Next Article in Journal / Special Issue
Geographical Correlation and Genetic Diversity of Newly Emerged Races within the Ug99 Lineage of Stem Rust Pathogen, Puccinia graminis f. sp. tritici, in Different Wheat-Producing Areas
Previous Article in Journal
Evaluation of the Ability of Seven Active Ingredients of Fungicides to Suppress Phytophthora cactorum at Diverse Life Stages, and Variability in Resistance Found among Isolates
Previous Article in Special Issue
Morphological and Molecular Characterization of Calonectria foliicola Associated with Leaf Blight on Rubber Tree (Hevea brasiliensis) in Thailand
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 8
Issue 10
10.3390/jof8101040
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of Alternaria and Colletotrichum Species Associated with Pomegranate (Punica granatum L.) in Maharashtra State of India

by
Nanjundappa Manjunatha
*,
Jyotsana Sharma
,
Somnath S. Pokhare
*,
Ruchi Agarrwal
*,
Prakash G. Patil
,
Jaydip D. Sirsat
,
Mansi G. Chakranarayan
,
Aarti Bicchal
,
Anmol S. Ukale
and
Rajiv A. Marathe
ICAR-National Research Centre on Pomegranate, Solapur 413255, Maharashtra, India
*
Authors to whom correspondence should be addressed.
J. Fungi 2022, 8(10), 1040; https://doi.org/10.3390/jof8101040
Submission received: 25 August 2022 / Revised: 26 September 2022 / Accepted: 26 September 2022 / Published: 30 September 2022
(This article belongs to the Special Issue Diagnosis of Plant Pathogenic Fungi and Oomycetes and Plant Breeding for Disease Resistance)
Browse Figures
Versions Notes

Abstract

:
Fungal pathogens are a major constraint affecting the quality of pomegranate production around the world. Among them, Alternaria and Colletotrichum species cause leaf spot, fruit spot or heart rot (black rot), and fruit rot (anthracnose) or calyx end rot, respectively. Accurate identification of disease-causing fungal species is essential for developing suitable management practices. Therefore, characterization of Alternaria and Colletotrichum isolates representing different geographical regions, predominantly Maharashtra—the Indian hub of pomegranate production and export—was carried out. Fungal isolates could not be identified based on morphological characteristics alone, hence were subjected to multi-gene phylogeny for their accurate identification. Based on a maximum likelihood phylogenetic tree, Alternaria isolates were identified as within the A. alternata species complex and as A. burnsii, while Colletotrichum isolates showed genetic closeness to various species within the C. gloeosporioides species complex. Thus, the current study reports for the first time that, in India, the fruit rots of pomegranate are caused by multiple species and not a single species of Alternaria and Colletotrichum alone. Since different species have different epidemiology and sensitivity toward the commercially available and routinely applied fungicides, the precise knowledge of the diverse species infecting pomegranate, as provided by the current study, is the first step towards devising better management strategies.

1. Introduction

Pomegranate (Punica granatum L.) has been cultivated as a fruit crop since ancient times. It produces edible fruits with innumerable health benefits and high commercial value. Moreover, in recent years, possible applications of extracts of pomegranate fruit peel as natural pesticides or food preservatives have also been envisaged [1,2,3]. Over the last few decades, global market demand of pomegranate fruit has increased remarkably, resulting in alluring monetary returns to growers and a constant increase in cultivation area and production of this horticultural crop, especially in India. Globally, India is the largest pomegranate producer, with more than 41% of the world’s area and production. Currently, in India, the crop occupies an area of 288,000 ha, with a production of 3,256,000 tons [4]. Maharashtra state is the first pomegranate producer in India with a cultivated area of 171,000 ha and a production of 1,795,000 MT, as well as the first exporter, with 51,699 MT and a value of INR 3520 million in 2020–2021 [5], with a share of 59.4% in area, 55.13% in production, and 84.41% in export at the national level. In Maharashtra, the largest area cultivated with pomegranate (47,380 ha) is in the Solapur district. Due to the unique properties of pomegranate produced in Solapur, it has been awarded the geographical indication tag and more than 80% of planting material is now supplied from Maharashtra to other pomegranate growing states of the country.
In India, among all the commercial pomegranate cultivars, cv. Bhagawa is the most popular; it accounts for more than 86% of the pomegranate production area and is requested in local and export markets. However, this cultivar is highly susceptible to several fungal pathogens, among which Alternaria and Colletotrichum species are the major pathogens affecting the quality of pomegranate production [6,7]. Under changing climatic conditions, in recent times, infections by these pathogens are becoming more frequent in India [8,9]. Alternaria species cause leaf spot, fruit spot and heart rot (black rot) of pomegranate, whereas Colletotrichum species cause a fruit rot called anthracnose/calyx end rot [7,8,9]. These fungal pathogens cause huge economic losses to growers, as infected fruits become unmarketable. However, the precise estimation of losses caused by heart rot and anthracnose to pomegranate production in India is not available, though in 2020–2021, farmers in Maharashtra reported up to 50% losses due to these pathogens.
In the absence of resistant cultivars, fungicide application is the most widespread management method of fungal plant diseases. However, due to overuse, fungicide resistance may develop in the fungal pathogen populations. Fungicide resistance of Alternaria and Colletotrichum sp. to different fungicides was reported [10,11] earlier. Moreover, within the same genus of plant pathogenic fungi, isolates may exhibit differences in their sensitivity to various fungicides. For example, some species of Colletotrichum are inherently resistant to benomyl and, thus, their baseline sensitivity has been used to separate species complexes [12,13,14,15]. The accurate species differentiation is crucial for the implementation of suitable management practices and may have quarantine significance [16,17].
Identification of plant pathogenic fungi at the species level has traditionally relied mainly on morphological and cultural characteristics. However, these traditional techniques are limited in their effectiveness as growth medium and temperature are known to cause variation in cultural and morphological characteristics [18]. Therefore, in the last few years, DNA sequence-based identification has also been widely used. Sequences of the internal transcribed spacer (ITS; ITS1/ITS4 region 5.8S) [19] are the most commonly used barcode loci for fungi; however, they alone are not always able to discriminate species of plant pathogenic fungi [20]. Multi-locus phylogenetic analyses have proven to be more reliable in addressing the challenge of identifying pathogenic fungal species [18,20]. In addition to ITS, protein-coding loci, such as Translation Elongation factor-1 (TEF-1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and actin (ACT), have been commonly used to resolve pathogenic fungal species infecting pomegranate, apple and citrus and other host plants [21,22,23].
Different species of Alternaria (A. alternata, A. arborescens, A. gaisen, A. mali and A. tenuissima) and Colletotrichum (C. gloeosporioides, C. fioriniae, C. nymphaeae, C. siamense, C. simmondsii and C. theobromicola) associated with heart rot and anthracnose/calyx end rot, respectively, have been reported from different pomegranate-growing regions worldwide [4,24,25,26,27,28]. Alternaria and Colletotrichum species are also known to cause diseases in several fruit and vegetable crops worldwide [29,30]. Consequently, cross infections of Alternaria and Colletotrichum species have been reported in many fruit crops [31,32,33]. Although it is a common practice of cultivating other horticultural crops in close proximity to pomegranate, it is, however, unknown if cross infections by Alternaria and Colletotrichum species occur between pomegranate and these crops.
In India, currently, Alternaria leaf spot, fruit spot and heart rot of pomegranate are imputed to A. alternata [7,9,30], and fruit anthracnose to C. gleosporoides [7,8,34,35,36]. Moreover, there are no studies available on species diversity and/or molecular characterization of Alternaria and Colletotrichum associated with pomegranate in India. Based on the findings of recent studies in other pomegranate-growing countries, we hypothesized that different species of these two fungal genera may be involved in the etiology of pomegranate fruit rots. Thus, the main objective of the present study was to identify and characterize Alternaria and Colletotrichum species associated with pomegranate fruit in India.

2. Materials and Methods

2.1. Sample Collection and Fungus Isolation

Alternaria and Colletotrichum isolates characterized in this study were isolated from symptomatic fruits and leaves of pomegranate collected from several orchards in different geographical regions of India, such as Maharashtra (MH), Karnataka (KA), Uttar Pradesh (UP), Madhya Pradesh (MP) and Tamil Nadu (TN), during 2015–2021 (Supplementary Table S1). For sample collection, places that were at least 100–150 km apart were included. Symptomatic tissues were excised, disinfected with 1% sodium hypochlorite (NaOCl) and thereafter rinsed three times with sterile distilled water. The sterile tissues were then placed on sterile potato dextrose agar (PDA, HiMedia Laboratories Pvt Ltd., Mumbai, India) medium with pH 7 and incubated at 24 ± 1 °C. All the isolates were purified by the hyphal tip technique and stored at 4 °C in mineral oil until further use. Of all the isolates, 12 Alternaria and 19 Colletotrichum isolates representative of the entire variability, were used for further characterization (Supplementary Table S1).

2.2. Morphological Characterization

Representative fungal isolates of Alternaria and Colletotrichum were grown on PDA amended with streptomycin sulphate (100 mg/L) at 25 ± 1 °C. Seven days after incubation, all the isolates were subjected to macroscopic and microscopic study by using a compound microscope (Nikon Eclipse 90i). Growth rate, colony appearance and conidium characteristics were recorded for each isolate of Alternaria and Colletotrichum according to the method previously described [21,37]. Statistical analyses of the data obtained were performed using WASP (Web Agri Stats Package) software available at https://ccari.icar.gov.in/waspnew.html (accessed on 30 June 2022). Multivariate statistical analysis, such as Principal Component Analysis, was performed using morphological data such as length and width of conidia.

2.3. Molecular Characterization

A multi-locus approach was employed to characterize the selected isolates of Alternaria and Colletotrichum. The barcoding genetic regions, such as ITS, LSU, NS and TEF-1 for Alternaria and ITS, GADPH and ACT for Colletotrichum, were PCR amplified and sequenced for characterization (Table 1). For genomic DNA isolation, mycelium was harvested from colonies of fungal isolates grown on PDA after 7 days of incubation at 24 ± 1 °C. Genomic DNA was extracted using the CTAB method described earlier [38] with some modifications. PCR was carried out in a 10 μL reaction mixture containing 1 μL of 50 ng g DNA, 0.25 μL of 10 µM primer forward and reverse each (Table 1), 4 µL of 2X PCR master mix (HiMedia Laboratories Pvt Ltd., Mumbai, India) and 4.5 μL molecular-grade sterile water. PCR was performed in a Thermocycler (HiMedia, Laboratories Pvt Ltd., Mumbai, India) with the following PCR program for ITS, LSU, NS and TEF-α amplification: initial denaturation at 95 °C for 3 min, followed by 35 cycles of denaturation (95 °C for 30 s), annealing (55 °C for 30 s), extension (72 °C for 30 s) and the final extension at 72 °C for 7 min. Amplification of GAPDH and ACT was performed using touchdown PCR with an initial denaturation at 94 °C for 5 min, followed by 16 cycles of denaturation (94 °C for 30 s), annealing (60 °C for 30 s) and extension (72 °C for 45 s), followed by 25 cycles of denaturation (94 °C for 30 s), annealing (55 °C for 30 s), extension (72 °C for 45 s) and the final extension at 72 °C for 10 min. The PCR product was resolved on 1% agarose gel and sequenced using Sanger sequencing at a commercial facility (Eurofins Genomics India Pvt. Ltd., Bengaluru, India). The obtained sequences were screened using Finch TV v 1.4.0 and searched against NCBI database using homology search (BLASTn). After validation, consensus sequences were deposited at GenBank, an NCBI database, with accession numbers given in Table 2 and Table 3.

2.4. Phylogenetic Analysis

Phylogenetic analysis was performed using sequences obtained from the PCR amplification of genetic regions of the Alternaria (ITS, LSU, NS and TEF-α) and Colletotrichum (TUB, CHS, ITS, GADPH and ACT) isolates used in the current study and validated representative sequences of different Alternaria and Colletotrichum species available in the database. Individual sequences were aligned using the MUSCLE algorithm in MEGA XI software [44] and a phylogenetic tree was constructed using the Maximum Likelihood method and the Tamura–Nei model; analysis was performed with 1000 bootstrap replications. Aligned sequences were also concatenated to obtain multi-locus sequences and used for phylogenetic tree construction using the Maximum Likelihood method and the Tamura–Nei model. Multi-locus sequence analysis (MLSA) was performed with 1000 bootstrap replications. A combined dataset of coding and non-coding regions was used in order to maximize the effectiveness of the genetic diversity analysis amongst Alternaria and Colletotrichum isolates obtained in the current study [19].

2.5. Pathogenicity tests

To prove Koch’s postulates, pathogenicity tests for selected isolates of Alternaria and Colletotrichum were performed in vitro using the mycelial plug inoculation method with some modifications [27]. Briefly, fresh healthy fruits of cv. Bhagawa were collected from bearing orchards (rainy season crop) of the National Research Centre (ICAR) on Pomegranate, Solapur, Maharashtra. Fruits were collected from the orchard where no pesticide sprays were used for the last 25 days and washed with distilled water to remove surface contaminants. Fruits were further disinfected with 70% ethanol and placed on plastic mesh platforms inside sterile glass jar chambers (diameter × height: 30 cm × 22.5 cm). Sterile distilled water was added underneath the platform (12–15 cm) to maintain high humidity (>70 %). Five fruits were inoculated (per isolate) with mycelial plugs (4 mm) at wounded and non-wounded sites from seven-day-old cultures grown on PDA. Healthy fruits were inoculated with PDA alone, which served as the control (Supplementary Figure S1). The inoculated fruits were incubated at room temperature for 7 days and observed regularly for onset of the symptoms.

3. Results and Discussion

3.1. Symptoms and Disease Incidence

Fungal pathogens belonging to the genus Alternaria and Colletotrichum cause disease on several horticultural plant species [28,45,46,47,48]. They have been reported to be destructive pathogens infecting pomegranate worldwide [6,25,28,49,50]. Alternaria causes heart rot of fruits and leafspot/blight, while Colletotrichum causes fruit anthracnose. In the current study, fruits with natural infections of Alternaria collected in various regions of India did not exhibit any damage or signs of rotting on the outer surface of the peel; however, they exhibited a peculiar external coloration of the peel (Figure 1a). When such fruits were cut open, the arils inside were brown and rotten (Figure 1b). The infected fruits at advanced stage produced a hollow sound when knocked, while healthy fruits did not. Moreover, infected fruits were lighter than healthy fruits of comparable size and age. These symptoms are characteristic of heart rot of pomegranate [25], and as such it may be difficult to identify heart rot visibly externally. Fruits infected with Colletotrichum exhibited characteristic brown-tan hard spots on the surface (Figure 1c). The lesions often displayed gray-orange fungal spore masses on the surface and expanded into the rind and arils, leading to fruit decay [51].
As per yearly data recorded in field surveys at the National Research Centre (ICAR) from 2015 to 2019, the incidence of pomegranate fruit rot ranged from 0 to 8% in the case of Alternaria and 0–27% in the case of Colletotrichum. However, a remarkable increase was observed in disease incidence in the last two years (2020–2022): up to 25% for Alternaria rot and 63% for Colletotrichum rot. During these surveys, infected samples were collected from pomegranate orchards in different geographical locations in India, from which around 30 and 45 isolates of Alternaria and Colletotrichum, respectively, were recovered. Out of these isolates, 12 Alternaria and 19 Colletotrichum isolates representing different geographical regions were selected based on their morphotypes (Table 2 and Supplementary Table S1). Most of the selected isolates were from Maharashtra, the leading area for pomegranate production and export.

3.2. Morphological Characterization of Isolates

Colonies produced by Alternaria and Colletotrichum isolates, when cultured on PDA, displayed intra-genus variability of morphological features. Alternaria isolates could be broadly grouped into three morphotypes based on colony morphology (Figure 2). Morphotype I: colonies that appeared greyish white on the obverse; on the reverse, the innermost part was dark brown with brownish white margins. Eight isolates (Alt-1, 3, 5, 6, 7, 8, JD and N) belonged to this morphotype. Morphotype II: colonies that appeared white on the obverse and light-brown with a white margin on the reverse. Isolates Alt-12 and 13 belonged to this morphotype. Morphotype III: colonies that appeared brownish on the obverse and light-brown with a white margin on the reverse. Isolates Alt-2 and MP6 belonged to this morphotype. The color of colonies (grey–white–brown) produced by Alternaria isolates in the current study (Supplementary Table S2) are characteristic of this genus [52,53]. The growth rate of different isolates ranged from 4.5 to 7 mm per day, with a maximum exhibited by isolate Alt-8 and a minimum by isolate Alt-13 (Table 4).
Conversely, Colletotrichum isolates could be broadly grouped into two morphotypes (Figure 3). Morphotype I comprised isolates that produced colonies which appeared white and fluffy (Col-1, 4, 11, 18, and 21), mostly with regular margins on the obverse and pale-yellow to yellow on the reverse. The majority of isolates (Col-2, 3, 6, 7, 8, 9, 12, 13, 14, 15, 17, 25, 26 and 27) belonged to morphotype II, which produced colonies that appeared grey in the middle with whitish irregular margins on the obverse and greyish yellow on the reverse. Such morphological features of colonies produced by Colletotrichum isolates in the current study (Supplementary Table S3) are characteristic of Colletotrichum as reported in previous studies by other authors [27,51]. The growth rate of different isolates ranged from 3.29 to 11.14 mm per day (Table 4).
Conidia produced by the majority of Alternaria isolates were ovoid, with only two isolates (Alt-8 and Alt-13) producing obclavate conidia, and appeared light-to-dark-brown under the microscope. Conidial length ranged from 11 to 27 µm, width from 5 to 8 µm, while the beak length varied from 1.9 to 3.7 µm (Supplementary Table S4). Conidia produced by Alt-2 were the shortest and those by Alt-8 were the longest (Figure 4). However, the beak length was shortest in the Alt-7 isolate and longest in the Alt-JD isolate. The dimensions of conidia, as observed in the current study, corresponded to those reported previously for small spore species of Alternaria [54]. The number of horizontal septa ranged from 2 to 5, while the number of vertical septa ranged from 0 to 2 amongst the isolates characterized in this study (Supplementary Table S4).
Colletotrichum isolates produced cylindrical, hyaline, single-celled conidia. Conidia of isolates Col-1, 2, 3, 9, 11, 12, 13, 14, 15, 17, 18 and 25 were rounded at both ends, while conidia of the rest of the isolates were pointed at one end and rounded at the other. Conidial length ranged from 7.9 to 17 µm and width from 2.1 to 3.2 µm, with a length-to-width ratio ranging between 2.7 and 5.3 (Figure 5, Supplementary Table S5).
Principal component analysis (PCA) was performed using conidial features for isolates of both Alternaria and Colletotrichum. However, based on these characteristics, no clustering or grouping could be obtained (Figure 6), confirming that morphological features alone are not sufficient to separate and identify the isolates [55]. Delimiting species boundaries and accurate identification of species belonging to the Alternaria genus within the Alternaria section is difficult because of the overlapping of characteristics and morphological plasticity under different cultural conditions [56]. Therefore, morphological characterization accompanied by molecular information has been utilized for species identification in Alternaria species [57]. Similarly, for Colletotrichum, the morphological features are not reliable for identifying species and defining species boundaries. Therefore, other features based on DNA/RNA sequences, secondary metabolite production or pathogenicity have been employed either alone or in combination for accurate identification of Colletotrichum species [16].

3.3. Molecular Characterization

Despite grouping into different morphotypes based on colony morphology, conidial features could not group the isolates. Since species belonging to Alternaria or Colletotrichum could not be adequately discriminated using morphological features alone, molecular approaches were also used. Individual genetic regions that were PCR amplified and sequenced were searched against the NCBI database. However, based on the BLASTn results, no single species could be deduced, and thus only genera were confirmed based on a homology search. Multi-locus phylogeny was applied for resolving such ambiguity at the species identification level. In particular, ITS, LSU, NS and TEF-α regions were targeted for identifying species of Alternaria, and ITS, ACT and GAPDH for Colletotrichum species (Table 1). Phylogenetic trees were drawn for individual fragments; however, the trees were not congruent (Supplementary Figures S2–S7). To resolve the incongruence posed by single-gene phylogeny, a combined dataset of coding and non-coding regions was used in order to maximize the effectiveness of the genetic diversity analysis amongst Alternaria and Colletotrichum isolates obtained in the current study. Since NS is not able to provide much information useful for species identification [56], it was excluded from the combined dataset.

3.4. Phylogenetic Analyses

Based on the result of multi-locus phylogenetic analysis, Alternaria isolates clustered into two groups: group I, containing seven isolates (Alt-1, 3, 5, 6, 8, JD and N), showing close relatedness with Alternaria species belonging to the A. alternata species complex; and group II, containing five isolates (Alt-2, 7, 12, 13 and MP6), showing close relatedness to A. burnsii (Figure 7). All isolates of morphotype I, except Alt-7, were in group I, while isolates of morphotype II and III were in group II, indicating a partial overlap between colony morphology and multi-gene phylogeny. The presence of A. arborescens close to A. alternata in group I could be due to inconsistencies related to the A. arborescens species complex (AASC) reported in the literature [22,56,58,59]. For example, some studies have reported AASC to be distinct from the A. alternata species complex, while others have identified AASC as a subspecies of A. alternata or a different morphotype. However, A. arborescens has been retained in Alternaria sect. Alternaria [56]. Consistently, the isolates indicated under group I in the current study were referred to Alternaria sect. Alternaria. Moreover, a number of species of Alternaria, including A. solani, have been reported to infect pomegranate [22,28,60]; however, many of these species were not represented among the isolates characterized in the current study. Alternaria species, due to their high adaptivity to different environmental conditions, can infect pomegranate fruits in both pre- and post-harvest stages [61]; they produce toxins which are important for their virulence and may contaminate fruits and the products processed downstream [22]. Moreover, some species, such as A. gaisen, are quarantine pathogens imposing export restrictions, and therefore accurate identification of Alternaria species also has toxicological and phytosanitary implications.
For multi-locus phylogeny of Colletotrichum isolates, sequences for species belonging to the Colletotrichum gloeosporioides species complex were retrieved [62]. In total, 52 species were included in the analysis, along with 17 isolates characterized in the current study. The combined dataset obtained by concatenation of five loci were used, and in case the sequence was not available, gaps were used in the alignment. As per the ML tree, the isolates belonging to morphotype I resolved well; for example, Col-1 and Col-4 showed close proximity to C. viniferum, Col-8 and Col-18 clustered together with Colletotrichum tainanense, while Col-21 grouped with Colletotrichum hederiicola. On the other hand, isolates belonging to morphotype II formed a separate cluster, showing closeness to the cluster containing Colletotrichum theobromicola and C. pseudotheobromicola. This cluster also contained Col-11, which belonged to morphotype I (Figure 8). Colletotrichum is one of the most economically important and highly damaging genus of plant pathogens and comprises several species complexes [62]. Colletotrichum gloeosporioides, long considered as a single species, is now regarded as one of the 14 Colletotrichum species complexes and encompasses 22 species [63,64,65,66,67]. In our study, some of the isolates showed close association with C. theobromicola, while others grouped with other species in the C. gloeosporioides species complex, indicating high genetic variability amongst them. Diversity of Colletotrichum species associated with the same host plant has also been reported for many anthracnose diseases of horticultural crops, such as citrus and olive, to name a few [15,68,69,70,71].
Since different Alternaria and Colletotrichum species have different sensitivity toward the commercially available and routinely applied fungicides [10,11,12,72,73], the complete and precise knowledge of the species involved in the etiology of heart rot and anthracnose of pomegranate fruits is the first step toward devising effective management strategies aimed at preventing these two major fungal diseases of pomegranate in India.

3.5. Pathogenicity Tests

Representative isolates were tested for their pathogenicity on detached fruits. Alternaria isolates obtained from both fruits and leaves induced rotting on the surface of fruit peel, as well as inside the fruit in the arils, 12 days after inoculation (Supplementary Figure S1). Alternaria alternata isolates produced both types of symptoms, while other species of Alternaria caused internal rotting only. All Colletotrichum isolates induced characteristic symptoms of anthracnose 12–15 days after inoculation (Supplementary Figure S1). Thus, Koch’s postulates were verified for both the pathogens.

4. Conclusions

The present study highlighted the variability of Alternaria and Colletotrichum associated with pomegranate in India and showed that heart rot and anthracnose of pomegranate fruits are caused by diverse Alternaria and Colletotrichum species, respectively. Most of these species were reported previously in other pomegranate-growing countries. However, many of the taxa identified in this study are first records on pomegranate in India, and A. burnsii is reported for the first time as a pathogen of pomegranate worldwide.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jof8101040/s1, Figure S1: Flowchart depicting steps performed during pathogenicity tests. Figure S2: Phylogenetic analysis using elongation factor (TEF-α) gene amplified and sequenced from Alternaria isolates. Maximum Likelihood tree drawn using MEGA XI with 1000 bootstraps. Figure S3: Phylogenetic analysis using ITS region amplified and sequenced from Alternaria isolates. Maximum Likelihood tree drawn using MEGA XI with 1000 bootstraps. Figure S4: Phylogenetic analysis using nuclear ribosomal large subunit (LSU) region amplified and sequenced from Alternaria isolates. Maximum Likelihood tree drawn using MEGA XI with 1000 bootstraps. Figure S5: Phylogenetic analysis using actin gene amplified and sequenced from Colletotrichum isolates. Maximum Likelihood tree drawn using MEGA XI with 1000 bootstraps. Figure S6: Phylogenetic analysis using GAPDH (glyceraldehyde phosphate dehydrogenase) gene amplified and sequenced from Colletotrichum isolates. Maximum Likelihood tree drawn using MEGA XI with 1000 bootstraps. Figure S7: Phylogenetic analysis using ITS region amplified and sequenced from Colletotrichum isolates. Maximum Likelihood tree drawn using MEGA XI with 1000 bootstraps. Table S1: Origin of isolates of Alternaria (n = 12) and Colletotrichum (n = 19) from pomegranate characterized in this study. Table S2: Morphotypes of Alternaria isolates (n = 12) characterized in the current study. Front and back of seven-day-old colonies grown on PDA at 25 °C. Table S3: Morphotypes of Colletotrichum isolates (n = 19) characterized in the current study. Front and back of seven-day-old colonies grown on PDA at 25 °C. Table S4: Microscopic features of conidia produced by different isolates (n = 12) of Alternaria characterized in this study. Table S5: Microscopic features of conidia produced by different isolates (n = 19) of Colletotrichum characterized in this study.

Author Contributions

Conceptualization, N.M.; Data curation, N.M., J.S., R.A. and P.G.P.; Formal analysis, N.M., J.S., S.S.P. and P.G.P.; Funding acquisition, R.A.M.; Investigation, J.D.S., M.G.C., A.B. and A.S.U.; Methodology, N.M. and J.S.; Project administration, R.A.M.; Resources, N M., J.S., S.S.P. and R.A.M.; Software, R.A. and J.D.S.; Writing—original draft, N.M. and R.A.; Writing—review and editing, N.M., R.A. and J.S. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Indian Council of Agricultural Research (ICAR) under the Institute Research Grant.

Informed Consent Statement

Not applicable.

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available within the article [and/or] its Supplementary Materials.

Acknowledgments

All authors acknowledge the research funding by ICAR provided to the National Research Centre on Pomegranate to carry out research activities in the institute.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Pangallo, S.; Li Destri Nicosia, M.G.; Agosteo, G.E.; Abdelfattah, A.; Romeo, F.V.; Cacciola, S.O.; Rapisarda, P.; Schena, L. Evaluation of a pomegranate peel extract as an alternative means to control olive anthracnose. Phytopathology 2017, 107, 1462–1467. [Google Scholar] [CrossRef] [PubMed]
  2. Belgacem, I.; Pangallo, S.; Abdelfattah, A.; Romeo, F.V.; Cacciola, S.O.; Li Destri Nicosia, M.G.; Ballistreri, G.; Schena, L. Transcriptomic analysis of orange fruit treated with pomegranate peel extract (PGE). Plants 2019, 8, 101. [Google Scholar] [CrossRef] [PubMed]
  3. Lacivita, V.; Incoronato, A.L.; Conte, A.; Del Nobile, M.A. Pomegranate Peel Powder as a Food Preservative in Fruit Salad: A Sustainable Approach. Foods 2021, 10, 1359. [Google Scholar] [CrossRef] [PubMed]
  4. Press Information Bureau, Government of India, Ministry of Agriculture & Farmers Welfare. Area Production 2020–2021. Available online: https://static.pib.gov.in/WriteReadData/specificdocs/documents/2021/oct/doc2021102951.pdf (accessed on 13 June 2022).
  5. APEDA. Available online: https://agricoop.nic.in/sites/default/files/202122%20%28First%20Advance%20Estimates%29%20%281%29_0.pdf (accessed on 13 June 2022).
  6. Munhuweyi, K.; Lennox, C.L.; Meitz-Hopkins, J.C.; Caleb, O.J.; Opara, U.L. Major diseases of pomegranate (Punica granatum L.), their causes and management—A review. Sci. Hortic. 2016, 211, 126–139. [Google Scholar] [CrossRef]
  7. Sharma, J.; Manjunath, G.; Xavier, K.V.; Vallad, G.E. Diseases and Management. In the Pomegranate: Botany, Production and Uses; Sarkhosh, A., Yavari, A., Zamani, Z., Eds.; CABI Publishing: Wallingford, UK, 2021; pp. 357–359. [Google Scholar]
  8. Jayalakshmi, K.; Nargund, V.B.; Raju, J.; Benagi, V.I.; Raghu, S.; Giri, M.S.; Basamma, R.B.; Priti, S.; Rajput, R.B. Pomegranate anthracnose caused by Colletotrichum gloeosporioides: A menace in quality fruit production. J. Pure Appl. Microbiol. 2015, 9, 3093–3097. [Google Scholar]
  9. Sharma, J.; Sharma, K.K.; Jadhav, V.T. Diseases of Pomegranate. In Diseases of Fruit Crops; Misra, A.K., Chowdappa, P., Sharma, P., Khetrapal, R.K., Eds.; Indian Phytopathological Society: New Delhi, India, 2012; Volume 343, pp. 181–224, ISBN1:81-7019-474-1; ISBN2:1-55528-331-4. [Google Scholar]
  10. Iacomi-Vasilescu, B.; Avenot, H.; Bataille-Simoneau, N.; Laurent, E.; Guénard, M.; Simoneau, P. In vitro fungicide sensitivity of Alternaria species pathogenic to crucifers and identification of Alternaria brassicicola field isolates highly resistant to both dicarboximides and phenylpyrroles. Crop Prot. 2004, 23, 481–488. [Google Scholar] [CrossRef]
  11. Budde-Rodriguez, S.; Pasche, J.S.; Mallik, I.; Gudmestad, N.C. Sensitivity of Alternaria spp. from potato to pyrimethanil, cyprodinil, and fludioxonil. Crop Prot. 2022, 152, 105855. [Google Scholar] [CrossRef]
  12. Peres, N.A.R.; Souza, N.L.; Peever, T.L.; Timmer, L.W. Benomyl sensitivity of isolates of Colletotrichum acutatum and C. gloeosporioides from citrus. Plant Dis. 2004, 88, 125–130. [Google Scholar] [CrossRef]
  13. Freeman, S.; Katan, T.; Shabi, E. Characterization of Colletotrichum species responsible for anthracnose diseases of various fruits. Plant Dis. 1998, 82, 596–605. [Google Scholar] [CrossRef]
  14. Cacciola, S.O.; Gilardi, G.; Faedda, R.; Schena, L.; Pane, A.; Garibaldi, A.; Gullino, M.L. Characterization of Colletotrichum ocimi population associated with black spot of sweet basil (Ocimum basilicum) in Northern Italy. Plants 2020, 9, 654. [Google Scholar] [CrossRef]
  15. Moral, J.; Agustí-Brisach, C.; Raya, M.C.; Jurado-Bello, J.; López-Moral, A.; Roca, L.F.; Chattaoui, M.; Rhouma, A.; Nigro, F.; Sergeeva, V.; et al. Diversity of Colletotrichum species associated with olive anthracnose worldwide. J. Fungi 2021, 7, 741. [Google Scholar] [CrossRef] [PubMed]
  16. Cai, L.; Hyde, K.D.; Taylor, P.W.J.; Weir, B.; Waller, J.; Abang, M.M.; Zhang, J.Z.; Yang, Y.L.; Phoulivong, S.; Liu, Z.Y.; et al. A polyphasic approach for studying Colletotrichum. Fungal Divers. 2009, 39, 183–204. [Google Scholar]
  17. Peres, N.A.R.; Souza, N.L.; Zitko, S.E.; Timmer, L.W. Activity of benomyl for control of postbloom fruit drop of citrus caused by Colletotrichum acutatum. Plant Dis. 2002, 86, 620–624. [Google Scholar] [CrossRef] [PubMed]
  18. Chethana, K.W.; Manawasinghe, I.S.; Hurdeal, V.G.; Bhunjun, C.S.; Appadoo, M.A.; Gentekaki, E.; Raspé, O.; Promputtha, I.; Hyde, K.D. What are fungal species and how to delineate them? Fungal Divers. 2021, 109, 1–25. [Google Scholar] [CrossRef]
  19. Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W. Fungal Barcoding Consortium, Fungal Barcoding Consortium Author List, Bolchacova, E. and Voigt, K.,. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA 2012, 109, 6241–6246. [Google Scholar] [CrossRef]
  20. Lücking, R.; Aime, M.C.; Robbertse, B. Unambiguous identification of fungi: Where do we stand and how accurate and precise is fungal DNA barcoding? IMA Fungus 2020, 11, 14. [Google Scholar] [CrossRef]
  21. Khodadadi, F.; González, J.B.; Martin, P.L.; Giroux, E.; Bilodeau, G.J.; Peter, K.A.; Doyle, V.P.; Aćimović, S.G. Identification and characterization of Colletotrichum species causing apple bitter rot in New York and description of C. noveboracense sp. nov. Sci. Rep. 2020, 10, 11043. [Google Scholar] [CrossRef]
  22. Aloi, F.; Riolo, M.; Sanzani, S.M.; Mincuzzi, A.; Ippolito, A.; Siciliano, I.; Pane, A.; Gullino, M.L.; Cacciola, S.O. Characterization of Alternaria species associated with heart rot of pomegranate fruit. J. Fungi 2021, 7, 172. [Google Scholar] [CrossRef]
  23. Saleem, A.; El-Shahir, A.A. Morphological and molecular characterization of some Alternaria species isolated from tomato fruits concerning mycotoxin production and polyketide synthase genes. Plants 2022, 11, 1168. [Google Scholar] [CrossRef]
  24. Michailides, T.; Morgan, D.; Quist, M.; Reyes, H. Infection of pomegranate by Alternaria spp. causing black heart. Phytopathology 2008, 98, S105. [Google Scholar]
  25. Ezra, D.; Kirshner, B.; Hershcovich, M.; Shtienberg, D.; Kosto, I. Heart rot of pomegranate: Disease etiology and the events leading to development of symptoms. Plant Dis. 2015, 99, 496–501. [Google Scholar] [CrossRef] [PubMed]
  26. Luo, Y.; Hou, L.; Förster, H.; Pryor, B.; Adaskaveg, J.E. Identification of Alternaria species causing heart rot of pomegranates in California. Plant Dis. 2017, 101, 421–427. [Google Scholar] [CrossRef] [PubMed]
  27. Xavier, K.V.; Kc, A.N.; Peres, N.A.; Deng, Z.; Castle, W.; Lovett, W.; Vallad, G.E. Characterization of Colletotrichum species causing anthracnose of pomegranate in the Southeastern United States. Plant Dis. 2019, 103, 2771–2780. [Google Scholar] [CrossRef] [PubMed]
  28. Cara, M.; Toska, M.; Frasheri, D.; Baroncelli, R.; Sanzani, S.M. Alternaria species causing pomegranate and citrus fruit rots in Albania. J. Plant Dis. Prot. 2022, 129, 1095–1104. [Google Scholar] [CrossRef]
  29. Singh, V. Alternaria diseases of vegetable crops and its management control to reduce the low production. Int. J. Agric. Sci. 2015, 7, 834–840. [Google Scholar]
  30. Maheshwari, S.K.; Haldhar, S.M. Disease Management in Arid Horticultural Crops; CIAH/Tech./Pub. No. 68; ICAR-Central Institute for Arid Horticulture: Bikaner, India, 2018; Volume 42. [Google Scholar]
  31. Troncoso-Rojas, R.; Tiznado-Hernández, M.E. Alternaria alternata (black rot, black spot). In Postharvest Decay; Academic Press: Cambridge, MA, USA, 2014; pp. 147–187. [Google Scholar]
  32. Lakshmi, B.K.M.; Reddy, P.N.; Prasad, R.D. Cross-infection potential of Colletotrichum gloeosporioides Penz. isolates causing anthracnose in subtropical fruit crops. Trop. Agric. Res. 2011, 22, 183–193. [Google Scholar] [CrossRef]
  33. Eaton, M.J.; Edwards, S.; Inocencio, H.A.; Machado, F.J.; Nuckles, E.M.; Farman, M.; Gauthier, N.A.; Vaillancourt, L.J. Diversity and cross-infection potential of Colletotrichum causing fruit rots in mixed-fruit orchards in Kentucky. Plant Dis. 2021, 105, 1115–1128. [Google Scholar] [CrossRef]
  34. Madhukar, J.; Reddy, S.M. Some new leaf spot diseases of pomegranate. Indian J. Mycol. Plant Pathol. 1988, 18, 171–172. [Google Scholar]
  35. Singh, R.S.; Chohan, J.S. A new fruit-rot disease of pomegranate. Curr. Sci. 1972, 41, 651. [Google Scholar]
  36. Sataraddi, A.R.; Prashanth, A.; Virupaksha Prabhu, H.; Jamadar, M.M.; Aski, S. Role of bio-agents and botanicals in the management of anthracnose of pomegranate. Acta Hortic. 2011, 890, 539–544. [Google Scholar] [CrossRef]
  37. Pryor, B.M.; Michailides, T.J. Morphological, pathogenic, and molecular characterization of Alternaria isolates associated with Alternaria late blight of pistachio. Phytopathology 2002, 92, 406–416. [Google Scholar] [CrossRef] [PubMed]
  38. Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
  39. White, T.J.; Bruns, T.D.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols, a Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar] [CrossRef]
  40. Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef] [PubMed]
  41. Rehner, S.A.; Buckley, E. Cryptic diversification in Beauveria bassiana inferred from nuclear its and ef1-alpha phylogenies. Mycologia 2005, 97, 84–98. [Google Scholar] [CrossRef] [PubMed]
  42. Johnston, P.R.; Jones, D. Relationships among Colletotrichum isolates from fruit-rots assessed using rDNA sequences. Mycologia 1997, 89, 420–430. [Google Scholar] [CrossRef]
  43. Peres, N.A.; MacKenzie, S.J.; Peever, T.L.; Timmer, L.W. Postbloom fruit drop of citrus and key lime anthracnose are caused by distinct phylogenetic lineages of Colletotrichum acutatum. Phytopathology 2008, 98, 345–352. [Google Scholar] [CrossRef] [Green Version]
  44. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  45. Sandoval-Contreras, T.; Betancourt-Rodríguez, J.; Garrido-Sánchez, L.; Ragazzo-Sánchez, J.A.; Iñiguez-Moreno, M.; Calderón-Santoyo, M. Effect of temperature on mycelial growth of Alternaria alternata and Colletotrichum gloeosporioides isolated from papaya fruit. Arch. Phytopathol. Plant Prot. 2021, 54, 1970–1988. [Google Scholar] [CrossRef]
  46. Timmer, L.W.; Peever, T.L.; Solel, Z.; Akimitsu, K. Alternaria diseases of citrus-novel pathosystems. Phytopathol. Mediterr. 2003, 42, 99–112. [Google Scholar]
  47. Riolo, M.; Aloi, F.; Pane, A.; Cara, M.; Cacciola, S.O. Twig and shoot dieback of citrus, a new disease caused by Colletotrichum species. Cells 2021, 10, 449. [Google Scholar] [CrossRef]
  48. Wang, F.; Yang, S.; Wang, Y.; Zhang, B.; Zhang, F.; Xue, H.; Jiang, Q.; Ma, Y. Overexpression of Chitinase gene enhances resistance to Colletotrichum gloeosporioides and Alternaria alternata in apple (Malus× domestica). Sci. Hortic. 2021, 277, 109779. [Google Scholar] [CrossRef]
  49. Thomidis, T. Fruit rots of pomegranate (cv. Wonderful) in Greece. Australas. Plant Pathol. 2014, 43, 583–588. [Google Scholar] [CrossRef]
  50. Uysal, A.; Kurt, Ş. Colletotrichum gloeosporiodes causing anthracnose on pomegranate in Turkey. Australas. Plant Dis. Notes 2018, 13, 19. [Google Scholar] [CrossRef]
  51. Gautam, A.K. Colletotrichum gloeosporioides: Biology, pathogenicity and management in India. J. Plant Physiol. Pathol. 2014, 2, 2–11. [Google Scholar] [CrossRef]
  52. Abkhoo, J.; Sabbagh, S.K. Evidence of Alternaria alternata causing leaf spot of Aloe vera in Iran. J. Phytopathol. 2014, 162, 516–518. [Google Scholar] [CrossRef]
  53. Chen, Y.J.; Meng, Q.; Zeng, L.; Tong, H.R. Phylogenetic and morphological characteristics of Alternaria alternata causing leaf spot disease on Camellia sinensis in China. Australas. Plant Pathol. 2018, 47, 335–342. [Google Scholar] [CrossRef]
  54. Simmons, E.G. Alternaria themes and variations (226-235): Classification of citrus pathogens. Mycotaxon 1999, 70, 263–323. [Google Scholar]
  55. Raja, H.A.; Miller, A.N.; Pearce, C.J.; Oberlies, N.H. Fungal identification using molecular tools: A primer for the natural products research community. J. Nat. Prod. 2017, 80, 756–770. [Google Scholar] [CrossRef]
  56. Woudenberg, J.H.C.; Seidl, M.F.J.; Groenewald, Z.; De Vries, M.; Stielow, J.B.; Thomma, B.P.H.J.; Crous, P.W. Alternaria section Alternaria: Species, formae speciales or pathotypes? Stud. Mycol. 2015, 82, 1–21. [Google Scholar]
  57. Ozkilinc, H.; Sevinc, U. Molecular phylogenetic species in Alternaria pathogens infecting pistachio and wild relatives. 3 Biotech 2018, 8, 1–7. [Google Scholar] [CrossRef]
  58. Andrew, M.; Peever, T.L.; Pryor, B.M. An expanded multilocus phylogeny does not resolve morphological species within the small-spored Alternaria species complex. Mycologia 2009, 101, 95–109. [Google Scholar] [CrossRef] [PubMed]
  59. Armitage, A.D.; Barbara, D.J.; Harrison, R.J.; Lane, C.R.; Sreenivasaprasad, S.; Woodhall, J.W.; Clarkson, J.P. Discrete lineages within Alternaria alternata species group: Identification using new highly variable loci and support from morphological characters. Fungal Biol. 2015, 119, 994–1006. [Google Scholar] [CrossRef] [PubMed]
  60. Gat, T.; Liarzi, O.; Skovorodnikova, Y.; Ezra, D. Characterization of Alternaria alternata causing black spot disease of pomegranate in Israel using a molecular marker. Plant Dis. 2012, 96, 1513–1518. [Google Scholar] [CrossRef] [PubMed]
  61. Mincuzzi, A.; Sanzani, S.M.; Palou, L.; Ragni, M.; Ippolito, A. Postharvest rot of pomegranate fruit in southern Italy: Characterization of the main pathogens. J. Fungi 2022, 8, 475. [Google Scholar] [CrossRef] [PubMed]
  62. Jayawardena, R.S.; Hyde, K.D.; Chen, Y.J.; Papp, V.; Palla, B.; Papp, D.; Bhunjun, C.S.; Hurdeal, V.G.; Senwanna, C.; Manawasinghe, I.S.; et al. One stop shop IV: Taxonomic update with molecular phylogeny for important phytopathogenic genera: 76–100 (2020). Fungal Divers. 2020, 103, 87–218. [Google Scholar] [CrossRef]
  63. Cannon, P.F.; Damm, U.; Johnston, P.R.; Weir, B.S. Colletotrichum–current status and future directions. Stud. Mycol. 2007, 59, 129–145. [Google Scholar] [CrossRef]
  64. Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef]
  65. Marin-Felix, Y.; Groenewald, J.Z.; Cai, L.; Chen, Q.; Marincowitz, S.; Barnes, I.; Bensch, K.; Braun, U.; Camporesi, E.; Damm, U.; et al. Genera of phytopathogenic fungi: GOPHY 1. Stud. Mycol. 2017, 86, 99–216. [Google Scholar] [CrossRef]
  66. Damm, U.; Sato, T.; Alizadeh, A.; Groenewald, J.Z.; Crous, P.W. The Colletotrichum dracaenophilum, C. magnum and C. orchidearum species complexes. Stud. Mycol. 2019, 92, 1–46. [Google Scholar] [CrossRef]
  67. de Silva, D.D.; Groenewald, J.Z.; Crous, P.W.; Ades, P.K.; Nasruddin, A.; Mongkolporn, O.; Taylor, P.W. Identification, prevalence and pathogenicity of Colletotrichum species causing anthracnose of Capsicum annuum in Asia. IMA Fungus 2019, 10, 1–32. [Google Scholar] [CrossRef]
  68. Zakaria, L. Diversity of Colletotrichum species associated with anthracnose disease in tropical fruit crops—A review. Agriculture 2021, 11, 297. [Google Scholar] [CrossRef]
  69. Talhinhas, P.; Sreenivasaprasad, S.; Neves-Martins, J.; Oliveira, H. Molecular and phenotypic analyses reveal association of diverse Colletotrichum acutatum groups and a low level of C. gloeosporioides with olive anthracnose. Appl. Environ. Microb. 2005, 71, 2987–2998. [Google Scholar] [CrossRef] [PubMed]
  70. Huang, F.; Chen, G.Q.; Hou, X.; Fu, Y.S.; Cai, L.; Hyde, K.D.; Li, H.Y. Colletotrichum species associated with cultivated citrus in China. Fungal Divers. 2013, 61, 61–74. [Google Scholar] [CrossRef]
  71. Wang, W.; de Silva, D.D.; Moslemi, A.; Edwards, J.; Ades, P.K.; Crous, P.W.; Taylor, P.W.J. Colletotrichum species causing anthracnose of citrus in Australia. J. Fungi 2021, 7, 47. [Google Scholar] [CrossRef]
  72. Matić, S.; Gilardi, G.; Varveri, M.; Garibaldi, A.; Gullino, M.L. Molecular diversity of Alternaria spp. from leafy vegetable crops, and their sensitivity to azoxystrobin and boscalid. Phytopathol. Mediterr. 2019, 58, 519–533. [Google Scholar] [CrossRef]
  73. Martin, P.L.; Krawczyk, T.; Pierce, K.; Thomas, C.; Khodadadi, F.; Aćimović, S.G.; Peter, K.A. Fungicide sensitivity of Colletotrichum species causing bitter rot of apple in the mid-Atlantic U.S.A. Plant Dis. 2022, 106, 549–563. [Google Scholar] [CrossRef]
Jof 08 01040 g001 550
Figure 1. Fruits showing characteristic symptoms of heart rot caused by Alternaria (a,b) and Calyx rot/fruit rot caused by Colletotrichum (c).
Figure 1. Fruits showing characteristic symptoms of heart rot caused by Alternaria (a,b) and Calyx rot/fruit rot caused by Colletotrichum (c).
Jof 08 01040 g001
Jof 08 01040 g002 550
Figure 2. Representative morphotypes of Alternaria isolates characterized in the current study. Front and back of seven-day-old colonies grown on PDA at 25 °C.
Figure 2. Representative morphotypes of Alternaria isolates characterized in the current study. Front and back of seven-day-old colonies grown on PDA at 25 °C.
Jof 08 01040 g002
Jof 08 01040 g003 550
Figure 3. Representative morphotypes of Colletotrichum isolates characterized in the current study. Front and back of seven-day-old colonies grown on PDA at 25 °C.
Figure 3. Representative morphotypes of Colletotrichum isolates characterized in the current study. Front and back of seven-day-old colonies grown on PDA at 25 °C.
Jof 08 01040 g003
Jof 08 01040 g004 550
Figure 4. Box plots showing the variation in length and width of conidia produced by Alternaria isolates characterized in the current study. Center lines show the medians; box limits indicate the 25th and 75th percentiles, as determined by R software; whiskers extend 1.5 times the interquartile range from the 25th and 75th percentiles; outliers are represented by dots. n = 5 sample points.
Figure 4. Box plots showing the variation in length and width of conidia produced by Alternaria isolates characterized in the current study. Center lines show the medians; box limits indicate the 25th and 75th percentiles, as determined by R software; whiskers extend 1.5 times the interquartile range from the 25th and 75th percentiles; outliers are represented by dots. n = 5 sample points.
Jof 08 01040 g004
Jof 08 01040 g005 550
Figure 5. Box plots showing the variation in length and width of conidia produced by Colletotrichum isolates characterized in the current study. Center lines show the medians; box limits indicate the 25th and 75th percentiles, as determined by R software; whiskers extend 1.5 times the interquartile range from the 25th and 75th percentiles; outliers are represented by dots. n = 5 sample points.
Figure 5. Box plots showing the variation in length and width of conidia produced by Colletotrichum isolates characterized in the current study. Center lines show the medians; box limits indicate the 25th and 75th percentiles, as determined by R software; whiskers extend 1.5 times the interquartile range from the 25th and 75th percentiles; outliers are represented by dots. n = 5 sample points.
Jof 08 01040 g005
Jof 08 01040 g006 550
Figure 6. Principal component analysis (PCA) of conidial features of isolates of Alternaria (a) and Colletotrichum (b).
Figure 6. Principal component analysis (PCA) of conidial features of isolates of Alternaria (a) and Colletotrichum (b).
Jof 08 01040 g006
Jof 08 01040 g007 550
Figure 7. Multi-locus sequence analysis (MLSA) using three genomic regions (ITS, LSU and TEF-α) of different isolates of Alternaria characterized in the current study. The Maximum Likelihood tree was drawn using MEGA XI with 1000 bootstraps. Isolates in red were of morphotype I, those in blue of morphotype II and those in green of morphotype III.
Figure 7. Multi-locus sequence analysis (MLSA) using three genomic regions (ITS, LSU and TEF-α) of different isolates of Alternaria characterized in the current study. The Maximum Likelihood tree was drawn using MEGA XI with 1000 bootstraps. Isolates in red were of morphotype I, those in blue of morphotype II and those in green of morphotype III.
Jof 08 01040 g007
Jof 08 01040 g008 550
Figure 8. Multi-locus sequence analysis based on five genomic regions (TUB, CHS, ITS, ACT and GAPDH) amplified from different isolates of Colletotrichum obtained from pomegranate in India and reference isolates of diverse species belonging to the Colletotrichum gloeosporioides species complex. The Maximum Likelihood (ML) tree was drawn using MEGA XI with 1000 bootstraps. Isolates in red belong to morphotype I, while those in blue to morphotype II.
Figure 8. Multi-locus sequence analysis based on five genomic regions (TUB, CHS, ITS, ACT and GAPDH) amplified from different isolates of Colletotrichum obtained from pomegranate in India and reference isolates of diverse species belonging to the Colletotrichum gloeosporioides species complex. The Maximum Likelihood (ML) tree was drawn using MEGA XI with 1000 bootstraps. Isolates in red belong to morphotype I, while those in blue to morphotype II.
Jof 08 01040 g008
Table
Table 1. Primers used for DNA amplification in the molecular characterization of Alternaria and Colletotrichum isolates.
Table 1. Primers used for DNA amplification in the molecular characterization of Alternaria and Colletotrichum isolates.
Region Amplified #Primer Sequences (5′-3′)Amplicon Size (bp)Reference
ITSa, cITS 1: TCTGTAGGTGAACCTGCGGG
ITS-4: TCCTCCGCTTA TTGATATGC		615[39]
LSUaLROR: ACCCGCTGAACTTAAGC
LR5: TCCTGAGGGAAACTTCG		986[40]
NSaNS1: GTAGTCATATGCTTGTCT
NS4: CTTCCGTCAATTCCCTTTAAG		1043[39]
TEF-αaEF-F: GCYCCYGGHCAYCGTGAYTTYAT
EF-R: ACHGTRCCRATACCACCRATCTTT		650[41]
ACTcACT512F: ATGTGCAAGGCCGGTTTCGC
ACT783R: TACGAGTCCTTCTGGCCCAT		230[42]
GAPDHcGDF1: GCCGTCAACGACCCCTTCATTGA
GDR1: GGGTGGAGTCGTACTTGAGCATGT		250[43]
# ITS: Internal Transcribed Spacer; LSU: Larger subunit; NS: Smaller subunit; TEF-α: Translation Elongation Factor-α; ACT: Actin; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; a: fragments amplified in Alternaria isolates, c: fragments amplified in Colletotrichum isolates.
Table
Table 2. Geographical origin and accession numbers of gene sequences of Alternaria isolates from pomegranate fruits characterized in the current study.
Table 2. Geographical origin and accession numbers of gene sequences of Alternaria isolates from pomegranate fruits characterized in the current study.
Isolate CodeGeographical LocationAccession Numbers of Gene Sequences
ITSLSUNSTEF-α
Alt-5Kanpur, UPOL662873OM073988OM108305ON971380
Alt-1Solapur, MHOL662874OM073989-ON993381
Alt-6Aurangabad, MHOL662875OM073990OM108306ON993382
Alt-7Solapur, MHOL662876OM073991OM108307ON993383
Alt-12Nanded, MHOL662877OM073992OM108308ON993384
Alt-13Solapur, MHOL662878OM073993OM108309ON993385
Alt-JDSolapur, MHOL662879OM073994OM108310ON993386
Alt-NBeed, MHOL662880OM073995OM108311ON993387
Alt-2Solapur, MHOL662881OM073996OM108312ON993388
Alt-3Parbhani, MHOL662882OM073997OM108313ON993389
Alt-8Chhindwara, MPOL662883OM073998OM108314ON993390
Alt-MP6Solapur, MHOL662884OM073999OM108315ON993391
Table
Table 3. Geographical origin and accession numbers of gene sequences of Colletotrichum isolates from pomegranate fruits characterized in the current study.
Table 3. Geographical origin and accession numbers of gene sequences of Colletotrichum isolates from pomegranate fruits characterized in the current study.
Isolate CodeGeographical LocationAccession Numbers of Gene Sequences
ITSACTGAPDH
Col-1Chitradurga, KAOM638721ON971379ON971360
Col-2Solapur, MHOM638722ON993365ON971361
Col-3Jalna, MHOM638723ON993366ON971374
Col-4Jalna, MHOM638724ON993367ON971362
Col-6Solapur, MHOM638725ON993368ON971363
Col-7Beed, MHOM638726ON993369ON971364
Col-8Satara, MHOM638727ON993370ON971375
Col-9Nandurbar, MHOM638728ON993371ON971365
Col-11Selam, TNOM638729ON993372ON971366
Col-12Solapur, MHOM638730ON993373ON971376
Col-13Jalna, MHOM638731ON993374ON971367
Col-14Solapur, MHOM638732ON993375ON971368
Col-15Solapur, MHOM638733ON993376ON971377
Col-17Solapur, MHOM638734ON993377ON971369
Col-18Solapur, MHOM638735ON993378ON971370
Col-21Bagalkot, KAON908458ON993379ON971378
Col-25Solapur, MHON908459-ON971371
Col-26Solapur, MHOM638736-ON971372
Col-27Solapur, MHON908460ON993380ON971373
Table
Table 4. Mean growth rate of isolates of diverse species of Alternaria (n = 12) and Colletotrichum (n = 19) from pomegranate characterized in this study determined after seven days incubation on PDA at 25 °C.
Table 4. Mean growth rate of isolates of diverse species of Alternaria (n = 12) and Colletotrichum (n = 19) from pomegranate characterized in this study determined after seven days incubation on PDA at 25 °C.
Isolate NameSpeciesGrowth Rate (mm/day) aIsolate NameSpeciesGrowth Rate (mm/day) a
Alternaria IsolatesColletotrichum Isolates
Alt-1A. alternata6.64 ± 0.5Col-1C. viniferum10.86 ± 0.14
Alt-2A. burnsii6.79 ± 0.07Col-2C. gloeosporioides10.71 ± 0.29
Alt-3A. alternata5.64 ± 0.07Col-3C. gloeosporioides5.57 ± 0.14
Alt-5A. alternata5.96 ± 0.39Col-4C. viniferum5.86 ± 0.0
Alt-6A. alternata6.93 ± 0.5Col-6C. gloeosporioides5.86 ± 0.0
Alt-7A. burnsii6.71 ± 1.14Col-7C. gloeosporioides10.57 ± 0.0
Alt-8A. alternata7.07 ± 0.07Col-8C. tainanense11.14 ± 0.0
Alt-12A. burnsii6.11 ± 0.68Col-9C. gloeosporioides5.29 ± 0.0
Alt-13A. burnsii4.50 ± 0.5Col-11C. gloeosporioides3.86 ± 0.0
Alt-JDA. alternata4.86 ± 0.86Col-12C. gloeosporioides10.00 ± 0.0
Alt-MP6A. burnsii5.64 ± 0.21Col-13C. gloeosporioides10.57 ± 0.0
Alt-NA. alternata6 ± 1.43Col-14C. gloeosporioides9.57 ± 0.43
Col-15C. gloeosporioides9.14 ± 0.0
Col-17C. gloeosporioides3.29 ± 0.0
Col-18C. tainanense5.29 ± 0.14
Col-21C. hederiicola5.43 ± 0.0
Col-25C. gloeosporioides3.29 ± 0.0
Col-26C. gloeosporioides5.14 ± 0.0
Col-27C. gloeosporioides9.86 ± 0.14
a Means of three replicates ± SD.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Manjunatha, N.; Sharma, J.; Pokhare, S.S.; Agarrwal, R.; Patil, P.G.; Sirsat, J.D.; Chakranarayan, M.G.; Bicchal, A.; Ukale, A.S.; Marathe, R.A. Characterization of Alternaria and Colletotrichum Species Associated with Pomegranate (Punica granatum L.) in Maharashtra State of India. J. Fungi 2022, 8, 1040. https://doi.org/10.3390/jof8101040

AMA Style

Manjunatha N, Sharma J, Pokhare SS, Agarrwal R, Patil PG, Sirsat JD, Chakranarayan MG, Bicchal A, Ukale AS, Marathe RA. Characterization of Alternaria and Colletotrichum Species Associated with Pomegranate (Punica granatum L.) in Maharashtra State of India. Journal of Fungi. 2022; 8(10):1040. https://doi.org/10.3390/jof8101040

Chicago/Turabian Style

Manjunatha, Nanjundappa, Jyotsana Sharma, Somnath S. Pokhare, Ruchi Agarrwal, Prakash G. Patil, Jaydip D. Sirsat, Mansi G. Chakranarayan, Aarti Bicchal, Anmol S. Ukale, and Rajiv A. Marathe. 2022. "Characterization of Alternaria and Colletotrichum Species Associated with Pomegranate (Punica granatum L.) in Maharashtra State of India" Journal of Fungi 8, no. 10: 1040. https://doi.org/10.3390/jof8101040

APA Style

Manjunatha, N., Sharma, J., Pokhare, S. S., Agarrwal, R., Patil, P. G., Sirsat, J. D., Chakranarayan, M. G., Bicchal, A., Ukale, A. S., & Marathe, R. A. (2022). Characterization of Alternaria and Colletotrichum Species Associated with Pomegranate (Punica granatum L.) in Maharashtra State of India. Journal of Fungi, 8(10), 1040. https://doi.org/10.3390/jof8101040

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop