Next Article in Journal
Comparative Study of Cypripedium Plant Photosynthetic Characteristics from Changbai Mountain
Previous Article in Journal
Insecticide Efficacy against Earias Species Infestation of Okra and Residue Analysis of Chlorantraniliprole under Field Conditions in India
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 9
Issue 3
10.3390/horticulturae9030357
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Marker-Assisted Selection of Male-Sterile and Maintainer Line in Chili Improvement by Backcross Breeding

by
Aatjima Na Jinda
1,2,
Maneechat Nikornpun
1,
Nakarin Jeeatid
1,
Siwaporn Thumdee
1,
Kamon Thippachote
1,
Tonapha Pusadee
1,* and
Jutamas Kumchai
1,*
1
Department of Plant and Soil Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand
2
Department of Agriculture Extension, Ministry of Agriculture and Cooperatives, Bangkok 10200, Thailand
*
Authors to whom correspondence should be addressed.
Horticulturae 2023, 9(3), 357; https://doi.org/10.3390/horticulturae9030357
Submission received: 2 February 2023 / Revised: 2 March 2023 / Accepted: 6 March 2023 / Published: 8 March 2023
(This article belongs to the Section Genetics, Genomics, Breeding, and Biotechnology (G2B2))
Browse Figures
Review Reports Versions Notes

Abstract

:
Cytoplasmic genic male sterility (CGMS) is a male sterility system that uses the maternal line for hybrid production, ensuring no obscurity of F1 seed purity and reducing the cost of hybrid seed production. Identification of the male sterility gene is important for plant improvement and classification when using the molecular marker-assisted selection (MAS) method. This study aimed to produce a new maternal line (A-line) and its maintainer line (B-line) by transferring a male-sterile line (A-line) and its maintainer line (B-line) gene from another variety to restorer lines (C-line) to achieve future hybrid seed production. In the process, the CGMS line (A-line) and B-line transferred to C1 and C3 lines, which finally resulted in new A-line (BC2F2A1 × C1, BC2F2A1 × C3), and B-line (BC1F2B1 × C1, BC1F2B1 × C3), and then used the MAS method for detecting genes and pollen viability test in the newly improved lines. The results indicated that the 3336-last2-SCAR (1639 bp) and 4162-SCAR (1046 bp) DNA markers classified the Rf locus, and the CMS-SCAR130/140 marker confirmed the S or N cytoplasm. The BC2F2A1 × C1 and BC2F2A1 × C3 lines represented both male-fertile (SRf_) and male-sterile (Srfrf) progenies in a Mendelian ratio of 3:1. Moreover, stained pollen grains with 1% acetocarmine confirmed abnormal pollen in male-sterile plants. The molecular markers that detect maintainer lines (Nrfrf) are BC1F2B1 × C1-14, BC1F2B1 × C3-10, and BC1F2B1 × C3-11. The 3336-last2-SCAR (1639 bp) and CMS-SCAR130/140 markers successfully identified the male-sterile line (Srfrf) and maintainer line (Nrfrf), and 4162-SCAR (1046 bp) detected the presence of the RfRf or Rfrf genotype in chilies at the seedling stage. The use of these markers was highly accurate and confirmed the results at the early generation stage of a conventional breeding program. It can be concluded that the CGMS and maintainer gene in chilies were successfully transferred during early generation using the backcross method.

1. Introduction

Chili is a major commercial vegetable crop worldwide used for both food and medicine [1]. It is widely used in cooking as a spice that provides spicy heat, flavoring, and color to foods [2]. Moreover, chili is used in food processing (viz., chili sauce, ground chili, dried chili, and pickled chili) [3] and in medicine through the extraction of capsaicin [4]. Chili (Capsicum annuum L. and C. frutescens L.) is one of the five major vegetables in Thailand with a total plant production area (northern and northeastern regions) and yield weight of 40,409 ha and 282,047 tons, respectively, in 2016 [5]. Thailand was the world’s second biggest dry chili producer in 2020 with 322,886 tons; the first being India, which produced 1,702,000 tons [6]. In 2019, Thailand exported THB 2.5 billion of chili (fresh product, frozen chili, ground chili, dried chili, and chili sauce). Therefore, it has become an economically important vegetable crop, especially in Thailand [7]. Presently, hybrid seeds are commonly used in commercial crop production to take advantage of the vigor, high yield, and high uniformity of certain hybrids [8]. However, the production of hybrid seeds is more costly compared to heirlooms due to their labor-intensive management, particularly the complicated procedures of emasculation and hand-pollination [9].
The male sterility system is used as a female parent for hybrid seed development to reduce the cost-intensive process of emasculation and associated laborious procedures [10]. Two systems are commonly used to develop hybrid seeds. The first is cytoplasmic genic male sterility (CGMS). The sterility factor causes reactions between sterile cytoplasm (S-type) and homozygous recessive genes in the nucleus (rf), usually occurring in the A-line (Srfrf) [11]. The A-line has the problem of pollen sterility, which is due to the abnormal anther size and a scarcity of available pollen grains [10]. However, the A-line can provide the seed for the next generation by crossing it with the maintainer line. The maintainer line has the normal cytoplasm (N) with homozygous recessive genes (rfrf), called the B-line (Nrfrf), which presents normal pollen grains (male fertility). If the dominant gene (Rf) has a fertile cytoplasm (N type) [12], it is the restorer line (NRfRf, R/C-line), which is used as a male line to produce hybrid seeds [13]. The second system is cytoplasmic male sterility (CMS), which is male sterility determined by the S cytoplasm with the similar use of the A-line, B-line, and C-line as the CGMS system in the process of developing hybrid seeds; for example, in cases of chili and muskmelon. The CMS system is also commercially exploited in cabbage, cauliflower, and onion [10] as well as for capsicum breeding. There are many genes that can be used to identify the Rf gene, such as Capana06g002967 and Capana06g002969 [14]. Moreover, Zhang et al. (2021) [15] found that gene CaRfm of non-pungent bell pepper (0601M line) linked the S1597 and S1609 markers and was thus applied in marker-assisted selection in a chili breeding program. Male sterility can be inherited using the backcrossing method.
Backcrossing is a plant breeding method used to transfer a desired trait controlled by one or a few genes from a donor parent to a recurrent parent that lacks one or two of these traits [16]. Wang et al. (2014) [17] showed that the male-sterile Brassica campestris L. ssp. chinensis L. S01 transferred the male sterility and other botanical traits to an inbred line of Wutacai (WT01: GMS-3) and was used as a female parent for the hybrid variety. Moreover, a backcross breeding program was used to transfer the genes contributing to submergence stress tolerance and grain yield from the Swarna-Sub1 variety to Maudamani rice, with the final process being improved by marker assistance [18].
Molecular marker-assisted selection (MAS) is instrumental in plant breeding. It facilitates the rapid screening for a recessive trait that is indirectly selected, shows high accuracy and efficiency of selection, and speeds up the procedure of crop improvement [19]. MAS for Rf genes helps select a restorer line/genotype in a CMS/Rf breeding program [13]. Many researchers have developed and reported markers for male sterility selection. Ren et al. (2022) [13] found that the CRF and SCD06-17 markers were screened in individual plants with the Rf gene, and 31 SSR markers showed the most successful screening in terms of similarity in the genetic background of the recurrent parent in BC1F1 and BC2F1 generations. Lee et al. (2010) [20] developed molecular markers linked to the ms1 gene using a combination of bulked segregant analysis (BSA) and amplified fragment length polymorphism (AFLP) techniques. By screening primers from all 1024 AFLP primers, it was found that E-AGC/M-GTG markers (514 bp) were linked to the ms1 gene and developed into a SCAR marker that could identify male-fertile and -sterile plants. Ji et al. (2014) [21] developed a sequence characterized amplified region (SCAR130) for the identification of the S cytoplasm in chili CMS lines (130 bp). Yeh et al. (2016) [22] and Sun et al. (2017) [23] used the SCAR130/140 marker to speed up CMS selection in chili (Capsicum annuum L.), and both researchers found that the SCAR130/140 marker can be used to screen the S cytoplasm. Jo et al. (2016) [24] developed molecular markers associated with the Rf gene and found that a marker developed from a sequence near CaPPR6 showed a higher accuracy rate of the Rf phenotype.
The present study was aimed at breeding the elite restorer line (C-line, C1, and C3) of chili by using the backcrossing method, which was obtained by transferring the CGMS of the A-line (A1) (donor) to C-lines (recurrent) (normal cytoplasm with homozygous dominant) in the first breeding program. In the second program, the B-line (B1, Nrfrf) was transferred to C-lines. This work created new A-lines and B-lines for hybrid seed production. The molecular markers (MAS) were used to identify S/N cytoplasms and Rf genes from the A-line and B-line (donor parents) in flower morphology, and pollen viability tests were used to identify the true male-sterile (no pollen grain/rudimentary pollen grain) and male-fertile (normal pollen) plants in the new A-line.

2. Materials and Methods

2.1. Plant Materials

In this crossing program, a male-sterile line, A1 (A-line: Srfrf), was crossed with two restorer lines, C1 and C3 (C-line: NRfRf), to obtain two crosses. All combinations were self-pollinated to produce F2 to select the male-sterile phenotype for backcrossing with a recurrent parent to produce BC1F1 to BC2F2. A new maintainer line, B1 (B-line; Nrfrf), was introduced for crossing with the two restorer lines, C1 and C3 (C-line; NRfRf). The progenies were self-pollinated to produce F2 for backcrossing with a recurrent parent to produce BC1F1 to BC1F2 (Table 1, Figure 1).

2.2. DNA Extraction and Polymerase Chain Reaction

Young leaves (0.2 g) of the BC2 generation of the A-line program, BC1 generation of B-line program, and parental lines were used for plant genomic DNA extraction according to a modified CTAB method [25,26,27]. Briefly, a mortar and pestle were used to grind young chili leaves in liquid nitrogen. The homogenate was dissolved in CTAB buffer, and the mixture was incubated at 65 °C for 30 min. The mixture was mixed with an equal volume of chloroform: isoamyl alcohol (24:1), then centrifuged at 4 °C and 14,000 rpm for 10 min to separate the phases. The supernatant was transferred to a new tube to which cold isopropanol was added and then incubated at −20 °C for 2 h. DNA was then pelleted by centrifuging at 4 °C and 14,000 rpm for 15 min. The pellets were washed twice with 500 µL of ice-cold 75% ethanol, and the ethanol was discarded. The DNA pellet was air-dried overnight and then dissolved in 50 µL TE buffer. The quality and concentration of the isolated DNA were determined by a spectrophotometer (ScanDrop2 by Analytik Jena AG).
The primer of 1.85 HRM (control), 3362-last2-SCAR, 4162SCAR, and SCAR130 were used for polymerase chain reactions (PCR) (Table 2). The PCR mixture (20 µL) consisted of 1 µL DNA template 30 ng/µL, 2 µL 10X buffer, 1 µL 25 mM MgCl2, 0.05 µL Taq DNA polymerase (Thermo Scientific), 0.08 µL 25 mM dNTPs, 0.5 µL from 100 ng/µL forward and reverse primers, 0.6 µL DMSO, and water.
The PCR reactions consisted of 35 cycles of 30 sec at 94 °C for denaturation, 30 s at annealing temperature, and 2 min at 72 °C for an extension. At the initial cycling profile, the reaction was heated for 5 min at 95 °C, and the final cycle was extended to 10 min at 72 °C (Table 2).
The amplified products were separated by electrophoresis on a 1.5% agarose gel, stained with MaestroSafeTM Nucleic Acid Stains (MAESTROGEN, Hsinchu City, Taiwan), and visualized with a BLooK LED transilluminator (GeneDireX, Taiwan).

2.3. Pollen Viability Test

To confirm male sterility, the BC2 generation of the A-line was evaluated using the pollen viability test [27]. The pollen grains were stained with 1% acetocarmine and observed under a digital compound microscope (Olympus CX31). The pollen grains stained with 1% acetocarmine that took on color for 5 min and were observed to have large and distinct shapes were considered viable or normal. At the same time, those that showed abnormal pollen or no pollen and were colorless were counted as indicating male sterility.

3. Results

3.1. Analysis of the Rf-Linked DNA Marker and S-Linked DNA Marker

The parental lines (A-line, B-line, and C-line), the BC2 generation of the A-line, and the BC1 generation of the B-line were investigated using CMS-SCAR130 for sterile (S) and normal (N) cytoplasms and using markers 3336-last2-SCAR and 4162-SCAR to evaluate the Rf-linkage. DNA markers of 3336-last2-SCAR and 4162-SCAR were used to classify whether the parental lines were of the Rf or rfrf genotype. C1 and C3 (1639 bp of 3336-last2-SCAR and 1046 bp of 4162-SCAR) were thus evaluated as having either the RfRf or Rfrf genotype. However, the markers did not present in A1 and B1, indicating that they have the rfrf genotype (Figure 2).
The 24 plant samples of BC2F2A1 × C1 were identified by the 3336-last2-SCAR marker, which showed banding at 1639 bp in the case of a fertile plant (RfRf or Rfrf). Eighteen plants were clearly found to be fertile. Meanwhile, plants no. 3, 7, 8, 14, 22, and 24 did not show DNA bands, meaning they were sterile (rfrf) (Table 3, Figure 3A top). The 4162-SCAR marker showed the same result as the 3336-last2-SCAR marker, except for plant no. 3, which presents banding at 1046 bp (Table 3, Figure 3A center).
Among the 24 plants of BC2F2A1 × C3 tested by the 3336-last2-SCAR marker, 20 plants showed banding at 1639 bp indicating they were fertile. The other four plants, no. 9, 14, 16, and 17, showed no DNA bands meaning that they were sterile (rfrf) (Table 3, Figure 3B top). Meanwhile, the 4162- SCAR marker showed the same results as the other marker (Table 3; Figure 3A Top) except in plant no. 17, which presented banding at 1046 bp, which is linked to rfrf (Table 3, Figure 3B center).
The 15 BC1F2 progenies of the B-line group were also tested with the 3336-last2-SCAR and 4162-SCAR markers. Figure 4 shows that 14 plants of BC1F2B1 × C1 had banding, indicating that they have the RfRf or Rfrf genotype and could thus not be used as a maintainer line. Only plant no. 14 could be designated a maintainer line (with rfrf genotype) (Table 4, Figure 4A top). Thirteen plants of BC1F2 B1 × C3 had the RfRf or Rfrf genotype, with two plants (no. 10 and 11) having the rfrf genotype (Table 4, Figure 4B).
The CMS-SCAR130/140 marker showed that the marker at 130 bp was present in A-line (A1), BC2F2A1 × C1, and BC2F2A1 × C3, whereas the 140 bp fragment was detected in the maintainer line (B1), the restorer line (C1 and C3), BC1F2B1 × C1, and BC1F2B1 × C3 (Figure 5).

3.2. Pollen Viability Test

Detection of pollen viability to confirm male sterility was carried out using the staining method with 1% acetocarmine. It was found that the B-line group showed regular flowers with shred anthers rich in pollen. The pollen viability showed normal pollen under fluorescence microscopy (Figure 6A). However, BC2F2A1 × C1 (plants no. 3, 7, 8, 14, 22, and 24) and BC2F2A1 × C3 (plants no. 9, 14, 16, and 17) showed small pollen grains, meaning it was rudimentary pollen and thus abnormal. The male-sterile plants could be visually identified from their phenotypical characteristics (i.e., male flower with non-viable pollen) (Figure 6B,C), and the results of the DNA marker analysis confirmed their male sterility traits.

4. Discussion

The CMS source of chili was reported by Peterson (1958) [28]. The CGMS and CMS lines are helpful as female lines for producing F1 hybrid seeds [29]. Therefore, these lines were essential for the chili breeding program. Sources of male-sterile lines have become more widespread for plant breeders by finding the genetic CGMS or CMS genes. The most common method for creating new genetic variables is the backcross method (BC), in which the CMS system, both the cytoplasm and nuclear gene, can transfer a trait from the maternal line to their hybrids and is controlled by one or two major and minor genes [30]. It can transfer the desired traits from the donor parent’s CGMS gene (A-line, Srfrf) and maintainer gene (B-line, Nrfrf) to the recurrent typical fertile plant to develop a new male-sterile gene for the hybrid seed production program [31]. For every backcross to the recurrent parent, the average germplasm portion from the donor parent is decreased by one-half [32], while the recurrent parent’s genome recovery increases during the CGMS transfer of BC2F2 at approximately 90–97 percent and the Nrfrf genes of BC1 in B-line types increase at approximately 87–88 percent [33]. Moreover, the presence of the Rf gene and N or S cytoplasm were detected by the specific MAS. Usman et al. (2020) [34] indicated that after backcrossing and the cycle of selfing, their target heat-tolerant gene had increased from 80.75 in the BC1F1 chili lines to 97.9 percent in the BC3F2 chili.
Several Rf-linked DNA markers, such as CRF-SCAR [30], PR-CAPS [35], BAC13T7 SCAR [36], Capana06g002967, and Capa-na06g002969 [14], and CaRfm-linked markers S1597 and S1609 [15] have been used in the literature. Our results, along with other findings, such as those of Sun et al. (2017) [23] and Min et al. (2009) [37], confirmed that the Rf-linked DNA markers 3336-last2-SCAR and 4162-SCAR showed an accuracy of 88.2–92.0% and 60%, respectively [24]. Therefore, they were successfully used to identify the Rf or rfrf genotype of BC2F2 of the A-line types and BC1F2 of the B-line types at the seedling stage in this study. Moreover, the Rf-linked DNA marker indicated that a single dominant gene controlled the male fertility (Rf gene) of chili plants [38].
The CMS-SCAR130/140 DNA marker can be used to screen S and N cytoplasms [22] during the seedling stage of chili peppers [39]. Fragments of 130 bp were found in the male steriles (A-line, BC2F2A1 × C1, and BC2F2A1 × C3), while 140 bp were found in the fertile plants (B-line, C-line, BC1F2B1 × C1, and BC1F2B1 × C3). Thus, CMS-SCAR130/140 was reliable and can be used for maintainer line screening [23].
The conventional selection of a maintainer line requires many steps. First, a male-sterile plant (tester), used as a female parent, is crossed with a male parent (unknown genotype). Then, the test crosses are evaluated if all progenies show male sterility, which indicates that the male parent is the maintainer line [40]. There are three types of male sterility: pollen sterility, in which each male-sterile system differs from the flowers of regular plants only in the absence of functional pollen grains or the presence of extremely non-functional pollen grains (this type is the most commonly used and plays an important role in plant breeding); the other types are structural or staminal male sterility and functional male sterility [9].
This study also confirmed the male sterility phenotype type of pollen sterility by conducting a pollen viability test [41]. The nucleus and the cytoplasm of pollen grains were stained with 1% acetocarmine [42] to observe whether they were fertile or sterile [43]. Staining is a reaction between hydrogen ions from cell respiration (living cells) and the dyes to produce colored compounds [44]. Therefore, the pollen from male-sterile plants is colorless and abnormal in shape. Pollen abortion in male-sterile plants possibly occurs in different stages [45]. The pollenless mutants showed meiotic defects and abnormalities in cell layers surrounding the locules. The study of mutant pollenless alleles showed that they localized specifically within meiotic cells and presented only during late meiosis, which led to the production of abnormal tetrad-like structures in anther development [46]. Many reports have shown that this was related to the tapetum. Luo et al. (2006) [47] found that abnormal swelling of the tapetum affected pollen abortion in the anther of pepper CMS 21. Tapetum is a source of nutrients and structural components for pollen development during the tetrad stage of meiosis in the pepper [48]. Ahmadikhah et al. (2015) [49] improved a rice hybrid crossed from IR68897 (CMS gene) and Yosen B (maintainer line). The hybrid was improved until BC1F1, which had the CMS gene, using the wild abortive CMS specific marker confirmation and sterile pollen stained with I2-KI. Therefore, the study of molecular markers and flower morphology can be an efficient and precise tool for plant breeders as its use helps optimize the time, resources, and effort for plant improvement and breeding work [50].

5. Conclusions

The development of male-sterile and maintainer lines was completely accomplished in the first generation of the backcrossing program for transferring genes. The 3336-last2-SCAR and 4162-SCAR markers were successfully used to screen for the Rf and rf gene in the new male-sterile lines (A-line, BC2F2A1 × C1 and BC2F2A1 × C3) and maintainer lines (B-line, BC1F2B1 × C1 and BC1F2B1 × C3) in chilies. The CMS-SCAR marker identified the group of male-sterile and male-fertile types, of which the CMS-SCAR130 DNA marker confirmed the new A-lines and the CMS-SCAR140 DNA marker indicated the B-lines in chilies. This project successfully improved the new CGMS female parent and its maintainer to produce CGMS-based commercial chili hybrids following the result of the pollen viability test. The use of molecular marker-assisted selection can reduce the time of the conventional selection method because it is practical, precise, and rapid.

Author Contributions

Conceptualization, J.K., M.N. and T.P.; methodology, J.K., T.P., K.T. and A.N.J.; software, A.N.J.; validation, J.K. and A.N.J.; formal analysis, J.K., T.P. and A.N.J.; investigation, J.K., A.N.J. and T.P.; resources, J.K., M.N., N.J., S.T. and K.T.; data curation, J.K. and A.N.J.; writing—original draft preparation, J.K. and A.N.J.; writing—review and editing, J.K., M.N., S.T. and T.P.; visualization, J.K.; supervision, J.K., T.P. and S.T.; project administration, J.K.; funding acquisition, J.K. and T.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

J.K. is responsible for data keeping, and data are available upon request.

Acknowledgments

This work was supported by Faculty of Agriculture, Chiang Mai University, and Graduate School, Chiang Mai University.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Lozada, D.N.; Bosland, P.W.; Barchenger, D.W.; Haghshenas-Jaryani, M.; Sanogo, S.; Walker, S. Chile pepper (Capsicum) breeding and improvement in the “Multi-Omics” Era. Front. Plant Sci. 2022, 13, 879182. [Google Scholar] [CrossRef]
  2. Techawongstien, S. Chili: Production Management and Breeding; Press Media Co.: Bangkok, Thailand, 2006; pp. 2–6. (In Thai) [Google Scholar]
  3. Milerue, N.; Nikornpun, M. Studies on heterosis of chili (Capsicum annuum L.). Kasetsart J. (Nat. Sci.) 2000, 34, 90–196. [Google Scholar]
  4. Jeeatid, N.; Suriharn, B.; Techawongstien, S.; Chanthai, S.; Bosland, P.W.; Techawongstien, S. Evaluation of the effect of genotype-by-environment interaction on capsaicinoid production in hot pepper hybrids (Capsicum chinense Jacq.) under controlled environment. Sci. Hortic. 2018, 235, 334–339. [Google Scholar] [CrossRef]
  5. Kim, M.K.; Jang, J.H.; Potchanasin, P.; Chae, W.B.; Yoo, E.H.; Taek-Ryoun, K. Current status and breeding perspectives of major vegetable crops in Thailand. J. Korean Soc. Int. Agric. 2019, 31, 67–75. [Google Scholar] [CrossRef]
  6. Buchholz, K. The Biggest Producers of Chilis. Available online: https://www.statista.com/chart/28756/countries-producing-the-biggest-amount-of-dry-chilis-and-peppers/ (accessed on 28 February 2022).
  7. Office of Permanent Secretary Ministry of Commerce, Exports Group Structure. Thailand Trading Report. 2019. Available online: http://www.ops3.moc.go.th/infor/menucomth/stru1export/exportre/report.asp (accessed on 17 September 2019).
  8. Hundal, J.S.; Dhall, R.K.; Tripathi, S.K. Breeding for hybrid hot pepper. In Hybrid Vegetable Development; Singh, P.K., Dasgupta, S.K., Tripathi, S.K., Eds.; Food Products Press: New York, NY, USA, 2004; pp. 40–44. [Google Scholar]
  9. Colombo, N.; Galmarini, C.R. The use of genetic, manual and chemical methods to control pollination in vegetable hybrid seed production: A review. Plant Breed. 2017, 136, 287–299. [Google Scholar] [CrossRef] [Green Version]
  10. Hussain, S.M.; Khursheed, H.; Farwah, S.; Rizvi, S.; Rashid, M.; Saleem, S.; Andrabi, N.; Rashid, H. Male sterility in vegetable crops. J. Pharmacogn. Phytochem. 2018, 7, 3390–3393. [Google Scholar]
  11. Chen, L.; Liu, Y.G. Male sterility and fertility restoration in crops. Annu. Rev. Plant Biol. 2014, 65, 579–606. [Google Scholar] [CrossRef]
  12. Kim, Y.J.; Zhang, D. Molecular control of male fertility for crop hybrid breeding. Trends Plant Sci. 2018, 23, 53–65. [Google Scholar] [CrossRef]
  13. Ren, F.S.; Yang, H.F.; Jiao, Y.S.; Zhang, R.P.; Guo, Z.W.; Liu, H.J.; Sun, Q.; Li, X.J.; Tan, X.F.; Zhang, B.; et al. Fertility conversion between cytoplasmic maintainer lines and restorer lines through molecular marker-assisted selection in pepper (Capsicum annuum L.). Biologia 2022, 77, 2351–2358. [Google Scholar] [CrossRef]
  14. Wu, L.; Wang, P.; Wang, Y.; Cheng, Q.; Lu, Q.; Liu, J.; Li, T.; Ai, Y.; Yang, W.; Sun, L.; et al. Genome-wide correlation of 36 agronomic traits in the 287 pepper (Capsicum) accessions obtained from the SLAF-seq-based GWAS. Inter. J. Molecul. Sci. 2019, 20, 5675. [Google Scholar] [CrossRef] [Green Version]
  15. Zhang, Z.; An, D.; Cao, Y.; Yu, H.; Zhu, Y.; Mei, Y.; Zhang, B.; Wang, L. Development and application of KASP markers associated with Restorer-of-fertility gene in Capsicum annuum L. Physiol. Mol. Biol. Plants 2021, 27, 2757–2765. [Google Scholar] [CrossRef] [PubMed]
  16. Reyes-Valde’s, M.H. A model for marker-based selection in gene introgression breeding programs. Crop Sci. 2000, 40, 91–98. [Google Scholar] [CrossRef]
  17. Wang, Q.S.; Zhang, X.; Li, C.Y.; Liu, Z.; Feng, Y.H. Directional transfer of a multiple-allele male sterile line in Brassica campestris L. ssp. chinensis (L.) Makino var. rosularis Tsen et Lee. Breed. Sci. 2014, 64, 149–155. [Google Scholar] [CrossRef] [Green Version]
  18. Kaushik, S.; Djiwanti, S.R. Genetic improvements of traits for enhancing NPK acquisition and utilization efficiency in plants. In Plant Macronutrient Use Efficiency: Molecular and Genomic Perspectives in Crop Plants; Hossain, M.A., Kamiya, T., Burritt, D., Tran, L.S.P., Fujiwara, T., Eds.; Academic Press: Cambridge, MA, USA, 2017; pp. 267–283. [Google Scholar]
  19. Varshney, R.K.; Roorkiwal, M.; Sorrells, M.E. Genomic selection for crop improvement: An introduction. In Genomic Selection for Crop Improvement; Varshney, R.K., Roorkiwal, M., Sorrells, M.E., Eds.; Springer: New York, NY, USA, 2017; pp. 1–6. [Google Scholar]
  20. Lee, J.; Yoon, J.B.; Han, J.H.; Lee, W.P.; Do, J.W.; Ryu, H.S.; Kim, H.; Park, H.G. A codominant SCAR marker linked to the genic male sterility gene (ms1) in chili pepper (Capsicum annuum). Plant Breed. 2010, 129, 35–38. [Google Scholar] [CrossRef]
  21. Ji, J.J.; Huang, W.; Yin, Y.X.; Li, Z.; Gong, Z.H. Development of a SCAR marker for early identification of S-cytoplasm based on mitochondrial SRAP analysis in pepper (Capsicum annuum L.). Mol. Breed. 2014, 33, 679–690. [Google Scholar] [CrossRef]
  22. Yeh, T.; Lin, S.; Shieh, H.; Teoh, Y.; Kumar, S. Markers for cytoplasmic male sterility (CMS) traits in chili peppers (Capsicum annuum L.). I: Multiplex PCR and validation. SABRAO J. Breed. Genet. 2016, 48, 465–473. [Google Scholar]
  23. Sun, G.S.; Dai, Z.L.; Bosland, P.W.; Wang, Q.; Sun, C.Q.; Zhang, Z.C.; Ma, Z.H. Characterizing and marker-assisting a novel chili pepper (Capsicum annuum L.) yellow bud mutant with cytoplasmic male sterility. Genet. Mol. Res. 2017, 16, gmr16019459. [Google Scholar] [CrossRef]
  24. Jo, Y.D.; Ha, Y.; Lee, J.H.; Park, M.; Bergsma, A.C.; Choi, H.I.; Goritschnig, S.; Kloosterman, B.; Van Dijk, P.J.; Choi, D.; et al. Fine mapping of restorer-of-fertility in pepper (Capsicum annuum L.) identified a candidate gene encoding a pentatricopeptide repeat (PPR)-containing protein. Theor. Appl. Genet. 2016, 129, 2003–2017. [Google Scholar] [CrossRef]
  25. Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Focus 1987, 12, 3–15. [Google Scholar]
  26. Winnepenninckx, B.; Backeljau, T.; de Wachter, R. Extraction of high molecular weight DNA from molluscs. Trends Genet. 1993, 9, 407. [Google Scholar]
  27. Kumchai, J.; Wei, Y.C.; Lee, C.Y.; Chen, F.C.; Chin, S.W. Production of interspecific hybrids between commercial cultivars of the eggplant (Solanum melongena L.) and its wild relative. S. Torvum. Genet. Mol. Res. 2013, 12, 755–764. [Google Scholar] [CrossRef] [PubMed]
  28. Peterson, P.A. Cytoplasmically inherited male sterility in Capsicum. Am. Nat. 1958, 92, 111–119. [Google Scholar] [CrossRef]
  29. Cheng, Q.; Wang, P.; Liu, J.Q.; Wu, L.; Zhang, Z.P.; Li, T.T.; Gao, W.J.; Yang, W.C.; Sun, L.; Shen, H.L. Identification of candidate genes under lying genic male–sterile msc-1 locus via genome resequencing in Capsicum annuum L. Theor. App. Genet. 2018, 131, 1861–1872. [Google Scholar] [CrossRef]
  30. Gulyas, G.; Pakozdi, K.; Lee, J.S.; Hirata, Y. Analysis of fertility restoration by using cytoplasmic male-steriles red pepper (Capsicum annuum L.). Breed. Sci. 2006, 56, 331–334. [Google Scholar] [CrossRef] [Green Version]
  31. Vogel, K.E. Backcross Breeding. Transgenic Maize Methods and Protocols Springer Protocals Methods in Molecular Biology; Humana Press: New York, NY, USA, 2009; pp. 161–169. [Google Scholar]
  32. Briggs, F.N.; Knowles, P.F. Introduction to Plant Breeding; Reinhold Publishing Coorperation: New York, NY, USA, 1967; pp. 162–174. [Google Scholar]
  33. Bellundagi, A.; Ramya, K.T.; Krishna, H.; Jain, N.; Shashikumara, P.; Singh, P.K.; Singh, G.P.; Prabhu, K.V. Marker-assisted backcross breeding for heat tolerance in bread wheat (Triticum aestivum L.). Front. Genet. 2022, 13, 1056783. [Google Scholar] [CrossRef] [PubMed]
  34. Usman, M.G.; Rafii, M.Y.; Yusuff, O.; Martini, M.Y.; Ismail, M.R.; Ridzuan, R. Molecular confirmation of candidate Hsp70 gene associated with heat tolerancein BC3F2 advanced backcross lines and their phenotypic resemblance with recurrent chilli Kulai. Acta Agric. Scand. B 2020, 70, 252–264. [Google Scholar]
  35. Lee, J.; Yoon, J.B.; Park, H.G. A CAPS marker associated with the partial restoration of cytoplasmic male sterility in chili pepper (Capsicum annuum L.). Mol. Breed. 2008, 21, 95–104. [Google Scholar] [CrossRef]
  36. Jo, Y.D.; Kim, Y.M.; Park, M.N.; Yoo, J.H.; Park, M.; Kim, B.D.; Kang, B.C. Development and evaluation of broadly applicable markers for restorer-of-fertility in pepper. Mol. Breed. 2010, 25, 187–201. [Google Scholar] [CrossRef]
  37. Min, W.K.; Kim, S.; Sung, S.K.; Kim, B.D.; Lee, S. Allelic discrimination of the restorer of fertility gene and its inheritance in peppers (Capsicum annuum L.). Theor. Appl. Genet. 2009, 119, 1289–1299. [Google Scholar] [CrossRef]
  38. Nei, Z.; Song, Y.; Wang, H.; Chen, J.; Niu, Q.; Zhu, W. Fine mapping and gene analysis of restorer-of -fertility gene CaRfHZ in pepper (Capsicum annuum L.). Int. J. Mol. Sci. 2022, 23, 7633. [Google Scholar]
  39. Dhaliwal, M.S.; Jindal, S.K. Induction and exploitation of nuclear and cytoplasmic male sterility in pepper (Capsicum spp.): A review. J. Hortic. Sci. Biotechnol. 2014, 89, 471–479. [Google Scholar] [CrossRef]
  40. Usman, M.; Ziaf, K.; Ye, Z. Breeding and crop improvement. In Breeding of Horticultural Crops; Khan, A.S., Ziaf, K., Eds.; Horticulture Science and Technology, University of Agriculture: Faisalabad, Pakistan, 2017; pp. 25–65. [Google Scholar]
  41. Jugulam, M.; Ziauddin, A.; So, K.K.Y.; Chen, S.; Hall, J.C. Transfer of Dicamba tolerance from Sinapis arvensis to Brassica napus via embryo rescue and recurrent backcross breeding. PLoS ONE 2015, 10, e0141418. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Lee, H.I.; Havey, M.J. Variable penetrance among different sources of the male fertility restoration allele of onion. Hortscience 2020, 55, 543–546. [Google Scholar] [CrossRef] [Green Version]
  43. Rattenbury, J.A. Specific staining of nucleolar substance with aceto-carmine. Stain Technol. 1952, 27, 113–120. [Google Scholar] [CrossRef]
  44. Dapson, R.W. The history, chemistry, and modes of action of carmine and related dyes. Biotech. Histochem. 2007, 82, 173–187. [Google Scholar] [CrossRef] [PubMed]
  45. Cheng, Q.; Ting, L.; Yixin, A.; Qiaohua, L.; Yihao, W.; Lang, W.; Jinqiu, L.; Liang, S.; Huolin, S. Phenotypic, genetic, and molecular function of msc-2, a genic male sterile mutant in pepper (Capsicum annuum L.). Theor. Appl. Genet. 2019, 133, 843–855. [Google Scholar] [CrossRef]
  46. Sanders, P.M.; Bui, A.Q.; Weterings, K.; McIntire, K.N.; Hsu, Y.C.; Lee, P.Y.; Truong, M.T.; Beals, T.P.; Goldberg, R.B. Anther developmental defects in Arabidopsis thaliana male-sterile mutants. Sex Plant Reprod. 1999, 11, 297–322. [Google Scholar] [CrossRef]
  47. Luo, X.D.; Dai, L.F.; Wang, S.B.; Wolukau, J.; Jáhn, M.; Chen, J.F. Male gamete development and early tapetal degeneration in cytoplasmic male-sterile pepper investigated by meiotic, anatomical and ultrastructural analyse. Plant Breed. 2006, 125, 395–399. [Google Scholar] [CrossRef]
  48. Guo, J.; Wang, P.; Cheng, Q.; Sun, L.; Wang, H.; Wang, Y.; Kao, L.; Li, Y.; Qiu, T.; Yang, W.; et al. Proteomic analysis reveals strong mitochondrial involvement in cytoplasmic male sterility of pepper (Capsicum annuum L.). J. Proteom. 2017, 168, 15–27. [Google Scholar] [CrossRef]
  49. Ahmadikhah, A.; Mirarab, M.; Pahlevani, M.H.; Nayyeripasand, L. Marker-assisted backcrossing to develop an elite cytoplasmic male sterility line in rice. Plant Genome 2015, 8, plantgenome2014.07.0031. [Google Scholar] [CrossRef]
  50. Collard, B.C.Y.; Mackill, D.J. Marker-assisted selection: An approach for precision plant breeding in the twenty-first century. Philos. Trans. R. Soc. B 2008, 363, 557–572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Horticulturae 09 00357 g001 550
Figure 1. Backcross breeding with a recessive trait program for the development of male-sterile (A-line program) and maintainer lines (B-line program) by transferring genes to C-lines (elite restorer lines).
Figure 1. Backcross breeding with a recessive trait program for the development of male-sterile (A-line program) and maintainer lines (B-line program) by transferring genes to C-lines (elite restorer lines).
Horticulturae 09 00357 g001
Horticulturae 09 00357 g002 550
Figure 2. Amplification of Rf-linkage DNA marker in parental lines (A-line, B-line, and C-line). Lanes: 1 (100 bp DNA ladder), 2 to 5 (1.85 HRM marker (control)), 6 to 9 (3336-last2-SCAR marker), and 10 to 13 (4162-SCAR marker).
Figure 2. Amplification of Rf-linkage DNA marker in parental lines (A-line, B-line, and C-line). Lanes: 1 (100 bp DNA ladder), 2 to 5 (1.85 HRM marker (control)), 6 to 9 (3336-last2-SCAR marker), and 10 to 13 (4162-SCAR marker).
Horticulturae 09 00357 g002
Horticulturae 09 00357 g003 550
Figure 3. Amplification of 3336-last2-SCAR (top), 4162-SCAR (center), and 1.85 HRM (control) (bottom) in BC2F2 progeny of the A-line group for 24 plants (lanes 1–24), BC2F2A1 × C1 (A), BC2F2A1 × C3 (B), and 100 bp DNA ladder (lane M).
Figure 3. Amplification of 3336-last2-SCAR (top), 4162-SCAR (center), and 1.85 HRM (control) (bottom) in BC2F2 progeny of the A-line group for 24 plants (lanes 1–24), BC2F2A1 × C1 (A), BC2F2A1 × C3 (B), and 100 bp DNA ladder (lane M).
Horticulturae 09 00357 g003
Horticulturae 09 00357 g004 550
Figure 4. Amplification of 3336-last2-SCAR (top), 4162-SCAR (center), and 1.85 HRM (control) (bottom) in BC1F2 progeny of B-line group for 15 plants (Lanes 1–15), BC1F2B1 × C1 (A), BC1F2B1 × C3 (B), and 100 bp DNA ladder (lane M).
Figure 4. Amplification of 3336-last2-SCAR (top), 4162-SCAR (center), and 1.85 HRM (control) (bottom) in BC1F2 progeny of B-line group for 15 plants (Lanes 1–15), BC1F2B1 × C1 (A), BC1F2B1 × C3 (B), and 100 bp DNA ladder (lane M).
Horticulturae 09 00357 g004
Horticulturae 09 00357 g005 550
Figure 5. Amplification of CMS-SCAR130/140 DNA marker in parental lines, BC2F2 of A-line and BC1F2 of B-line. Lane M (100 bp DNA ladder), lane 1 (A-line), lane 2 (B-line), lane 3 (C1), lane 4 (C3), lanes 5–10 (BC2F2A1 × C1; no. 3, 7, 8, 14, 22, and 24), lanes 11–14 (BC2F2A1 × C3; no. 9, 14, 16, and 17), lane 15 (BC1F2B1 × C1-14) and lanes 16–17 (BC1F2B1 × C3; no.10 and 11).
Figure 5. Amplification of CMS-SCAR130/140 DNA marker in parental lines, BC2F2 of A-line and BC1F2 of B-line. Lane M (100 bp DNA ladder), lane 1 (A-line), lane 2 (B-line), lane 3 (C1), lane 4 (C3), lanes 5–10 (BC2F2A1 × C1; no. 3, 7, 8, 14, 22, and 24), lanes 11–14 (BC2F2A1 × C3; no. 9, 14, 16, and 17), lane 15 (BC1F2B1 × C1-14) and lanes 16–17 (BC1F2B1 × C3; no.10 and 11).
Horticulturae 09 00357 g005
Horticulturae 09 00357 g006a 550Horticulturae 09 00357 g006b 550
Figure 6. Morphological characteristics of flower and pollen grains observed under fluorescence microscopy of normal flower with fertile pollen as shown in B-line (A), male-sterile flower and non-viable pollen of BC2F2A1 × C1 (B), and male-sterile flower and non-viable pollen of BC2F2A1 × C3 (C). The red circle shows rudimentary pollen grains. Scale bars of pollen grains: 200 µm.
Figure 6. Morphological characteristics of flower and pollen grains observed under fluorescence microscopy of normal flower with fertile pollen as shown in B-line (A), male-sterile flower and non-viable pollen of BC2F2A1 × C1 (B), and male-sterile flower and non-viable pollen of BC2F2A1 × C3 (C). The red circle shows rudimentary pollen grains. Scale bars of pollen grains: 200 µm.
Horticulturae 09 00357 g006aHorticulturae 09 00357 g006b
Table
Table 1. Description of chili lines used in this study.
Table 1. Description of chili lines used in this study.
GroupCodeGenotypePhenotype
A-lineA1S rfrfSterile
B-lineB1N rfrfMaintainer (Fertile)
C-lineC1N RfRfRestorer (Fertile)
C3N RfRfRestorer (Fertile)
cross
BC2F2A1 × C1 --
BC2F2A1 × C3 --
BC1F2B1 × C1 --
BC1F2B1 × C3 --
Table
Table 2. List of markers in this study.
Table 2. List of markers in this study.
Marker Name5′ to 3′ SequenceAnnealing Temperature (°C)Product Size (bp)References
S or N cytoplasm
CMS-SCAR130/140F: TTACGGCTCGTTACCGCAGCG
R: CAATTGACCGACCCGCCAT		57130/140Ji et al. (2014) [21]
Rf locus
3336-last2-SCARF: CATCGAACTGATACGGAAGGAC
R: TAACACTACTTGGGGAAAGCG		521639Jo et al. (2016) [24]
4162-SCARF: GCAGTTCGGTTTTACGGAGTTAC
R: CCATTGGACAAAAGGGGATC		511046Jo et al. (2016) [24]
1.85-HRMF: GACATGCAAGGTAAGGCTGC
R: CACAAATTCTGGCTATCGGTC		52250Jo et al. (2016) [24]
Table
Table 3. The presence of DNA bands of BC2F2A1 × C1 and BC2F2A1 × C3 under 3336-last2- SCAR and 4162-SCAR markers with their identification of genotype and phenotype.
Table 3. The presence of DNA bands of BC2F2A1 × C1 and BC2F2A1 × C3 under 3336-last2- SCAR and 4162-SCAR markers with their identification of genotype and phenotype.
BC2F2Plant No.MarkersGenotypePhenotype
3336-last2-SCAR4162-SCAR
A1 × C11–2, 4–6, 9–13, 15–21, 23++S Rf_Fertile
A1 × C13, 7–8, 14, 22, 24−+S rfrfSterile
A1 × C31–8, 10–13, 15, 18–24++S Rf_Fertile
A1 × C39, 14, 16–17, −+S rfrfSterile
+: present DNA bands, −: absence (no bands) of DNA.
Table
Table 4. The presence of DNA bands of BC1F2B1 × C1 and BC1F2B1 × C3 under 3336-last2-SCAR and 4162-SCAR markers with their identification of genotype and phenotype.
Table 4. The presence of DNA bands of BC1F2B1 × C1 and BC1F2B1 × C3 under 3336-last2-SCAR and 4162-SCAR markers with their identification of genotype and phenotype.
BC1F2Plant No.MarkersGenotypePhenotype
3336-last2-SCAR4162-SCAR
B1 × C11–13, 15++N Rf_Fertile
B1 × C114−−N rfrfMaintainer
B1 × C31–9, 12–15++S Rf_Fertile
B1 × C310–11−−N rfrfMaintainer
+: presence DNA bands, −: absence (no bands) of DNA.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Na Jinda, A.; Nikornpun, M.; Jeeatid, N.; Thumdee, S.; Thippachote, K.; Pusadee, T.; Kumchai, J. Marker-Assisted Selection of Male-Sterile and Maintainer Line in Chili Improvement by Backcross Breeding. Horticulturae 2023, 9, 357. https://doi.org/10.3390/horticulturae9030357

AMA Style

Na Jinda A, Nikornpun M, Jeeatid N, Thumdee S, Thippachote K, Pusadee T, Kumchai J. Marker-Assisted Selection of Male-Sterile and Maintainer Line in Chili Improvement by Backcross Breeding. Horticulturae. 2023; 9(3):357. https://doi.org/10.3390/horticulturae9030357

Chicago/Turabian Style

Na Jinda, Aatjima, Maneechat Nikornpun, Nakarin Jeeatid, Siwaporn Thumdee, Kamon Thippachote, Tonapha Pusadee, and Jutamas Kumchai. 2023. "Marker-Assisted Selection of Male-Sterile and Maintainer Line in Chili Improvement by Backcross Breeding" Horticulturae 9, no. 3: 357. https://doi.org/10.3390/horticulturae9030357

APA Style

Na Jinda, A., Nikornpun, M., Jeeatid, N., Thumdee, S., Thippachote, K., Pusadee, T., & Kumchai, J. (2023). Marker-Assisted Selection of Male-Sterile and Maintainer Line in Chili Improvement by Backcross Breeding. Horticulturae, 9(3), 357. https://doi.org/10.3390/horticulturae9030357

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop