea anthracnose we obtained, clustered into a novel phylogenetic taxon within Melanconiellaceae, which formed a strong support clade (MPB = 100, MLB = 100, PP = 1.00) and are distinct from their closest relatives classified in Greeneria Scribn. and Viala, Melanconiella Sacc., Microascospora Senan. and K.D. Hyde., Paraphomopsis Udayanga and Castl., or Septomelanconiella Samarak. and K.D. Hyde. In this clade, there are two subclades with high support values, among them, the type strain of Discula theae-sinensis (MAFF 752003) is clustered in clade 2 (Figure 1).
3.2. Taxonomy
Sinodiscula M. J. Guo and C. L. Hou, gen. nov.—MycoBank MB851774.
Etymology. sino (lat.) = China, referring to the specimens collected in China.
Asexual morph: The front of the lesion is scattered with many black, small protruding granules that are pycnidial conidiomata. Conidiomata acervular, irregularly round or oval, erumpent to immersed, solitary, scattered. Conidiogenous layer covering the entire inner surface of acervular chambers and mostly in basal layer, yellowish-brown, initially developing under epidermis, then breaking through epidermis and forming thick whitish amorphous conidial masses. Conidiophores acropleurogenous, branched or sympodially branched, cylindrical, aseptate. Conidiogenous cells enteroblastic, phialidic, cylindrical, straight or slightly curved, crowded, terminal, slightly tapering toward apex. Conidia abundant, small, acrogenous, hyaline, fusiform to obovoid, often biguttulate, tapered at base or both ends.
Sexual morph: Undetermined.
Type species: Sinodiscula theae-sinensis (I. Miyake) M. J. Guo and C. L. Hou, described below.
The multiple-gene phylogenetic analysis shows that sequence data obtained from specimens cited below for species of Sinodiscula form an independent clade with high support values (MLB = 100, MPB = 100, PP = 1.00). Morphologically, Sinodiscula can be distinguished from its closely related genera Greeneria, Melanconiella, Microascospora, Paraphomopsis, and Septomelanconiella. In contrast to the new genus, the asexual morph of Melanconiella usually consists of septate only at the base and hyaline to light brown conidiophores, annellidic or phialidic conidiogenous cells, dark brown melanconium-like or hyaline discosporina-like conidia [46,47]. Similarly, the genus Greeneria, which is typified by Greeneria uvicola (Berk. and M.A. Curtis) Punith., forms pale brown conidia, variously shaped ranging from fusiform, oval, to ellipsoidal, each with a truncate base and obtuse to bluntly pointed apex [48]. The asexual morph of Paraphomopsis distinct from Sinodiscula by pycnidia with a slightly elongated, black neck, wider toward the apex at maturity [46]. The asexual morph of Septomelanconiella distinct from Sinodiscula by mature conidia cylindrical to clavate, straight or slightly curved, brown, 1-euseptate, more often with six unequal lumina, guttulate, dark brown at the base [49]. Although the asexual morph of Microascospora remains undetermined, Microascospora is distantly related to Sinodiscula in the phylogeny presented (Figure 1). Additionally, the sexual morph of Microascospora is distinct from other genera in the same family having immersed, solitary ascomata with narrow papilla with smaller hyaline, aseptate ascospores bearing long appendages [40,41,46].
Sinodiscula camellicola S. Y. Zhao, M. J. Guo, and C. L. Hou, sp. nov.—MycoBank MB851775; Figure 2.
Diagnosis: The new species is similar to Sinodiscula theae-sinensis, but differs by the scattered and dark-blown conidiomata with slight raising above the surface of the host tissue at maturity, the bigger conidiomata pycnidial, and the L/W ratio of conidia.
Holotype: China. Anhui Province, Jingde County, Wuguiling, 30.2503 N; 118.3519 E, alt. ca. 392 m, on leaves of Camellia sinensis, May 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 107-4-1.
Etymology: Referring to the host plant, Camellia sinensis.
On leaves of Camellia sinensis: Conidiomata scattered, round to elliptical or slightly irregular, 160–270 μm diam., dark brown, slight raising above the surface of the host tissue at maturity, opening by an ostiole to liberate the conidia. In the vertical section, conidiomata intraepidermal.
On PDA: Vegetative hyphae 2–5 μm, hyaline, smooth-walled, septate, branched. Conidiomata and Conidiophores formed on a cushion of angular brown cells. Without setae. Conidiomata pycnidial, globular, scattered, immersed in the medium, forming a chamber, erumpent, fuscous to black, 730–1380 μm diam., yellowish to cream conidial drops exuding from the ostioles. Conidiophores acropleurogenous, branched or sympodially branched, cylindrical, aseptate. Conidiogenous cells phialidic, cylindrical, straight or slightly curved, crowded, terminal, slightly tapering toward apex, 7–20 μm × 0.7–2.0 μm, opening 0.4–0.9 μm diam. Conidia small, hyaline, aseptate, smooth-walled, often biguttulate, fusiform to obovoid, tapered at base or both ends, 4.33–5.96 μm × 1.80–2.66 μm, av. ± SD = 5.07 ± 0.41 μm × 2.12 ± 0.20 μm, L/W ratio = 2.40 (n = 30).
Culture characteristics: Colony at first white, covered with medium after 15–20 d, becoming olivaceous after 25–30 days. The colony is flat, felty with a thick texture at the center and marginal area, aerial mycelium unconspicuous. Conidiomata sparse, irregularly distributed over agar surface, yellowish mucous conidia were produced on the colony.
The sexual morph: Undetermined.
Additional specimens examined: CHINA. Anhui Province, Jingde County, Niqiuwu, 30.2530 N; 118.3439 E, alt. ca. 460 m, on leaves of Camellia sinensis, May 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 106-1-2, CNUCC 106-2-1, and CNUCC 106-3-3; CHINA. Anhui Province, Jingde County, Wuguiling, 30.2503 N; 118.3519 E, alt. ca. 392 m, on leaves of Camellia sinensis, May 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 107-3-2; CHINA. Anhui Province, Jingde County, Wuguiling, 30.2504 N; 118.3520 E, alt. ca. 390 m, on leaves of Camellia sinensis, May 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 108-2-1; CHINA. Anhui Province, Jingde County, Niqiuwu, 30.2532 N; 118.3440 E, alt. ca. 465 m, on leaves of Camellia sinensis, May 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 110-3-3; CHINA. Anhui Province, Jingde County, Yunle, 30.2538 N; 118.3520 E, alt. ca. 430 m, on leaves of Camellia sinensis, May 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 111-1-3; CHINA. Anhui Province, Jingde County, Niqiuwu, 30.2533 N; 118.3439 E, alt. ca. 464 m, on leaves of Camellia sinensis, May 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 112-2-1, CNUCC 112-2-4, and CNUCC 112-3-3; CHINA. Anhui Province, Jingde County, Niqiuwu, 30.2532 N; 118.3432 E, alt. ca. 432 m, on leaves of Camellia sinensis, May 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 114-2-3; CHINA. Anhui Province, Jingde County, Niqiuwu, 30.2522 N; 118.3449 E, alt. ca. 413 m, on leaves of Camellia sinensis, May 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 117-1-3 and CNUCC 117-4-4; CHINA. Hubei Province, Yichang City, Muyu Town, 31.4620 N; 110.3980 E, alt. ca. 950 m, on leaves of Camellia sinensis, May 2019, C.L. Hou and Q.T. Wang, living culture CNUCC 345-2-3; CHINA. Anhui Province, Jingde County, Yunle, 30.2537 N; 118.3640 E, alt. ca. 445 m, on leaves of Camellia sinensis, May 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 1297-2-1.
In the ITS-nrLSU-mtSSU rDNA phylogenetic tree, the molecular sequences of Sinodiscula camellicola closely related to the type species Sinodiscula theae-sinensis. Morphologically, this new species is similar to S. theae-sinensis, but differs by the scattered and dark-blown conidiomata with slight raising above the surface of the host tissue at maturity, the bigger conidiomata pycnidial (240–630 μm diam. vs. 730–1380 μm diam.), and the L/W ratio of conidia (2.20 vs. 2.40). In addition, S. camellicola is distinctly separated from S. theae-sinensis in gene sequences analysis, the ITS gene shown 86–91% identify, the nrLSU gene shown 93–94% identify.
Sinodiscula theae-sinensis (I. Miyake) M. J. Guo and C. L. Hou, comb. nov.—MycoBank MB851776; Figure 3.
=Discula theae-sinensis (I. Miyake) Moriwaki & Toy. Sato, J. Gen. Pl. Path. 75(5): 359 (2009).
=Gloeosporium theae-sinensis I. Miyake, Bot. Mag., Tokyo 21: 44 (1907).
Type. MAFF 752003 (lectotype), isolated from C. sinensis, Shiga Pref., Japan, 1984, collected by M. Oniki [50].
Specimen examined. CHINA. Anhui Province, Jingde County, Yunle, 30.2536 N; 118.3602 E, alt. ca. 417 m, on leaves of Camellia sinensis, Apr 2017, C.L. Hou and Q.T. Wang, living culture CNUCC 98B-1-2 and CNUCC 98B-2-2; CHINA. Anhui Province, Jingde County, Yunle, 30.2620 N; 118.3580 E, alt. ca. 463 m, on leaves of Camellia sinensis, Apr 2017, C.L. Hou and Q.T. Wang, living culture CNUCC 100B-1-3 and CNUCC 100B-3-1; CHINA. Anhui Province, Jingde County, Niqiuwu, 30.2532 N; 118.3440 E, alt. ca. 465 m, on leaves of Camellia sinensis, May 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 110-4-2; CHINA. Anhui Province, Jingde County, Yunle, 30.2538 N; 118.3520 E, alt. ca. 430 m, on leaves of Camellia sinensis, May 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 111-2-3; CHINA. Zhejiang Province, Wenzhou City, Rui’an City, Hongshuang Forest, 27.7885 N; 120.6580 E, alt. ca. 635 m, on leaves of Camellia sinensis, Nov 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 269B-1-1; CHINA. Anhui Province, Jingde County, Yunle, 30.2537 N; 118.3640 E, alt. ca. 445 m, on leaves of Camellia sinensis, May 2018, C.L. Hou and Q.T. Wang, living culture CNUCC 1297-2-2, CNUCC 1297-3-1, CNUCC 1297-4-1, and CNUCC 1297-4-4; CHINA. Zhejiang Province, Changshan County, Quzhou, Changshan Oil Tea Park, 29.0350 N; 118.3614 E, alt. ca. 140 m, on leaves of Camellia sinensis, May 2023, M.J. Guo, L. Zhuo, and C.L. Hou, living culture CNUCC 1887-3-1; CHINA. Anhui Province, Jingde County, Houjiazhuang, 30.2514 N; 118.3548 E, alt. ca. 335 m, on leaves of Camellia sinensis, May 2023, M.J. Guo, L. Zhuo, and C.L. Hou, living culture CNUCC 1900-4-3, 1900-7-3; CHINA. Anhui Province, Jingde County, Houjiazhuang, 30.2504 N; 118.3522 E, alt. ca. 352 m, on leaves of Camellia sinensis, May 2023, M.J. Guo, L. Zhuo, and C.L. Hou, living culture CNUCC 1914-2-2, 1914-3-3.
On leaves of Camellia sinensis: Conidiomata scattered or coalesced, round to elliptical or slightly irregular, 130–260 μm diam., black, strongly raising above the surface of the host tissue at maturity, opening by an ostiole to liberate the conidia. In the vertical section, conidiomata intraepidermal.
On PDA: Vegetative hyphae 2–5 μm, hyaline, smooth-walled, septate, branched. Conidiomata and Conidiophores formed on a cushion of angular brown cells. Without setae. Conidiomata pycnidial, globular, scattered, immersed in the medium, forming a chamber, erumpent, fuscous to black, 240–630 μm diam., yellowish to cream conidial drops exuding from the ostioles. Conidiophores acropleurogenous, branched or sympodially branched, cylindrical, aseptate. Conidiogenous cells phialidic, cylindrical, straight or slightly curved, crowded, terminal, slightly tapering toward apex, 10–25 μm × 1–2.5 μm, opening 0.5–1 μm diam. Conidia small, hyaline, aseptate, smooth-walled, often biguttulate, fusiform to obovoid, tapered at base or both ends, 4.15–5.39 μm × 1.20–2.73 μm, av. ± SD = 4.72 ± 0.34 × 2.19 μm ± 0.25 μm, L/W ratio = 2.20 (n = 30).
Culture characteristics: Colony at first white, covered with medium after 15–20 d, becoming olivaceous after 25–30 days. The colony is flat, felty with a thick texture at the center and marginal area, aerial mycelium unconspicuous. Conidiomata sparse, irregularly distributed over agar surface, yellowish mucous conidia were produced on the colony.
The sexual morph: Undetermined.
The multi-locus gene analysis indicates that the sequences of the type strain MAFF 752003 described as Discula theae-sinensis clustered with other 16 strains in one subclade with high support values (MPB = 100, MLP = 100, PP = 1.00), and not clustered with Apiognomonia veneta (Sacc. and Speg.) Höhn., the teleomorph of Discula nervisequa (Fuckel) M. Morelet, the type species of Discula. Moreover, the morphological observation showed that the strains in this subclade are consistent in morphology. Therefore, we propose a new combination for the present fungus as follows, Sinodiscula theae-sinensis.
3.3. Pathogenicity Tests
For each species of Sinodiscula, a representative isolate was selected for the pathogenicity test (CNUCC 1914-2-2 from Sinodiscula theae-sinensis, CNUCC 107-4-1 from Sinodiscula camellicola). Two isolates of Sinodiscula were pathogenic, and the inoculated tea leaves showed lesions similar to the previous symptoms that were observed naturally; nevertheless, the controls remained healthy 7 days after inoculation. Infection occurred from the wound, gradually forming significantly dark lesions on the tea leaf surface (Figure 4). The mean spot size of infected leaves and the incidence of infection are shown in Table 3. The fungi were re-isolated from the lesions and cultured on PDA to verify Koch’s postulates.
4. Discussion
In this study, fresh collections of diseased specimens, pure cultures, and multi-locus phylogenetic analysis were used to address the taxonomic and phylogenetic challenges related to the causal fungi of tea anthracnose in China, contributing toward a better understanding of the causal fungi of tea anthracnose in China, and providing clear pathogen information for the further evaluation of the disease control strategies.
As research has progressed, the tea anthracnose pathogen Gloeosporium theae-sinensis has undergone several taxonomic changes and has been successively transferred to different genera, namely, Colletotrichum and Discula [9,14]. However, the morphology of Gloeosporium theae-sinensis is characterized by the small conidia, which are much smaller than those of any other species of Colletotrichum [13,50]. And as shown in the study of Moriwaki and Sato [9], the conidiogenous cells of the strains of Gloeosporium theae-sinensis examined were ampoule-to-tenpin-shaped, like those of the type species of Apiognomonia veneta (Sacc. and Speg.) Höhn., the teleomorph of Discula nervisequa (Fuckel) M. Morelet (Gnomoniaceae, Diaporthales, Ascomycota), rather than a cylindrical shape as in Colletotrichum spp. [51,52]. Phylogenetically, the strains isolated from the lesion of anthracnose of tea indeed fell in the same clade of Diaporthalean fungi with high supports, but did not form a clade with any species in this family [9]. Therefore, Moriwaki and Sato suggested that this fungus should belong to the genus Discula [9]. In this study, the morphological and molecular phylogenetic analyses indicate that the isolates of the causal fungus of the tea anthracnose belong to Melanconiellaceae, but cannot be classified within any existing genus of Melanconiellaceae. Therefore, a novel genus Sinodiscula is proposed in this study, typified by the new combination Sinodiscula theae-sinensis, and a new species Sinodiscula camellicola is also described. Indeed, these two species exhibit remarkable morphological similarities and lack significant differences in terms of pathogenicity, which presents challenges in their differentiation. However, there is a noticeable molecular distinction between Sinodiscula camellicola and Sinodiscula theae-sinensis, underscoring the importance of molecular markers in distinguishing between these two species. Further comparative research using genomic approaches in order to gain a more comprehensive understanding of these species should be conducted.
The use of the name “tea anthracnose” has long been controversial, because the disease of tea caused by Discula theae-sinensis, a synonym of Gloeosporium theae-sinensis, is commonly referred to as “tea anthracnose” [8,9,10,53,54,55]. However, the disease of tea caused by Colletotrichum spp. is also referred to as “tea anthracnose” [56,57,58,59,60]. It is noteworthy that the phytopathogenic fungi causing “tea anthracnose” do not belong to the same family or order. While the disease of tea caused by Colletotrichum camelliae Massee is known as “tea cloud leaf blight” in China, this name is not widely used [11,61,62,63]. Phylogenetically, the species of Colletotrichum spp. that cause “tea anthracnose” are distantly related to Discula theae-sinensis [64]. However, the symptoms of the disease they cause on the leaves of tea are very similar. The disease caused by these phytopathogenic fungi primarily affects mature leaves and typically begins at the leaf edge or tip. Initially, they produce dark green or yellowish-brown watery spots that later expand along the leaf veins, forming irregular-shaped spots. These spots gradually turn brown or reddish-brown and eventually become greyish-white. The edges of the spots have a yellowish-brown line and are clearly distinguishable from the healthy part of the leaf. The front of the spot is densely covered with numerous small black conidiomata [11,12,58]. The visual similarity of disease symptoms caused by these pathogens makes it challenging to differentiate them with the naked eye, which contributes to the confusion surrounding their identification. The study of Li et al. [18] revealed that Discula theae-sinensis is the predominant species in tea leaves, serving as the primary causative agent of tea plant anthracnose. However, there are numerous studies on “tea anthracnose” caused by Colletotrichum spp., so we suggest that the tea disease caused by Colletotrichum spp. is referred to as “tea anthracnose” and the tea disease caused by Discula theae-sinensis as “the tea leaf blight”, in order to differentiate between the two diseases.
5. Conclusions
In this study, dozens of specimens and strains of Discula theae-sinensis, collected and isolated from diseased leaves of tea in Anhui, Hubei, and Zhejiang Provinces, China, were investigated. The phylogeny and taxonomy of Discula theae-sinensis were revised through phylogenetic analyses, morphological characteristics, and pathogenicity tests. A novel genus Sinodiscula is proposed to accommodate the pathogens of tea anthracnose, typified by the new combination Sinodiscula theae-sinensis, and a new species, Sinodiscula camellicola, is included. Additionally, the controversial use of the name “tea anthracnose” was discussed, suggesting that the tea disease caused by Sinodiscula should be referred to as “the tea leaf blight”. Accurate diagnosis of plant diseases is crucial for effective disease management, and further research and verification of disease control methods are necessary in the near future.
Author Contributions
Conceptualization, C.H. and X.S.; methodology, X.S.; software, M.G. and S.Z.; validation, S.Z.; formal analysis, M.G. and X.S.; investigation, S.Z. and Y.G.; resources, C.H., M.G. and X.S.; data curation, S.Z. and Y.G.; writing—original draft preparation, M.G.; writing—review and editing, M.G. and C.H.; visualization, C.H. and X.S.; supervision, C.H.; project administration, C.H. and X.S.; funding acquisition, C.H. All authors have read and agreed to the published version of the manuscript.
Funding
This research was supported by the National Natural Science Foundation of China (No. 32270012).
Institutional Review Board Statement
Not applicable for studies not involving humans or animals.
Informed Consent Statement
Not applicable.
Data Availability Statement
Data are contained within the article.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Oh, J.K.; Sandin, S.; Ström, P.; Löf, M.; Adami, H.O.; Weiderpass, E. Prospective study of breast cancer in relation to coffee, tea and caffeine in Sweden. Int. J. Cancer 2015, 137, 1979–1989. [Google Scholar] [CrossRef] [PubMed]
- Rahmani, A.H.; Aly, S.M.; Allemailem, K.S.; Khan, M.A. Implications of green tea and its constituents in the prevention of cancer via the modulation of cell signalling pathway. BioMed Res. Int. 2015, 2015, 925640. [Google Scholar] [CrossRef] [PubMed]
- Saito, E.; Inoue, M.; Sawada, N.; Shimazu, T.; Yamaji, T.; Iwasaki, M.; Sasazuki, S.; Noda, M.; Iso, H.; Tsugane, S. Association of green tea consumption with mortality due to all causes and major causes of death in a Japanese population: The Japan Public Health Center-based Prospective Study (JPHC Study). Ann. Epidemiol. 2015, 25, 512–518. [Google Scholar] [CrossRef]
- Zhang, Q.; Cai, M.C.; Yu, X.M.; Wang, L.S.; Guo, C.F.; Ming, R.; Zhang, J.S. Transcriptome dynamics of Camellia sinensis in response to continuous salinity and drought stress. Tree Genet. Genomes 2017, 13, 78. [Google Scholar] [CrossRef]
- Tian, Y.Y.; Chen, Z.J.; Jiang, Z.L.; Huang, X.Q.; Zhang, L.X.; Zhang, Z.Q.; Sun, P. Effects of Plant Growth Regulators on Flower Abscission and Growth of Tea Plant Camellia sinensis (L.) O. Kuntze. J. Plant Growth Regul. 2022, 41, 1161–1173. [Google Scholar] [CrossRef]
- Pan, S.Y.; Nie, Q.; Tai, H.C.; Song, X.L.; Tong, Y.F.; Zhang, L.J.F.; Wu, X.W.; Lin, Z.H.; Zhang, Y.Y.; Ye, D.Y.; et al. Tea and tea drinking: China’s outstanding contributions to the mankind. Chin. Med. 2022, 17, 27. [Google Scholar] [CrossRef]
- Mei, Y.; Zhang, S. Analysis of China’s Tea Production and Domestic Sales in 2022. China Tea 2023, 45, 25–30. [Google Scholar]
- Zheng, S.Z.; Zhou, Z.W.; Chen, X.H.; Cai, L.W.; Jiang, S.T.; Liu, S.R. Screening, Identification and Culture Condition Optimization of Antagonistic Endophytic Bacteria Against Gloeosporium theae-sinensis Miyake. J. Tea Sci. 2023, 43, 205–215. [Google Scholar]
- Moriwaki, J.; Sato, T. A new combination for the causal agent of tea anthracnose: Discula theae-sinensis (I. Miyake) Moriwaki & Toy. Sato, comb. nov. J. Gen. Plant Pathol. 2009, 75, 359–361. [Google Scholar]
- Zhao, X.; Zhang, J.; Tang, A.; Yu, Y.; Yan, L.; Chen, D.; Yuan, L. The Stress Detection and Segmentation Strategy in Tea Plant at Canopy Level. Front. Plant Sci. 2022, 13, 949054. [Google Scholar] [CrossRef]
- Tan, J.C. Tea Tree Diseases and Pest Control; China Agricultural Publishing House: Beijing, China, 2002. [Google Scholar]
- Tang, M.J. Identification and Control of Tea Anthracnose. Chin. Tea 2019, 41, 10–12. [Google Scholar]
- Miyake, I. Ueber einige Pilz-Krankheiten unserer Nutzpflanzen. Shokubutsugaku Zasshi 1907, 21, 39–44. (In German) [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, W. A revision of the genus and species names of anthracnose fungi in Japan. Plant Prot. 1960, 14, 49–52. (In Japanese) [Google Scholar]
- Castlebury, L.A.; Rossman, A.Y.; Jaklitsch, W.J.; Vasilyeva, L.N. A preliminary overview of the Diaporthales based on large subunit nuclear ribosomal DNA sequences. Mycologia 2002, 94, 1017–1031. [Google Scholar] [CrossRef] [PubMed]
- Green, S.; Castlebury, L.A. Connection of Gnomonia intermedia to Discula betulina and its relationship to other taxa in Gnomoniaceae. Mycol. Res. 2007, 111, 62–69. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.C. Handbook of Fungal Identification; Shanghai Science and Technology Press: Shanghai, China, 1979. [Google Scholar]
- Li, Q.; Zhu, J.; Ren, N.; Li, D.; Jin, Y.; Lu, W.; Lu, Q. Characteristics and Pathogenicity of Discula theae-sinensis Isolated from Tea Plant (Camellia sinensis) and Interaction with Colletotrichum spp. Plants 2023, 12, 3427. [Google Scholar] [CrossRef]
- Cai, L.; Hyde, K.D.; Taylor, P.; Weir, B.S.; Waller, J.M.; Abang, M.M.; Zhang, J.Z.; Yang, Y.L.; Phoulivong, S.; Liu, Z.Y. A polyphasic approach for studying Colletotrichum. Fungal Divers. 2009, 39, 183–204. [Google Scholar]
- Liu, R.; Yao, Y.X.; Zhou, S.S.; Li, Y.B. Identification and control of Gloeosporium theae-sinensis Miyake. Tea Fujian 2022, 44, 24–26. [Google Scholar]
- Rayner, R.W. A Mycological Colour Chart; Cmi & British Mycological Society Kew: London, UK, 1970. [Google Scholar]
- Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4239–4246. [Google Scholar] [CrossRef]
- Rehner, S.A.; Samuels, G.J. Taxonomy and phylogeny of Gliocladium analysed from nuclear large subunit ribosomal DNA sequences. Mycol. Res. 1994, 98, 625–634. [Google Scholar] [CrossRef]
- White, T.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; pp. 315–322. [Google Scholar]
- Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes–application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef]
- Liu, Y.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerase II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef] [PubMed]
- Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in flamentous ascomycetes. Mycologia 1999, 3, 553–556. [Google Scholar] [CrossRef]
- Rehner, S.A. Primers for Elongation Factor 1-α (EF1-α); Insect Biocontrol Laboratory, USDA: Columbia, MO, USA, 2001. [Google Scholar]
- Phillips, A.J.L.; Alves, A.; Pennycook, S.R.; Johnston, P.R.; Ramaley, A.; Akulov, A.; Crous, P.W. Resolving the phylogenetic and taxonomic status of dark-spored teleomorph genera in the Botryosphaeriaceae. Persoonia 2008, 21, 29–55. [Google Scholar] [CrossRef] [PubMed]
- Glass, N.L.; Donaldson, G. Development of primer sets designed for use with PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef] [PubMed]
- MAFFT. Job Dispatcher. EMBL’s European Bioinformatics Institute. Available online: https://www.ebi.ac.uk/Tools/msa/mafft/ (accessed on 10 November 2023).
- Rambaut, A. Estimating the rate of molecular evolution: Incorporating non-contemporaneous sequences into maximum likelihood phylogenies. Bioinformatics 2000, 16, 395–399. [Google Scholar] [CrossRef] [PubMed]
- Swofford, D.L. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4.0b10; Sinauer Associates: Sunderland, MA, USA, 2003. [Google Scholar]
- Huelsenbeck, J.P.; Ronquist, F.; Nielsen, R.; Bollback, J.P. Bayesian inference of phylogeny and its impact on evolutionary biology. Science 2001, 294, 2310–2314. [Google Scholar] [CrossRef]
- Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
- Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; von Haeseler, A.; Lanfear, R. IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef]
- Wang, Q.; Cheng, Y.H.; Zhuo, L.; Wang, Y.; Zhou, H.; Hou, C.L. Neopestalotiopsis longiappendiculata as the agent of grey blight disease of Camellia spp. J. Phytopathol. 2022, 170, 770–777. [Google Scholar] [CrossRef]
- Fan, X.; Yang, Q.; Bezerra, J.D.; Alvarez, L.V.; Tian, C. Diaporthe from walnut tree (Juglans regia) in China, with insight of the Diaporthe eres complex. Mycol. Prog. 2018, 17, 841–853. [Google Scholar] [CrossRef]
- Yang, Q.; Fan, X.L.; Du, Z.; Tian, C.M. Diaporthosporellaceae, a novel family of Diaporthales (Sordariomycetes, Ascomycota). Mycoscience 2018, 59, 229–235. [Google Scholar] [CrossRef]
- Senanayake, I.C.; Crous, P.W.; Groenewald, J.Z.; Maharachchikumbura, S.S.; Jeewon, R.; Phillips, A.J.; Bhat, J.D.; Perera, R.H.; Li, Q.R.; Li, W.J.; et al. Families of Diaporthales based on morphological and phylogenetic evidence. Stud. Mycol. 2017, 86, 217–296. [Google Scholar] [CrossRef] [PubMed]
- Senanayake, I.C.; Maharachchikumbura, S.S.N.; Jeewon, R.; Promputtha, I.; Al-Sadi, A.M.; Camporesi, E.; Hyde, K.D. Morphophylogenetic study of Sydowiellaceae reveals several new genera. Mycosphere 2017, 8, 172–217. [Google Scholar] [CrossRef]
- Du, Z.; Fan, X.L.; Yang, Q.; Tian, C.M. Host and geographic range extensions of Melanconiella, with a new species M. cornuta in China. Phytotaxa 2017, 327, 252–260. [Google Scholar] [CrossRef]
- Guterres, D.C.; Galvão-Elias, S.; dos Santos, M.D.D.M.; de Souza, B.C.P.; de Almeida, C.P.; Pinho, D.B.; Miller, R.N.G.; Dianese, J.C. Phylogenetic relationships of Phaeochorella parinarii and recognition of a new family, Phaeochorellaceae (Diaporthales). Mycologia 2019, 111, 660–675. [Google Scholar] [CrossRef] [PubMed]
- Xavier, K.V.; KC, A.N.; Crous, P.W.; Groenewald, J.Z.; Vallad, G.E. Dwiroopa punicae sp. nov. (Dwiroopaceae fam. nov., Diaporthales), associated with leaf spot and fruit rot of pomegranate (Punica granatum). Fungal Syst. Evol. 2019, 4, 33–41. [Google Scholar] [CrossRef] [PubMed]
- Braun, U.; Nakashima, C.; Crous, P.W.; Groenewald, J.Z.; Moreno-Rico, O.; Rooney-Latham, S.; Blomquist, C.L.; Haas, J.; Marmolejo, J. Phylogeny and taxonomy of the genus Tubakia s. lat. Fungal Syst Evol. 2018, 1, 41–99. [Google Scholar] [CrossRef]
- Udayanga, D.; Miriyagalla, S.D.; Manamgoda, D.S.; Lewers, K.S.; Gardiennet, A.; Castlebury, L.A. Molecular reassessment of diaporthalean fungi associated with strawberry, including the leaf blight fungus, Paraphomopsis obscurans gen. et comb. nov. (Melanconiellaceae). IMA Fungus 2021, 12, 15. [Google Scholar] [CrossRef]
- Voglmayr, H.; Rossman, A.Y.; Castlebury, L.A.; Jaklitsch, W.M. Multigene phylogeny and taxonomy of the genus Melanconiella (Diaporthales). Fungal Divers. 2012, 57, 1–44. [Google Scholar] [CrossRef]
- Farr, D.F.; Castlebury, L.A.; Rossman, A.Y.; Erincik, O. Greeneria uvicola, cause of bitter rot of grapes, belongs in the Diaporthales. Sydowia 2001, 53, 185–199. [Google Scholar]
- Phookamsak, R.; Hyde, K.D.; Jeewon, R.; Bhat, D.J.; Jones, E.B.G.; Maharachchikumbura, S.S.N.; Raspé, O.; Karunarathna, S.C.; Wanasinghe, D.N.; Hongsanan, S.; et al. Fungal diversity notes 929–1035: Taxonomic and phylogenetic contributions on genera and species of fungi. Fungal Divers. 2019, 95, 1–273. [Google Scholar] [CrossRef]
- Moriwaki, J.; Tsukiboshi, T. Colletotrichum echinochloae, a new species on Japanese barnyard millet (Echinochloa utilis). Mycoscience 2009, 50, 273–280. [Google Scholar] [CrossRef]
- Sutton, B.C. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata; Commonwealth Mycological Institute: Kew, UK, 1980; p. 696. [Google Scholar]
- Sogonov, M.V.; Castlebury, L.A.; Rossman, A.Y.; White, J.F. The type species of Apiognomonia, A. veneta, with its Discula anamorph is distinct from A. errabunda. Mycol. Res. 2007, 111, 693–709. [Google Scholar] [CrossRef]
- Yamada, K.; Sonoda, R. A Fluorescence Microscopic Study of the Infection Process of Discula theae-sinensis in Tea. Jpn. Agric. Res. Q. 2014, 48, 399–402. [Google Scholar] [CrossRef]
- Yoshida, K.; Takeda, Y. Evaluation of Anthracnose Resistance among Tea Genetic Resources by Wound-Inoculation Assay. Jpn. Agric. Res. Q. JARQ 2006, 40, 379–386. [Google Scholar] [CrossRef]
- Yuan, L.; Yan, P.; Han, W.Y.; Huang, Y.B.; Wang, B.; Zhang, J.C.; Zhang, H.B.; Bao, Z.Y. Detection of anthracnose in tea plants based on hyperspectral imaging. Comput. Electron. Agric. 2019, 167, 105039. [Google Scholar] [CrossRef]
- Gong, C.Y.; Liu, J.J.; Deng, Q.; Zhang, L.X. Identification and pathogenicity of Colletotrichum species causing anthracnose on Camellia sinensis. Acta Hortic. Sin. 2022, 49, 1092–1101. [Google Scholar]
- Liu, F.; Weir, B.S.; Damm, U.; Crous, P.W.; Wang, Y.; Liu, B.; Wang, M.; Zhang, M.; Cai, L. Unravelling Colletotrichum species associated with Camellia: Employing ApMat and GS loci to resolve species in the C. gloeosporioides complex. Persoonia 2015, 35, 63–86. [Google Scholar] [CrossRef]
- Wang, Y.C.; Hao, X.Y.; Wang, L.; Xiao, B.; Wang, X.C.; Yang, Y.J. Diverse Colletotrichum species cause anthracnose of tea plants (Camellia sinensis (L.) O. Kuntze) in China. Sci. Rep. 2016, 6, 35287. [Google Scholar] [CrossRef]
- Shi, Y.L.; Sheng, Y.Y.; Cai, Z.Y.; Yang, R.; Li, Q.S.; Li, X.M.; Li, D.; Guo, X.Y.; Lu, J.L.; Ye, J.H.; et al. Involvement of Salicylic Acid in Anthracnose Infection in Tea Plants Revealed by Transcriptome Profiling. Int. J. Mol. Sci. 2019, 20, 2439. [Google Scholar] [CrossRef]
- Tan, S.; Chen, Y.; Zhou, G.; Liu, J. Transcriptome Analysis of Colletotrichum fructicola Infecting Camellia oleifera Indicates That Two Distinct Geographical Fungi Groups Have Different Destructive Proliferation Capacities Related to Purine Metabolism. Plants 2021, 10, 2672. [Google Scholar] [CrossRef]
- Zhang, M.T.; Li, X.H.; Chen, H.Y.; Tao, Z.J.; Zu, Z.Q.; Wu, H.; Jiang, H. A preliminary study on fast screening of different tea tree varieties for resistance to anthracnose of tea tree. J. Tea Bus. 2022, 44, 076–080. [Google Scholar]
- Sun, D.Z.; Liu, H.; Liu, J.Y.; Ding, Z.; Xie, J.X.; Wang, W.X. Recognition of tea diseases based on improved YOLOv4 model. J. Northwest AF Univ. 2023, 9, 16. [Google Scholar]
- Zhang, Y.L. Identification and Biological Characteristics of Tea Leaf Diseases in Shandong Province; Shandong Agricultural University: Shandong, China, 2023. [Google Scholar]
- Moriwaki, J.; Tsukiboshi, T.; Sato, T. Grouping of Colletotrichum species in Japan based on rDNA sequences. J. Gen. Plant Pathol. 2002, 68, 307–320. [Google Scholar] [CrossRef]
Figure 1.
Phylogenetic tree derived from maximum likelihood analysis of the combined ITS, nrLSU, rpb2, and tef1 sequences of Diaporthales, using Ceratosphaeria aquatica (MFLU 18.323) and Pyricularia grisea (CG4) as the outgroups. Bootstrap support values for RAxML and maximum parsimony greater than 70% and Bayesian posterior probabilities (PP) greater than 0.95 are given below and above the nodes. New species and new combinations from this study are in bold.
Figure 1.
Phylogenetic tree derived from maximum likelihood analysis of the combined ITS, nrLSU, rpb2, and tef1 sequences of Diaporthales, using Ceratosphaeria aquatica (MFLU 18.323) and Pyricularia grisea (CG4) as the outgroups. Bootstrap support values for RAxML and maximum parsimony greater than 70% and Bayesian posterior probabilities (PP) greater than 0.95 are given below and above the nodes. New species and new combinations from this study are in bold.
Figure 2.
Morphology of Sinodiscula camellicola collected from Camellia sinensis: (a) Sinodiscula camellicola causes a large number of fallen leaves of Camellia sinensis; (b) Lesion on Camellia sinensis; (c) Habit of conidiomata on leaf of Camellia sinensis; (d) Upper and reverse sides of cultures; (e) Conidiomata pycnidial; (f) Conidiogenous cells and conidia; (g) Conidia; (h) Longitudinal section through conidiomata on cotton blue. Scale bars: (c) = 250 μm, (e) = 250 μm, (f) = 10 μm, (g) = 5 μm, (h) = 100 μm.
Figure 2.
Morphology of Sinodiscula camellicola collected from Camellia sinensis: (a) Sinodiscula camellicola causes a large number of fallen leaves of Camellia sinensis; (b) Lesion on Camellia sinensis; (c) Habit of conidiomata on leaf of Camellia sinensis; (d) Upper and reverse sides of cultures; (e) Conidiomata pycnidial; (f) Conidiogenous cells and conidia; (g) Conidia; (h) Longitudinal section through conidiomata on cotton blue. Scale bars: (c) = 250 μm, (e) = 250 μm, (f) = 10 μm, (g) = 5 μm, (h) = 100 μm.
Figure 3.
Morphology of Sinodiscula theae-sinensis collected from Camellia sinensis: (a) Sinodiscula theae-sinensis causes a large number of fallen leaves of Camellia sinensis; (b) Lesion on Camellia sinensis; (c) Habit of conidiomata on leaf of Camellia sinensis; (d) Upper and reverse sides of cultures; (e) Conidiomata pycnidial; (f) Conidiogenous cells and conidia; (g) Conidia; (h) Longitudinal section through conidiomata on cotton blue. Scale bars: (c) = 250 μm, (e) = 500 μm, (f) = 10 μm, (g) = 5 μm, (h) = 50 μm.
Figure 3.
Morphology of Sinodiscula theae-sinensis collected from Camellia sinensis: (a) Sinodiscula theae-sinensis causes a large number of fallen leaves of Camellia sinensis; (b) Lesion on Camellia sinensis; (c) Habit of conidiomata on leaf of Camellia sinensis; (d) Upper and reverse sides of cultures; (e) Conidiomata pycnidial; (f) Conidiogenous cells and conidia; (g) Conidia; (h) Longitudinal section through conidiomata on cotton blue. Scale bars: (c) = 250 μm, (e) = 500 μm, (f) = 10 μm, (g) = 5 μm, (h) = 50 μm.
Figure 4.
Pathogenicity of Sinodiscula theae-sinensis and Sinodiscula camellicola. CNUCC 1914-2-2 (Sinodiscula theae-sinensis) and CNUCC 107-4-1 (Sinodiscula camellicola) were tested on the leaves of Camellia sinensis: (a) The left is the pathogenicity test of Sinodiscula theae-sinensis, the right is the pathogenicity test of Sinodiscula camellicola; (b) The symptom caused by Sinodiscula theae-sinensis after seven days; (c) The symptom caused by Sinodiscula camellicola after seven days.
Figure 4.
Pathogenicity of Sinodiscula theae-sinensis and Sinodiscula camellicola. CNUCC 1914-2-2 (Sinodiscula theae-sinensis) and CNUCC 107-4-1 (Sinodiscula camellicola) were tested on the leaves of Camellia sinensis: (a) The left is the pathogenicity test of Sinodiscula theae-sinensis, the right is the pathogenicity test of Sinodiscula camellicola; (b) The symptom caused by Sinodiscula theae-sinensis after seven days; (c) The symptom caused by Sinodiscula camellicola after seven days.
Table 1.
Primers used in this study, with sequences and sources.
| Gene a | Primer | Sequence (5′–3′) | Expected Amplicon Size (bp) |
|---|---|---|---|
| ITS | ITS1f | CTTGGTCATTTAGAGGAAGTAA | 600 |
| ITS4 | TCCTCCGCTTATTGATATGC | ||
| nrLSU | LR5 | TCCTGAGGGAAAGTTCG | 1200 |
| LR0R | ACCCGCTGAACTTAAGC | ||
| rpb2 | 5f | GAYGAYMGWGATCAYTTYGG | 1200 |
| 7cR | CCCATRGCTTGYTTRCCCAT | ||
| tef1 | 728f | CATCGAGAAGTTCGAGAAGG | 600 |
| EF2 | GGARGTACCAGTSATCATGTT |
a ITS, the internal transcribed spacer regions and intervening 5.8S nrDNA; nrLSU, the present study uses a combined taxonomic approach based on morphology and DNA sequence analyses of the partial 28S nrDNA; rpb2, DNA-directed RNA polymerase II second largest subunit; tef1, translation elongation factor 1-alpha.
Table 2.
GenBank accession numbers and culture collection/isolate information for the molecular analysis of Diaporthales. Information written in bold refers to sequences generated in the context of the present study.
Table 2.
GenBank accession numbers and culture collection/isolate information for the molecular analysis of Diaporthales. Information written in bold refers to sequences generated in the context of the present study.
| Species | Culture Collection/Isolate | ITS | nrLSU | rpb2 | tef1 |
|---|---|---|---|---|---|
| Apiognomonia veneta | CBS 897.79 | - | EU255195 | EU219259 | EU221910 |
| Apiosporopsis carpinea | CBS 771.79 | AF277130 | - | - | - |
| Apoharknessia insueta | CBS 111377 | AY720814 | JQ706083 | - | MN271820 |
| Apoharknessia insueta | CBS 114575 | MN172370 | MN172402 | - | MN271821 |
| Asterosporium asterospoermum | MFLU 15–3555 | MF190062 | - | - | - |
| Auratiopycnidiella tristaniopsis | CBS 132180 | JQ685522 | JQ685516 | - | MN271825 |
| Auratiopycnidiella tristaniopsis | CPC 16371 | MN172374 | MN172405 | - | MN271826 |
| Ceratosphaeria aquatica | MFLU 18–2323 | MK835812 | MK828612 | MN156509 | MN194065 |
| Chapeckia nigrospora | AR 3809 | EU683068 | - | - | - |
| Chrysoporthe australafricana | CBS 112916 | AY194097 | AF292041 | - | MN271832 |
| Chrysoporthe cubensis | CBS 118654 | MN172378 | DQ368773 | - | MN271834 |
| Coneilla peruensis | CBS 110394 | KJ710441 | KJ710463 | KX833499 | KX833695 |
| Coniella eucalyptorum | CBS 112640 | AY339290 | AY339338 | KX833452 | KX833637 |
| Coryneum gigasporum | CFCC 52319 | MH683557 | MH683565 | - | - |
| Coryneum umbonatum | D201 | MH674329 | MH674329 | MH674333 | MH674337 |
| Cryphonectria parasitica | ATCC 38755 | NG_027589 | AY141856 | DQ862017 | EU222014 |
| Cryphonectria parasitica | ATCC 48198 | JN940858 | JN942325 | - | - |
| Cryphonectria parasitica | CFCC 52150 | MH514021 | MG866018 | - | MN271848 |
| Cytospora chrysosperma | CFCC 89982 | KP310805 | KP281261 | KU710952 | KP310848 |
| Cytospora eleagni | CFCC 89633 | KF765693 | KF765677 | KU710956 | KU710919 |
| Cytospora viridistroma | CBS 202.36 | MN172388 | MN172408 | - | MN271853 |
| Dendrostoma osmanthi | CFCC 52106 | MG682013 | MG682073 | MG682033 | MG682053 |
| Diaporthe citri | AR 3405 | MT378365 | KC843311 | MT383081 | KC843071 |
| Diaporthe eres | CBS 138594 | MT378367 | KJ210529 | MT383083 | KJ210550 |
| Diaporthe helianthi | CBS 592.81 | MT378370 | NR_103698 | - | KC343841 |
| Diaporthe novem | AR 4855 | MT378366 | MT378351 | MT383082 | MT383100 |
| Diaporthella cryptica | CBS 140348 | MN172390 | MN172409 | MN271800 | MN271854 |
| Diaporthosporella cercidicola | CFCC 51994 | KY852515 | KY852492 | - | MN271855 |
| Diaporthostoma machili | CFCC 52101 | MG682021 | MG682081 | MG682041 | MG682061 |
| Diaporthostoma machili | CFCC 52100 | MG682020 | MG682080 | MG682040 | MG682060 |
| Dicarpella sp. | NY7452a | HM855225 | - | - | - |
| Discula betulina | AR 4173 | EU254757 | - | - | - |
| Discula campestris | CBS 32875 | EU199185 | MH872664 | EU199143 | - |
| Discula destructiva | CBS 109771 | - | - | EU199144 | JQ414137 |
| Discula quercina | CBS 115013 | AY853196 | - | - | - |
| Dwiroopa lythri | CBS 109755 | MN172389 | MN172410 | MN271801 | MN271859 |
| Dwiroopa punicae | CBS 143163 | MK510686 | MK510676 | MK510692 | - |
| Erythrogloeum hymenaeae | CBS 132185 | JQ685525 | JQ685519 | - | - |
| Gnomoniopsis comari | CBS 806.79 | EU255114 | EU254821 | - | GU320810 |
| Gnomoniopsis fragariae | CBS 121226 | EU255115 | EU254824 | EU219250 | EU221961 |
| Gnomoniopsis fragariae | DMW 63 | MT378357 | MT378343 | MT383072 | MT383089 |
| Gnomoniopsis fragariae | DMW 61 | MT378358 | MT378344 | MT383073 | MT383090 |
| Gnomoniopsis fragariae | VPRI 15547 | MT378359 | MT378345 | MT383087 | MT383091 |
| Gnomoniopsis fragariae | CBS 275.51 | MH868373 | EU254829 | MT383088 | MT383092 |
| Gnomoniopsis fragariae | CBS 208.34 | EU255116 | EU254826 | EU219284 | EU221968 |
| Gnomoniopsis tormentillae | CBS 904.79 | EU255133 | EU254856 | - | GU320795 |
| Greeneria uvicola | AU01 | JN547720 | - | - | - |
| Greeneria uvicola | OH35 | AF362570 | - | - | - |
| Harknessia gibbosa | CBS 120033 | EF110615 | EF110615 | - | MN271868 |
| Harknessia ipereniae | CBS 120030 | EF110614 | EF110614 | - | MN271870 |
| Involutiscutellula rubra | MUCC 2304 | MG591995 | MG591901 | MG976478 | MG592088 |
| Involutiscutellula rubra | CBS 192.71 | MG591993 | MG591899 | MG976476 | MG592086 |
| Juglanconis juglandina | CBS 121083 | KY427148 | KY427148 | KY427198 | KY427217 |
| Juglanconis oblonga | MAFF 410216 | KY427153 | KY427153 | KY427203 | KY427222 |
| Juglanconis pterocaryae | MAFF 410079 | KY427155 | KY427155 | KY427205 | KY427224 |
| Lamproconium desmazieri | MFLUCC 15–0870 | KX430135 | KX430134 | MF377605 | MF377591 |
| Lamproconium desmazieri | MFLUCC 15–0872 | KX430139 | KX430138 | - | MF377593 |
| Macrohilum eucalypti | CBS 140063 | NG_058183 | NR_154184 | MN271810 | - |
| Macrohilum eucalypti | CPC 10945 | DQ195793 | DQ195781 | - | - |
| Mastigosporella anisophylleae | CBS 136421 | KF777221 | KF779492 | - | MN271892 |
| Mastigosporella pigmentata | VIC44383 | MG587928 | MG587929 | - | - |
| Mazzantia galii | CBS 125529 | MH875041 | MH863563 | - | MT383101 |
| Melanconiella chrysodiscosporina | CBS 125597 | MH875191 | MH863730 | - | - |
| Melanconiella cornuta | CFCC 51990 | MF360006 | MF360008 | MF360002 | MF360004 |
| Melanconiella cornuta | CFCC 51991 | MF360007 | MF360009 | MF360003 | MF360005 |
| Melanconiella elegans | AR 3830 | JQ926264 | JQ926264 | JQ926335 | JQ926401 |
| Melanconiella ellisii | BPI 878343 | JQ926271 | JQ926271 | JQ926339 | JQ926406 |
| Melanconiella spodiaea | AR 3457 | AF408369 | MT378352 | MT383074 | MT383093 |
| Melanconiella spodiaea | AR 3462 | AF408370 | MT378353 | MT383075 | MT383094 |
| Melanconis betulae | CFCC 50471 | KT732971 | KT732952 | KT732984 | KT733001 |
| Melanconis itoana | CFCC 50474 | KT732974 | KT732955 | KT732987 | KT733004 |
| Melanconis stilbostoma | CFCC 50475 | KT732975 | KT732956 | KT732988 | KT733005 |
| Microascospora rubi | MFLU 15–1112 | MF190099 | MF190154 | MF377611 | MF377582 |
| Microascospora rubi | MFLU 17–0883 | MF190098 | MF190153 | - | MF377581 |
| Neocryphonectria carpini | CFCC 53027 | MN172396 | MN172413 | - | - |
| Neocryphonectria chinensis | CFCC 53025 | MN172397 | MN172414 | MN271812 | MN271893 |
| Neopseudomelanconis castaneae | CFCC 52787 | MH469164 | MH469162 | - | - |
| Oblongisporothyrium castanopsidis | CBS 189.71 | MG591943 | MG591850 | - | MG592038 |
| Oblongisporothyrium castanopsidis | CBS 124732 | MG591942 | MG591849 | MG976453 | MG592037 |
| Ophiognomonia rosae | DMW 108 | MT378355 | JF514851 | MT383086 | JF514824 |
| Ophiognomonia rosae | CBS 851.79 | MT378356 | EU254930 | MT383071 | JQ414153 |
| Paragnomonia fragariae | F129 | MK524447 | MK524430 | - | MK524466 |
| Paragnomonia fragariae | GF300 | MT378368 | - | MT383084 | MT383102 |
| Paragnomonia fragariae | GF301 | MT378369 | - | MT383085 | MT383103 |
| Paraphomopsis obscurans | M1261 | MT378360 | MT378346 | MT383076 | MT383095 |
| Paraphomopsis obscurans | CBS 143829 | MT378361 | MT378347 | MT383077 | MT383096 |
| Paraphomopsis obscurans | M1259 | MT378362 | MT378348 | MT383078 | MT383097 |
| Paraphomopsis obscurans | M1333 | MT378363 | MT378349 | MT383079 | MT383098 |
| Paraphomopsis obscurans | M1278/DS055 | MT378364 | MT378350 | MT383080 | MT383099 |
| Paraphomopsis obscurans | strain 1–1 | - | HM854850 | - | - |
| Paraphomopsis obscurans | strain 1–3 | - | HM854852 | - | - |
| Paraphomopsis obscurans | strain 12 | - | HM854849 | - | - |
| Paratubakia subglobosa | CBS 193.71 | MG592009 | MG591914 | MG976490 | MG592103 |
| Paratubakia subglobosoides | MUCC 2293 | MG592010 | MG591915 | MG976491 | MG592104 |
| Phaeoappendicospora thailandensis | MFLUCC 13–0161 | MF190102 | MF190157 | - | - |
| Prosopidicola mexicana | CBS 113529 | KX228354 | AY720709 | - | - |
| Prosopidicola albizziae | CBS 141298 | KX228325 | KX228274 | - | - |
| Pseudomelanconis caryae | CFCC 52110 | MG682022 | MG682082 | MG682042 | MG682062 |
| Pseudoplagiostoma eucalypti | CPC 14161 | GU973604 | GU973510 | - | GU973540 |
| Pseudoplagiostoma oldii | CBS 115722 | GU973610 | GU973535 | - | GU973565 |
| Pyricularia grisea | CG-4 | JX134683 | JX134671 | - | JX134697 |
| Racheliella wingfieldiana | CPC 13806 | MG592006 | MG591911 | MG976487 | MG592100 |
| Septomelanconiella thailandica | MFLUCC 18-0518 | MH727706 | MH727705 | MH752072 | - |
| Sillia karstenii | MFLU 16–2864 | KY523500 | KY523482 | KY501636 | - |
| Sinodiscula camellicola | CNUCC 106-1-2 | PP150390 | PP149025 | PP174323 | PP156920 |
| Sinodiscula camellicola | CNUCC 106-2-1 | PP150391 | PP149026 | PP174324 | PP156921 |
| Sinodiscula camellicola | CNUCC 106-3-3 | PP150392 | PP149027 | PP174325 | PP156922 |
| Sinodiscula camellicola | CNUCC 107-3-2 | PP150393 | PP149028 | PP174326 | PP156923 |
| Sinodiscula camellicola | CNUCC 107-4-1 | PP150394 | PP149029 | PP174327 | PP156924 |
| Sinodiscula camellicola | CNUCC 108-2-1 | PP150395 | PP149030 | PP174328 | PP156925 |
| Sinodiscula camellicola | CNUCC 110-2-3 | PP150396 | PP149031 | PP174329 | PP156926 |
| Sinodiscula camellicola | CNUCC 111-1-3 | PP150397 | PP149032 | PP174330 | PP156927 |
| Sinodiscula camellicola | CNUCC 112-2-1 | PP150398 | PP149033 | PP174331 | PP156928 |
| Sinodiscula camellicola | CNUCC 112-2-4 | PP150399 | PP149034 | PP174332 | PP156929 |
| Sinodiscula camellicola | CNUCC 112-3-3 | PP150400 | PP149035 | PP174333 | PP156930 |
| Sinodiscula camellicola | CNUCC 114-2-3 | PP150401 | PP149036 | PP174334 | PP156931 |
| Sinodiscula camellicola | CNUCC 117-1-3 | PP150402 | PP149037 | PP174335 | PP156932 |
| Sinodiscula camellicola | CNUCC 117-4-4 | PP150403 | PP149038 | PP174336 | PP156933 |
| Sinodiscula camellicola | CNUCC 345-2-3 | PP150404 | PP149039 | PP174337 | PP156934 |
| Sinodiscula camellicola | CNUCC 1297-2-1 | PP150405 | PP149040 | PP174338 | PP156935 |
| Sinodiscula theae-sinensis | MAFF 238240 | AB511919 | - | - | - |
| Sinodiscula theae-sinensis | MAFF 238241 | AB511920 | - | - | - |
| Sinodiscula theae-sinensis | MAFF 238242 | AB511921 | - | - | - |
| Sinodiscula theae-sinensis | MAFF 238243 | AB511922 | - | - | - |
| Sinodiscula theae-sinensis | MAFF 238244 | AB511923 | - | - | - |
| Sinodiscula theae-sinensis | MAFF 752003 | PP150406 | PP149041 | PP174339 | PP156936 |
| Sinodiscula theae-sinensis | CNUCC 98B-1-2 | PP150407 | PP149042 | PP174340 | PP156937 |
| Sinodiscula theae-sinensis | CNUCC 98B-2-2 | PP150408 | PP149043 | PP174341 | PP156938 |
| Sinodiscula theae-sinensis | CNUCC 100B-1-3 | PP150409 | PP149044 | PP174342 | PP156939 |
| Sinodiscula theae-sinensis | CNUCC 100B-3-1 | PP150410 | PP149045 | PP174343 | PP156940 |
| Sinodiscula theae-sinensis | CNUCC 110-4-2 | PP150411 | PP149046 | PP174344 | PP156941 |
| Sinodiscula theae-sinensis | CNUCC 111-2-3 | PP150412 | PP149047 | PP174345 | PP156942 |
| Sinodiscula theae-sinensis | CNUCC 269B-1-1 | PP150413 | PP149048 | PP174346 | PP156943 |
| Sinodiscula theae-sinensis | CNUCC 1297-2-2 | PP150414 | PP149049 | PP174347 | PP156944 |
| Sinodiscula theae-sinensis | CNUCC 1297-3-1 | PP150415 | PP149050 | PP174348 | PP156945 |
| Sinodiscula theae-sinensis | CNUCC 1297-4-1 | PP150416 | PP149051 | PP174349 | PP156946 |
| Sinodiscula theae-sinensis | CNUCC 1297-4-4 | PP150417 | PP149052 | PP174350 | PP156947 |
| Sinodiscula theae-sinensis | CNUCC 1887-3-1 | PP150418 | PP149053 | PP174351 | PP156948 |
| Sinodiscula theae-sinensis | CNUCC 1900-4-3 | PP150419 | PP149054 | PP174352 | PP156949 |
| Sinodiscula theae-sinensis | CNUCC 1900-7-3 | PP150420 | PP149055 | PP174353 | PP156950 |
| Sinodiscula theae-sinensis | CNUCC 1914-2-2 | PP150421 | PP149056 | PP174354 | PP156951 |
| Sinodiscula theae-sinensis | CNUCC 1914-3-3 | PP150422 | PP149057 | - | PP156952 |
| Sphaerosporithyrium mexicanum | CPC 31361 | MG591988 | MG591894 | - | MG592081 |
| Sphaerosporithyrium mexicanum | CPC 33021 | MG591990 | MG591896 | MG976473 | MG592083 |
| Stegonsporium acerophilum | CBS 117025 | EU039993 | EU039982 | KF570173 | EU040027 |
| Stilbospora longicornuta | CBS 122529 | KF570164 | KF570164 | KF570194 | KF570232 |
| Synnemasporella aculeans | CFCC 52094 | MG682026 | MG682086 | MG682046 | MG682066 |
| Synnemasporella toxicodendri | CFCC 52097 | MG682029 | MG682089 | MG682049 | MG682069 |
| Thailandiomyces bisetulosus | BCC 00018 | EF622230 | - | - | - |
| Tirisporella beccariana | BCC 38312 | JQ655449 | - | - | - |
| Tubakia dryina | CBS 114386 | JF704188 | MG591852 | - | MG592040 |
| Tubakia iowensis | CBS 129012 | MG591971 | JF704194 | - | MG603576 |
| Tubakia seoraksanensis | CBS 127490 | KP260499 | MG591907 | - | MG592094 |
Abbreviations of the culture collections: ATCC: American Type Culture collection; CMW:FABI fungal culture collection; CBS: CBS-KNAW culture collection, Westerdijk Fungal Biodiversity Institute; MFLU: Mae Fah Luang University Herbarium; MFLUCC: Mae Fah Luang University Culture Collection; CFCC: China Forestry Culture Collection Center; STE-U: culture collection of the Department of Plant Pathology at the University of Stellenbosch; AR, M, DMW: Cultures housed at MNGDBL, USDA-ARS, Beltsville, Maryland; CPC: Culture collection of Pedro Crous, housed at Westerdijk Fungal Biodiversity Institute; MUCC: Murdoch University Culture Collection; BCC: BIOTEC Culture Collection, Bangkok, Thailand; VPRI: Victoria Plant Pathology Herbarium.
Table 3.
The mean spot size of infected leaves and the incidence of infection.
| Species | The Mean Spot Size (av. ± SD/mm) | Incidence |
|---|---|---|
| Sinodiscula theae-sinensis (CNUCC 1914-2-2) | 1.52 ± 0.18 | 100% |
| Sinodiscula camellicola (CNUCC 107-4-1) | 1.21 ± 0.09 | 88.9% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Guo, M.; Zhao, S.; Gao, Y.; Shen, X.; Hou, C. A Phylogenetic and Taxonomic Revision of Discula theae-sinensis, the Causal Agents of Anthracnose on Camellia sinensis. J. Fungi 2024, 10, 141. https://doi.org/10.3390/jof10020141
AMA Style
Guo M, Zhao S, Gao Y, Shen X, Hou C. A Phylogenetic and Taxonomic Revision of Discula theae-sinensis, the Causal Agents of Anthracnose on Camellia sinensis. Journal of Fungi. 2024; 10(2):141. https://doi.org/10.3390/jof10020141
Chicago/Turabian StyleGuo, Meijun, Shiyi Zhao, Yue Gao, Xiaoye Shen, and Chenglin Hou. 2024. "A Phylogenetic and Taxonomic Revision of Discula theae-sinensis, the Causal Agents of Anthracnose on Camellia sinensis" Journal of Fungi 10, no. 2: 141. https://doi.org/10.3390/jof10020141
APA StyleGuo, M., Zhao, S., Gao, Y., Shen, X., & Hou, C. (2024). A Phylogenetic and Taxonomic Revision of Discula theae-sinensis, the Causal Agents of Anthracnose on Camellia sinensis. Journal of Fungi, 10(2), 141. https://doi.org/10.3390/jof10020141
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
