Next Article in Journal
Influence of Suboptimal Temperature on Flower Quality and Floral Organ Development in Spray-Type Cut Rose ‘Pink Shine’
Previous Article in Journal
Impact of Soil Biodisinfection Techniques in Horticultural Crops on Profitability within the Framework of the Circular Economy
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 9
Issue 8
10.3390/horticulturae9080860
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of 5-Aminolevulinic Acid (5-ALA) on Physicochemical Characteristics and Growth of Pomegranate (Punica granatum L.)

by
Sushuang Liu
1,†,
Yanmin Liu
1,†,
Hongtai He
1,
Ziyi Lin
1,
Jiong Sun
1,
Feixue Zhang
2,
Lili Zhou
2,
Zebo Wang
1,
Zaibao Zhang
1 and
Huasong Zou
1,*
1
School of Life Sciences and Health, Huzhou College, Huzhou 313000, China
2
Institute of Crop, Huzhou Academy of Agricultural Sciences, Huzhou 313000, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2023, 9(8), 860; https://doi.org/10.3390/horticulturae9080860
Submission received: 5 June 2023 / Revised: 25 July 2023 / Accepted: 25 July 2023 / Published: 27 July 2023
(This article belongs to the Section Developmental Physiology, Biochemistry, and Molecular Biology)
Browse Figures
Versions Notes

Abstract

:
The pomegranate is one of the most essential crop fruits in the world. 5-Aminolevulinic acid (ALA) regulates the growth and development of 5-year-old pomegranate. However, for plenty of pome crops, conventional information on the physio-chemical characteristics underlying 5-ALA is limited. Therefore, in this study, we applied four different concentrations of 5-ALA treatments (0 mg L−1, 10 mg L−1, 20 mg L−1, 50 mg L−1, and 100 mg L−1), where 0 mg L−1 was considered as a control group, to evaluate the effects of 5-ALA on the physiochemical characteristics of pomegranates. Our results showed that maximal photochemical efficiency (FV/FM), photosystem (ΦPSII), and photochemical quenching (qP) increased at concentrations of 50 mg L−1 and 100 mg L−1 compared with controls. Anthocyanin contents were elevated by 2.27% and 1.33% at the 5-ALA concentrations of 50 mg L−1 and 100 mg L−1. Furthermore, qRT-PCRs of the DEGs, such as punica granatum chalcone synthase (PgCHS), chalcone isomerase (PgCHI), flavanone 3-hydroxylase (PgF3H), dihydroflavonol 4-reductase (PgDFR), anthocyanidin synthase (PgANS), and ultrafine-grained (PgUFG), showed up-regulations, except for chalcone isomerase (PgCHI), after 5-ALA treatments. The fresh weight of the fruit and the weight of the grains were elevated under 50 mg L−1 and 100 mg L−1 concentrations, and both the fresh weight of the fruit and the grain weight were higher than controls. Total sugar (TS) increased by 8.49% and 24.99%, total soluble solids (TSS) increased by 2.02% and 6.07%, soluble proteins increased by 1.16% and 1.15%, and the pH level of juice increased by 0.12% and 0.19%, respectively. In addition, the contents of ascorbic acid, total phenols, and total flavonoids increased by 24.18%, 2.53%, and 1.29%, respectively, compared with controls. Taken together, the antioxidant activities of SOD and POD also increased by 13.33% and 11.95% at concentrations of 100 mg L−1. Our results show that concentrations of 5-ALA treatments at 50 mg L−1 and 100 mg L−1 will be beneficial for crop cultivation.

1. Introduction

5-Aminolevulinic acid (ALA), a natural δ-amino acid, is not involved in protein biosynthesis but instead acts as an essential biosynthetic precursor of all tetrapyrrole compounds such as chlorophylls and hemes, which are closely associated with plant photosynthesis and respiration. The pomegranate plant is an essential edible pome native to central Asian countries [1]. Normally, healthy pomegranate fruits have extreme nutritive and medical values that the pomegranate industry has profited from in the comprehensive consumer market in recent years [2,3,4,5]. Currently, due to the fastest growing production of pomegranate in the fruit industry, China has been considered the top- ranking country for pomegranate trade. According to the NBSC report, China’s pomegranate production during 2017–2018 was 120,000 and 1,700,000 tons [6]. Some studies have predicted that pomegranate might have emerged from Iran and Turkey based on the Mediterranean agriculture; however, fruit ripening is an intricate process that can be regulated by various factors, like light rhythms [7], temperature [8], nutrient elements [9], and plant hormones [10]. Recently, several methods in terms of improving pomegranate fruit quality in sandy soil involving semi-arid ecosystems have been reported, such as the foliar application of proline, tryptophan [11], zinc (Zn), boron (B) [12], potassium (K) [13], selenium (Se) [14], calcium (Ca), boron (B), gibberellic acid, and (GA3) [15]. Nevertheless, the investigations into horticultural practices that might be used to elevate the fruit quality of pomegranates cultivated in China are fairly limited.
5-Aminolevulinic acid (ALA) is a non-protein amino acid that is naturally present in all kinds of flora, faunas, fungi, and microorganisms [16]. In the last two decades, 5-ALA has incurred much awareness due to its great potential in the growth, maintenance, and developmental regulation of agricultural and horticultural crops [17]. The outstanding role of 5-ALA is that it helps in promoting photosynthetic activity in different crops [18], vegetables [19], and even in fruit trees [20,21,22]. It also improves fruit skin appearance and interior quality [23]. Some studies have suggested that exogenous applications of ALA are considered as a natural plant growth regulator (PGR) and can significantly increase fruit-ripening periods and pigmentation, as well as anthocyanin accumulation in apple (Malus domestica L.) [22,23,24,25], grape (Vitis vinifera L.) [26], peach (Prunus persica L.) [27,28], and litchi (Litchi chinensis Sonn.) [29]. In addition, 5-ALA may remarkably regulate fruit quality, including fruit mass, flavors, aroma, the content of vitamin C, and the activity of antioxidant and non-antioxidant enzymes [28,29,30]. Some researchers have suggested that treatments of 5-ALA are also effective during the maintenance of the post-harvesting level of fruit nutritional quality [31,32]. Nevertheless, remarkable doses of 5-ALA application can ameliorate fruit growth and fruit development. Therefore, whether 5-ALA could effectively improve the physiochemical and fruit quality of pomegranate remains unknown.
This study aimed to demonstrate the effects of ALA on pomegranates subjected to several concentrations of ALA treatments. Our current findings furnished valuable references to the suitable doses of this compound in pomegranates regarding growth and development.

2. Material and Methods

2.1. Plant Material via Experimental Closure

In this study, a 5-year-old pomegranate tree was cultivated in a garden that is situated in Huzhou, Zhejiang, China (N30.89, E120.09). The tissues (fruits) of the pomegranate tree were used in the present study. The growth of trees was managed according to traditional methods. The 75 uniform, well-grown trees were selected and divided into five experimental blocks and each experimental block comprised five trees. After 150 days of flowering, the foliar and fruit of selected trees were sprayed with different concentrations of 5-ALA solution, such as (0.01% Twenty-20 as the surfactant, pH 6.5) 0 mg L−1 (control meaning only normal water), 10 mg L−1, 20 mg L−1, 50 mg L−1, and 100 mg L−1, until exclusive foliage and fruit wetting at about 4 L/tree. After 30 days of treatment of 5-ALA solution, 8 fruits from the main branches of the plant and selected trees were randomly chosen for experimental procedures, and each block consisted of 8 fruits. After collection, the pomegranate fruits were directly brought to the laboratory. The selected parameters were checked. Pomegranate plant tissues, pericarp, and seed coats were separated at the harvesting stage and were kept in liquid nitrogen at -80 °C until analysis. Other parameters were evaluated by using fresh samples.

2.2. Determination of Physio-Chemical Parameters

In order to examine the effects of 5-ALA on chlorophyll content and the fluorescence parameter of pomegranate leaves, the 3rd and 4th mature leaves from the top of the plants were detected early at 9:00 a.m. after growing for two weeks. Chlorophyll contents were measured using a SPAD-502 chl-meter (Konica-Minolta, Tokyo, Japan). PAM-2500 (Waltz, Effeltrich, Germany) was used to assess the chlorophyll fluorescence parameters of PSII according to the protocol [33]. After sufficient dark adaptation, the leaves were exposed to a measuring light (<1 µmol (photon) m−2 s−1) and saturating light pulse (6000 µmol (photon) m−2 s−1) for 0.8 s to determine the minimum fluorescence (F0) and maximum fluorescence (FM). Then, a second saturating light pulse was imposed to record FM in the light-adapted state FM after real-time fluorescence reached a steady value under actinic light (619 μmol (photon) m−2 s−1) irradiation. On this basis, the actinic light was switched off and the minimum fluorescence parameter (F0′) was gained using infra-red light at (720–730 nm) for 4 s based on these original procedures as mentioned above; the relative parameters were analyzed according to Wang et al. (2018) [34].

2.3. Measurement of Anthocyanin Contents

To determine the anthocyanin content of pomegranate pericarp and seed coat, 0.5% of hydrochloric acid (HCl) was placed in a 5 mL methanol solution for 24 h at room temperature in the dark (Leong and Oey, 2012) [35]. After centrifugation of the extracts at 15,000× g for 15 min, the absorbance of the supernatant was measured at 530 and 700 nm, respectively. The content of anthocyanins was determined using pH differential method: when pH = 1.0, anthocyanins have characteristic absorption peaks at 530 nm, and when pH = 4.5, anthocyanins transform into colorless chalketone form without absorption peaks at 530 nm. This property can be used to determine the absorption values at 530 nm and 700 nm at different pH conditions, so as to quantitatively detect the content of plant anthocyanins. Furthermore, anthocyanin content was displayed in milligrams of cyanidin-3-galactoside equivalents per 100 g.

2.4. Determination of Fruits Physio-Morphological Properties of Fruits

For the measurements of physio-chemical properties, 30 fruits were selected from each treatment for physical-properties determination. Fruit weight (g) and weight of 100 grains (g) were measured. The fruit diameter (mm) and fruit length (mm) were recorded using the digital Vernier caliper (Mitutoyo, Kawasaki, Japan).

2.5. Determination of Physio-Chemical Fruit characteristics

2.5.1. Determinations of Total Sugars and Total Soluble Solids (TS and TSS) Contents

At the normal room temperature, pomegranate juice was extracted with the help of manual extraction for the measurements of total sugars and TSS contents. In addition, the total sugar contents of pomegranate juice were measured according to the process described by Zahedi et al. (2019) [14]. On the other hand, with slight modification, the fresh juice (0.5 g) was homogenized in a sterilizer centrifuge tube and diluted with 5 mL of deionized water. TS content was detected using anthrone-H2SO4 policy at 620 nm with a glucose standard curve. TS content was displayed in grams per 100 g of fresh weight (FW, g 100 g−1). Moreover, TSS was measured using a digital refractometer (A.PAL-1, Atago, Tokyo, Japan).

2.5.2. Measurement of Juice Titratable Acid Content (TAC), Soluble Protein Content (SPC), and pH

For the measurements of TAC in a pomegranate, juice was extracted and determined using a titration methodology according to Davarpanah et al. (2016) [12], and the results were expressed as percentages. SPC of pomegranate juice was extracted and determined using coomassie brilliant blue G250 staining at 595 nm [36]. The pH values of juice were assessed using a digital pH meter (BELL Analytical Instruments, Dalian, China).

2.5.3. Determinations of Ascorbic Acid

Ascorbic acid content was measured as described by Rajakumar and Rao (1993) [37]. The peel of the pomegranate containing fruit juice (0.3 g) was organized with 2 mL of 50 g L−1 trichloroacetic acid (TCA) in a test tube, and the homogenate was diluted at 100 mL with TCA. Seven milliliters of assay mixture contained TCA, 0.4% phosphoric acid-ethanol, 5 g L−1 o-phenanthroline, 0.2 mL ferric chloride, and the test take out was incubated for 60 min at 30 °C. Absorbance values were subjected at 534 nm. Our current results show milligrams per 100 g of fresh weight.

2.5.4. Measurement of Total Phenols and Flavonoid

Total phenols of pomegranate fruit were subjected according to Folin–Ciocalteu (FC) reagent methodology [12]. The 0.1 g juice was assorted with 1 mL distilled water and 1 mL of FC reagent mixture. After standing for 4 min, 2 mL of sodium carbonate solution (10%) was added to the asserter and the prepared samples were further incubated in a double boiler at 30 °C for around 60 min. The absorbance wavelength was measured at 765 nm. The gallic acid calibration curve was used to determine the phenolic content in the sample. The total flavonoid of fruit juice was determined according to the method described by Nie et al. [38]. Total flavonoid was asserted from 0.1 g juice using 2 mL 80% ethyl alcohol with ultrasonic vibration for 30 min at 20 °C and then centrifuged at 10,000× g for 15 min at 4 °C. Then, 1 mL of supernatant, 5 mL of deionized water, 0.3 mL NaNO2 (5%), and 0.5 mL 10% aqueous AlCl3 were completely assorted for at least 5 min; 1 mol L−1 of NaOH was added in a test tube. The assay reaction assertor was then incubated with the involvement of an ice bath for at least 15 min, and the absorbance value was subjected to around 500 nm. The total flavonoids of samples were displayed on a preliminary basis as mg.

2.6. Determinations of Antioxidant Enzymatic Activities

For the determinations of antioxidant enzymatic activities, the fresh juice samples (0.2 g) were homogenized with 2 mL of 50 mM phosphate buffer (pH 7.8). After that, the homogenate mixture was centrifuged at 15,000× g at 4 °C for around 20 min. Later, the supernatant mixture was used to evaluate super dioxide dismutase (SOD) (EC 1.15.1.1) and catalase (CAT) (EC 1.11.1.6) activities. Furthermore, the SOD activity was determined by assaying its inhibition role in the photochemical reduction of nitro blue tetrazolium (NBT) as described by Giannopolitis and Ries (1977) [39]. One SOD unit was explained as the amount of SOD required to inhibit 50% NBT photo-reduction of the blank test tube by monitoring at 560 nm. The CAT activity was determined by extinction of H2O2 at 240 nm for 180 s [40]. One unit of CAT activity was explained by the amount of enzyme that reduces the absorbance by 0.1 per min under the above conditions.

2.7. Extraction of RNA and qRT-PCR Validations

The total RNA of pomegranate from peel samples of (1 g) was extracted using cetyltrimethylammonium bromide (CTAB-LiCl) closure as presented by Jaakola et al. (2001) [41]. The first strand of cDNA synthesis was accomplished after the removal of genome DNA according to TransScript® One-Stpe gDNA elimination and cDNA Synthesis Supermix (Transgen Biotech, Beijing, China) according to the manufacturer’s instruction. The cDNA solution was diluted five times and was prepared as the template for qRT-PCR. The 20-μL reaction mixture consisted of a 10-μL SYBR qPCR Master Mix kit (Vazyme, Nanjing, China), 0.8-μL forward- and reverse-specific primer, 2-μL cDNA template, and 7.2-μL ddH2O. The qRT-PCR reaction was conducted in ABI 7300 Real-Time PCR system with the following amplification program: 95 °C for 2 min, tracked by 40 cycles at 94 °C for 5 s, 55 °C for 20 s, and 72 °C for 30 s. The relative expression levels of the tested genes were visualized according to Livak and Schmitten (2010) [42]. The primers used for qRT-PCR are listed in (Table 1). And, the PgActin gene was used as the reference gene [43,44].

2.8. Statistical Analysis

The current data presented in the figures were visualized based on SPSS software version 16.0 Statistics (SPSS Inc., Chicago, IL, USA), and all data were statistically analyzed using Analysis of Variance (ANOVA). The LSD (least significant difference) multiple comparison test, p ≤ 0.05, is used to indicate the significance difference between different treatments in lowercase letters. In addition, Origin 2019 was used to produce our experimental outcomes map.

3. Results

3.1. 5-ALA Ameliorates the Physiological Characteristics of Pomegranate

Our results demonstrate that chlorophyll content was significantly elevated by 7.78%, 8.62%, 8.32%, and 9.54% after the treatments of 5-ALA doses at 10 mg L−1, 20 mg L−1, 50 mg L−1, and 100 mg L−1, compared with the control (p < 0.05) (Figure 1A). Furthermore, the maximum quantum yield first slightly increased at 10 mg L−1 and was highly elevated at 20 mg L−1 and 50 mg L−1 of 5-ALA concentrations, and slightly decreased at 100 mg L−1, but FV/FM was higher when compared with controls (Figure 1B). In addition, ΦPSII was higher at 100 mg L−1 of 5-ALA concentrations and lower at 10 mg L−1, 20 mg L−1, and 50 mg L−1 but was higher when compared with controls (Figure 1C). The qP ratio was higher at 50 mg L−1 and 100 mg L−1; on the other hand, the qP ratio was lower at 10 mg L−1 and 20 mg L−1 but was but increased substantially compared with the controls (Figure 1D). However, the NPQ concentrations were totally decreased at different levels of 5-ALA treatments but were increased in controls (Figure 1E). Our results demonstrate that higher concentrations of 5-ALA treatments increase the physiological characteristics of pomegranates and that different parameters of pomegranates could change due to slight changes in 5-ALA concentrations. This may be due to fluctuations in the environment, with a decrease in the non-photochemical composition of chlorophyll at different doses of 5-ALA treatment, whilst showing the opposite trend in the control group.

3.2. 5-ALA Elevates Anthocyanin Content of Pomegranates

Fruit coloration status is positively correlated with anthocyanin contents. The anthocyanin content and anthocyanin content of juice at the fruit harvesting stage are shown in Figure 2. In Figure 2A, the anthocyanin contents are increased by 2.27% and 1.33% times at 50 mg L−1 and 100 mg L−1 5-ALA treatments (p < 0.05), respectively, compared with the control. Similarly, at the same concentrations of 50 mg L−1 and 100 mg L−1, the anthocyanin contents (Figure 2B, p < 0.05) are 1.20% and 0.27% times higher than the controls. Our findings justify that 5-ALA treatment at 50 mg L−1 and 100 mg L−1 may remarkably improve pomegranate fruiting peel and juice coloration.

3.3. Differentially Expression of Genes

qRT-PCR was used to elucidate the structural gene expression levels of anthocyanin contents. There were six numbers of genes (PgCHS, PgCHI, PgF3H, PgDFR, PgANS, and PgUFGT) that were selected for relative expression (Figure 3). Our results shows that 5-ALA treatments remarkably elevated the expression levels of the PgCHS gene when fruits were treated with 50 mg L−1 and 100 mg L−1 of 5-ALA, and the expression level was 9.59% and 5.44% times increased when compared with controls (Figure 3A). The relative expression level of the PgCHI gene treated with 5-ALA was significantly up-regulated at 3.80% and 13.38% times at 20 mg L−1 and 50 mg L−1 compared with the control, and the relative gene expression level peaked during the 20 mg L−1 of 5-ALA treatment (Figure 3B). The PgF3H gene relative expression levels at 50 mg L−1 and 100 mg L−1 of the 5-ALA treatments showed a remarkably higher relative expression when compared with controls (Figure 3C). The PgDFR relative gene expressions at 20 mg L−1, 50 mg L−1, and 100 mg L−1 of 5-ALA treatments were 3.64%, 12.72%, and 3.97% higher when compared with controls (Figure 3D). In general, the relative gene expressions of PgANS and PgUFGT (Figure 3E,F) were similar to those of PgF3H, PgDFR, and PgCHS. Hence, the relative gene expression findings suggest that the high expression levels of anthocyanin biosynthetic genes under 5-ALA treatments may be primarily responsible for the fruit color development of pomegranates.

3.4. 5-ALA Promotes Physio-Morphological Characteristics

The morphological parameters of pomegranates such as fresh weight (g), the weight of 100 grains (g), fruit diameter (mm), and fruit length (mm) were checked under 5-ALA treatments (Figure 4). Figure 4A shows that the fresh weight was increased by 4.74% and 6.16% under different concentration levels of 5-ALA compared with the controls. As shown in Figure 4B, the weight of 100 grains increased by 15.35% and 14.37% at different concentration levels of 5-ALA compared with controls. Figure 4C,D show that fruit diameter and fruit length were elevated only at concentrations of 50 mg L−1 5-ALA compared with controls. Our findings suggest that different concentrations of 5-ALA treatments, such as 50 mg L−1 and 100 mg L−1, are preferable to increase the contents of the morphological and physiological parameters of pomegranates.

3.5. 5-ALA Enhances Physio-Chemical Characteristics of Pomegranate

3.5.1. Determinations of Total Sugars (TS), TSS, TA, Soluble Protein Content, and pH Contents

The physio-chemical characteristics including total sugar, total soluble solids, titratable acids, soluble proteins, and the pH level of the juice were checked based on the different concentrations of 5-ALA treatments (Figure 5). Our results demonstrate that total sugar increased by 8.49% and 24.99% at concentrations of 50 mg L−1 and 100 mg L−1 compared with controls (Figure 5A). Figure 5B shows that total soluble solids increased by 2.02% and 6.07% at concentrations of 50 mg L−1 and 100 mg L−1 compared with controls. As shown in Figure 5C, titratable acid, increased by 23.08% at different concentrations of 5-ALA, suggesting that the cells were squeezed without showing activity, possibly due to environmental changes, hence lowering their activity of titratable acid. It can be seen from Figure 5D that soluble protein increased by 1.12%, 1.28%, 1.16%, and 1.15% at different concentrations compared with controls. Figure 5E shows that the pH level of juice increased by 0.12% and 0.19% at concentrations of 50 mg L−1 and 100 mg L−1 compared with controls. Therefore, our results indicate that various applications of 5-ALA treatments are preferable for the physio-chemical characteristics of plants.

3.5.2. Determinations of Antioxidant Characteristics of Pomegranate

The contents of ascorbic acid, total phenols, and total flavonoids were checked (Figure 6). Our results show that the content of ascorbic acid increased by 10.82%, 17.24%, 24.18%, and 20.31%, respectively, at concentrations of 10 mg L−1, 20 mg L−1, 50 mg L−1, and 100 mg L−1 compared with controls (Figure 6A). Figure 6B shows that total phenols were increased by 2.09% and 2.53% at concentrations of 50 mg L−1 and 100 mg L−1 compared with controls. As shown in Figure 6C, total flavonoids were increased by 1.29% and 1.19% at concentrations of 50 mg L−1 and 100 mg L−1 compared with controls. In addition, our findings show that different concentrations of 5-ALA treatments can ameliorate the antioxidant properties such as vitamin C, phenolic compounds, and flavonoids.

3.6. Determination of Antioxidant Enzymatic Activity

The superoxide dismutase (SOD) and catalase (CAT) activities in pomegranate fruits were determined at the different concentrations of 5-ALA treatments, as shown in (Figure 7). Figure 7A demonstrates that SOD activity was increased by 13.33% at concentrations of 100 mg L−1 compared with controls. The results of Figure 7B demonstrate that POD activity was elevated by 4.88% and 11.95% at concentrations of 50 mg L−1 and 100 mg L−1 compared with controls. All these results indicate that suitable concentrations of 5-ALA treatment are preferable to promote the antioxidant enzymatic activity of floral characteristic features.

4. Discussion

Pomegranate is a precious pome, and its productivity significantly depends on its cultivation conditions. The hormonal changes and environmental fluctuations are important components of plants’ physio-chemical parameters that play an essential role in growth and productivity. Some studies have suggested that photosynthetic activity are essential for plant growth under the 5-ALA treatments [45]. In addition, increasing the concentrations of 5-AlA as a precursor has the potential to increase the physio-chemical parameters of the plants and to some extent decrease the photosynthetic performance concerning non-photochemical characteristics [45]. Some studies have shown that several exogenous applications of plant growth regulators are widely applied in modern orchards to regulate fruit growth and increase fruit quality for commercial value [11,29,46]. 5-ALA treatment is an effective way to improve the morphology of the plants, the physical characteristics, fruit development, and maturation [24,25,26,27,28,29]. 5-ALA is an essential component for chlorophyll biosynthesis in nature [47]; furthermore, it is considered a developmental component for increasing the content of photosynthetic pigments in various plant species such as fig [48], strawberries [20], and peach [28]. The present study found that under different concentrations of 5-ALA treatments, growing pomegranates have shown remarkable results that positively demonstrates various physio-chemical characteristics such as chlorophyll content, yield, photosystem, and non-photochemical components.
A published study has suggested that applications of 5-ALA increase photosynthetic activities, such as maximum photochemical efficiency (FV/FM), the photochemical efficiency of the photosystem (ΦPSII), photochemical quench (qP), and nonphotochemical quench (NPQ) [49]. In the present study, the favorable results of 5-ALA treatments on the photosynthetic activities of pomegranate leaves were mainly calculated using several important fluorescence parameters, including FV/FM, ΦPSII, qP, and NPQ. These photosynthetic indexes demonstrate that 5-ALA may increase light quantum reactions, photon reaction centers, and actual photochemical reaction efficiency, and decrease the proportion of energy dissipation in PSII. Similarly, 5-ALA treatments may improve the accumulation of chlorophyll contents and the scheme of photosystem containing II and I in spirulina under non-stress conditions [50]. The current study found that 5-ALA enhances photosynthetic efficiency under favorable conditions. We also observed no clear effect of 5-ALA treatments at relatively low concentrations of (10 mg L−1 and 20 mg L−1). This may indicate that high concentrations of 5-ALA treatments are beneficial in improving photochemical efficiency in pomegranate leaves. Wang et al. (2004) reported that 300 mg L−1 ALA solution could enhance the coloration of apple fruits [51]. Therefore, we believe that the trend of higher concentrations of 5-ALA solutions can elevate the growth of horticultural plants.
Anthocyanins play an important part in pigmentation and help to prevent damage and maintain beautiful colors for plants. Fruit color appearance level is related to anthocyanin accumulation, which is a key factor influencing the market value of fruits that attracts consumers. 5-ALA treatment shows a substantial leading role in the metabolic regulation of fruit anthocyanin accumulation [24,25,26,27,28,29,32]. Our results confirm that exogenous applications of 5-ALA elevate anthocyanin biosynthesis in pomegranate pome.
The molecular mechanism of anthocyanin-related genes under 5-ALA treatments may regulate fruit appearance and color change in horticulture crops. The former survey revealed that a higher formulation of anthocyanin biosynthetic structural genes was the main factor, including CHS, DFR, ANS, and UFGT [24,25,27,28,52]. The CHS gene plays a pivotal role in the flavonoid biosynthetic pathway and was strongly induced by exogenous applications of 5-ALA treatments in apples [24,25,27] and peaches [28]. In addition, our results show that the PgCHS gene in pomegranate has a significant role in fruit expressional levels. Some studies have suggested that DFR, ANS, and UFGT genes annotated by the late biosynthetic anthocyanin accumulation biosynthesis may rapidly respond to 5-ALA stimulation in various crops, such as peach [27] and apple [24]. In the present study, the pomegranate fruit peel expression approaches of PgDFR, PgANS, and PgUFGT were positively increased under 5-ALA. Moreover, 5-ALA treatment also positively enhanced PgCHI and PgF3H gene expression levels (Figure 3B,C). The coloration effects of 5-ALA mainly enriched the anthocyanin accumulation biosynthesis of the fruit peel or pericarp without affecting the fruit flesh in various crops, such as apple, grape, and litchi [24,25,26,29] However, the seed coat of the pomegranate-related anthocyanin gene PgDFR was also significantly elevated under 5-ALA. Therefore, we speculate that several anthocyanin biosynthesis-related genes and enzymes might be responsible for various pigmentation and coloration in plants under the different concentrations of 5-ALA treatments. Further research is required for various genes concerning the anthocyanin-related metabolic activities of plants.
In horticultural study, evaluating the different parameters of the plant, such as fresh weight, grain weight, fruit diameter, and fruit length, is important. Our results show that fresh weight, grain weight, fruit diameter, and fruit length were significantly elevated under the given concentration of 5-ALA treatments. A previous study also recommended that 5-ALA treatments can amend various plants’ physio local parameters such as biomass in pepper (Capsicum annuum), kudzu (Pueraria phaseoloides) [23], and maize [53]. Similar effects have been observed during fruit development in many crops, including grapevine [26] and apple [54]. At the physiological level, there are interconnections between the different parameters of plants to achieve their respective functions. Furthermore, it allows the visualization mechanisms in pomegranates, such as photosynthesis, the cycling process of available nutrition, and evapotranspiration, as well as, ultimately, crops growth.
To date, TS, TSS, and soluble proteins play pivotal roles in pomegranate plants, such as photosynthesis, respiration, and transpiration processes. In the present study, our results show that total sugar, total soluble sugar, soluble proteins, and pH level were increased under 5-ALA treatments. A similar trend was also noticed in many fruit crops such as grapevine [26] and peach [28]. 5-ALA treatments may improve the soluble sugars and regulate the qualities of the pomegranate pome crop species. Ascorbic acid, total phenols, and total flavonoids are major biocatalysts and perform various biological functions such as hormone biosynthesis, defense mechanisms, seed development, fruit growth, and maturity and growth regulator transporters in pomegranate. Our results show that applications of 5-ALA treatment elevated the ascorbic acid, total phenols, and total flavonoids, which is similar with other fruit crops [28,54,55,56,57].
SOD and POD are functionally important for physiological defense schemes in plants coping with radicals and ROS subjected to biotic and abiotic stress. During plant growth and development, antioxidant metabolism and ROS-scavenging production are the major events of physiological and biochemical processes beneath stress conditions [23]. Our results show that SOD and POD content was significantly elevated under 5-ALA treatments, which is inconsistent with previous findings [28,54,55,56,57]. Therefore, we believe that the above results will provide positive and valuable recommendations for the improvement of physiological, biological, hormonal, and morphological changes in pomegranates and other horticultural crops.

5. Conclusions

To conclude, we discuss the effects of ALA concentrations on the physico-chemical characteristics of pomegranates. Our results show that concentrations of 5-ALA treatments at 50 mg L−1 and 100 mg L−1 will be beneficial for crop cultivation, which may provide convenient guidance in the theoretical approach.

Author Contributions

H.Z. designed the experimental layout; S.L. and Y.L. conducted all the relevant experiments; F.Z., L.Z., H.H., Z.L., J.S., Z.W., and Z.Z. analyzed the data; S.L. and Y.L. wrote the manuscripts. All authors have read and agreed to the published version of the manuscript.

Funding

This research was financially supported by Huzhou public welfare application research project (Grant No: 2021GZ26), Scientific Research Fund of Zhejiang Provincial Education Department (Grant No: Y202248468), National Training Programs of Innovation and Entrepreneurship for Undergraduates (Grant No: 202213287008; 202313287004; 202313287010).

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Morton, J.F.; Dowling, C.F. Fruits of Warm Climates; Florida Flair Books: Miami, FL, USA, 1987; pp. 352–355. [Google Scholar]
  2. Bourekoua, H.; Rózyło, R.; Gawlik-Dziki, U.; Benatallah, L.; Zidoune, M.N.; Dziki, D. Pomegranate seed powder as a functional component of gluten-free bread (Physical, sensorial and antioxidant evaluation). Int. J. Food Sci. Technol. 2018, 53, 1906–1913. [Google Scholar] [CrossRef]
  3. Shahamirian, M.; Eskandari, M.H.; Niakousari, M.; Esteghlal, S.; Gahruie, H.H.; Khaneghah, A.M. Incorporation of pomegranate rind powder extract and pomegranate juice into frozen burgers: Oxidative stability, sensorial and microbiological characteristics. J. Food Sci. Technol. 2019, 56, 1174–1183. [Google Scholar] [CrossRef] [PubMed]
  4. Asrey, R.; Kumar, K.; Sharma, R.R.; Meena, N.K. Fruit bagging and bag color affects physico-chemical, nutraceutical quality and consumer acceptability of pomegranate (Punica granatum L.) arils. J. Food Sci. Technol. 2020, 57, 1469–1476. [Google Scholar] [CrossRef]
  5. Turrini, F.; Boggia, R.; Donno, D.; Parodi, B.; Beccaro, G.; Baldassari, S.; Signorello, M.G.; Catena, S.; Alfei, S.; Zunin, P. From pomegranate marcs to a potential bioactive ingredient: A recycling proposal for pomegranate-squeezed marcs. Eur. Food Res. Technol. 2020, 246, 273–285. [Google Scholar] [CrossRef]
  6. National Bureau of Statistics of China (NBSC). 2018. Available online: http://www.stats.gov.cn (accessed on 5 December 2022).
  7. Smart, R.E.; Smith, S.M.; Winchester, R.V. Light Quality and Quantity Effects on Fruit Ripening for Cabernet Sauvignon. Am. J. Enol. Vitic. 1988, 39, 250–258. [Google Scholar] [CrossRef]
  8. Arakawa, O. Effect of temperature on anthocyanin accumulation in apple fruit as affected by cultivar, stage of fruit ripening and bagging. J. Hortic. Sci. 1991, 66, 763–768. [Google Scholar] [CrossRef]
  9. Martín, P.; Delgado, R.; González, M.R.; Gallegos, J.I. Colour of ‘Tempranillo’ Grapes as affected by different nitrogen and potassium fertilization rates. Acta Hortic. 2004, 652, 153–160. [Google Scholar] [CrossRef]
  10. Chervin, C.; El-Kereamy, A.; Roustan, J.-P.; Latché, A.; Lamon, J.; Bouzayen, M. Ethylene seems required for the berry development and ripening in grape, a non-climacteric fruit. Plant Sci. 2004, 167, 1301–1305. [Google Scholar] [CrossRef] [Green Version]
  11. Sayed, O.M.; El Gammal, O.H.M.; Salama, A.S.M. Effect of proline and tryptophan amino acids on yield and fruit quality of Manfalouty pomegranate variety. Sci. Hortic. 2014, 169, 1–5. [Google Scholar] [CrossRef]
  12. Davarpanah, S.; Tehranifar, A.; Davarynejad, G.; Abadía, J.; Khorasani, R. Effects of foliar applications of zinc and boron nano-fertilizers on pomegranate (Punica granatum cv. Ardestani) fruit yield and quality. Sci. Hortic. 2016, 210, 57–64. [Google Scholar] [CrossRef] [Green Version]
  13. Maity, A.; Sharma, J.; Pal, R.K. Novel potassium solubilizing bio-formulation improves nutrient availability, fruit yield and quality of pomegranate (Punica granatum L.) in semi-arid ecosystem. Sci. Hortic. 2019, 255, 14–20. [Google Scholar] [CrossRef]
  14. Zahedi, S.M.; Hosseini, M.S.; Meybodi, D.N.; Teixeira da Silva, J.A. Foliar application of selenium and nano-selenium affects pomegranate (Punica granatum cv. Malase Saveh) fruit yield and quality. S. Afr. J. Bot. 2019, 124, 350–358. [Google Scholar] [CrossRef]
  15. Hosein-Beigi, M.; Zarei, A.; Rostaminia, M.; Erfani-Moghadam, J. Positive effects of foliar application of Ca, B and GA3 on the qualitative and quantitative traits of pomegranate (Punica granatum L.) cv. ‘Malase-Torshe-Saveh’. Sci. Hortic. 2019, 254, 40–47. [Google Scholar] [CrossRef]
  16. Naeem, M.S.; Jin, Z.L.; Wan, G.L.; Liu, D.; Liu, H.B.; Yoneyama, K.; Zhou, W.J. 5-Aminolevulinic acid improves photosynthetic gas exchange capacity and ion uptake under salinity stress in oilseed rape (Brassica napus L.). Plant Soil 2010, 332, 405–415. [Google Scholar] [CrossRef]
  17. Wu, Y.; Liao, W.; Dawuda, M.M.; Hu, L.L.; Yu, J.H. 5-Aminolevulinic acid (ALA) biosynthetic and metabolic pathways and its role in higher plants: A review. Plant Growth Regul. 2019, 87, 357–374. [Google Scholar] [CrossRef] [Green Version]
  18. Xiong, J.L.; Wang, H.C.; Tan, X.Y.; Zhang, C.L.; Naeem, M.S. 5-aminolevulinic acid improves salt tolerance mediated by regulation of tetrapyrrole and proline metabolism in Brassica napus L. seedlings under NaCl stress. Plant Physiol. Biochem. 2018, 124, 88–99. [Google Scholar] [CrossRef]
  19. Wu, Y.; Jin, X.; Liao, W.; Hu, L.; Dawuda, M.M.; Zhao, X.; Tang, Z.; Gong, T.; Yu, J. 5-Aminolevulinic acid (ALA) alleviated salinity stress in cucumber seedlings by enhancing chlorophyll synthesis pathway. Front. Plant Sci. 2018, 9, 635. [Google Scholar] [CrossRef] [Green Version]
  20. Sun, Y.P.; Liu, J.; Cao, R.X.; Huang, Y.J.; Hall, A.M.; Guo, C.B.; Wang, L.J. Effects of 5-aminolevulinic acid treatment on photosynthesis of strawberry. Photosynthetica 2017, 55, 276–284. [Google Scholar] [CrossRef]
  21. Ye, J.B.; Chen, Q.W.; Tao, T.T.; Wang, G.; Xu, F. Promotive effects of 5-Aminolevulinic acid on growth, photosynthetic gas exchange, chlorophyll, and antioxidative enzymes under salinity stress in Prunnus persica (L.) Batseh Seedling. Emir. J. Food Agric. 2016, 28, 786. [Google Scholar] [CrossRef] [Green Version]
  22. Cai, C.; He, S.; An, Y.; Wang, L. Exogenous 5-aminolevulinic acid improves strawberry tolerance to osmotic stress and its possible mechanisms. Physiol. Plant. 2019, 168, 948–962. [Google Scholar] [CrossRef] [Green Version]
  23. Akram, N.A.; Ashraf, M. Regulation in plant stress tolerance by a potential plant growth regulator, 5-aminolevulinic acid. J. Plant Growth Regul. 2013, 32, 663–679. [Google Scholar] [CrossRef]
  24. Xie, L.; Wang, Z.H.; Cheng, X.H.; Gao, J.J.; Zhang, Z.P.; Wang, L.J. 5-Aminolevulinic acid promotes anthocyanin accumulation in Fuji apples. Plant Growth Regul. 2013, 69, 295–303. [Google Scholar] [CrossRef]
  25. Feng, X.X.; An, Y.Y.; Zheng, J.; Sun, M.; Wang, L.J. Proteomics and SSH analyses of ALA-promoted fruit coloration and evidence for the involvement of a MADS-box gene, MdMADS1. Front. Plant Sci. 2016, 7, 1615. [Google Scholar] [CrossRef] [Green Version]
  26. Watanabe, K.; Nishihara, E.; Watanabe, S.; Tanaka, T.; Takahashi, K.; Takeuchi, Y. Enhancement of growth and fruit maturity in 2-year-old grapevines cv. Delaware by 5-aminolevulinic acid. Plant Growth Regul. 2006, 49, 35–42. [Google Scholar] [CrossRef]
  27. Guo, L.; Cai, Z.X.; Zhang, B.B.; Xu, J.L.; Song, H.F.; Ma, R.J. The mechanism analysis of anthocyanin accumulation in peach accelerated by ALA. Acta Hortic. Sin. 2013, 40, 1043–1050. [Google Scholar]
  28. Ye, J.B.; Yang, X.H.; Chen, Q.W.; Xu, F.; Wang, G.Y. Promotive effects of 5-aminolevulinic acid on fruit quality and coloration of Prunus persica (L.) Batsch. Sci. Hortic. 2017, 217, 266–275. [Google Scholar] [CrossRef]
  29. Feng, S.; Li, M.F.; Wu, F.; Li, W.L.; Li, S.P. 5-Aminolevulinic acid affects fruit coloration, growth, and nutrition quality of Litchi chinensis Sonn. cv. Feizixiao in Hainan, tropical China. Sci. Hortic. 2015, 193, 188–194. [Google Scholar] [CrossRef]
  30. Al-Qurashi, A.D.; Awad, M.A. 5-Aminolevulinc acid increases tree yield and improves fruit quality of ‘Rabia’ and ‘Sukkariat-Yanbo’ date palm cultivars under hot arid climate. Sci. Hortic. 2011, 129, 441–448. [Google Scholar] [CrossRef]
  31. Li, Y.; Zhang, Z.Q.; Wang, L.J. Applications of 5-aminolevulinic acid on the physiological and biochemical characteristics of strawberry fruit during postharvest cold storage. Ciência Rural. 2016, 46, 2103–2109. [Google Scholar] [CrossRef] [Green Version]
  32. Li, M.; Feng, S.; Li, S.; Wu, F.; Wang, F.; Li, C.; Wang, L. Preharvest promotion or inhibition of colouration: Which is the more conducive to improving litchi postharvest quality? Sci. Hortic. 2019, 254, 124–132. [Google Scholar] [CrossRef]
  33. Genty, B.; Briantais, J.M.; Baker, N.R. The relationship between the quantum yield of photosynthetic electron transport and quenching of chlorophyll fluorescence. Biochim. Biophys. Acta 1989, 990, 87–92. [Google Scholar] [CrossRef]
  34. Wang, Z.B.; Wang, Y.F.; Zhao, J.J.; Ma, L.; Wang, Y.J.; Zhang, X.; Nie, Y.T.; Guo, Y.P.; Mei, L.X.; Zhao, Z.Y. Effects of GeO2 on chlorophyll fluorescence and antioxidant enzymes in apple leaves under strong light. Photosynthetica 2018, 56, 1081–1092. [Google Scholar] [CrossRef]
  35. Leong, S.Y.; Oey, I. Effects of processing on anthocyanins, carotenoids and vitamin C in summer fruits and vegetables. Food Chem. 2012, 133, 1577–1587. [Google Scholar] [CrossRef]
  36. Elfalleh, W.; Hannachi, H.; Guetat, A.; Tlili, N.; Guasmi, F.; Ferchichi, A.; Ying, M. Storage protein and amino acid contents of Tunisian and Chinese pomegranate (Punica granatum L.) cultivars. Genet. Resour. Crop. Evol. 2011, 59, 999–1014. [Google Scholar] [CrossRef]
  37. Rajakumar, D.V.; Rao, M.N. Dehydrozingerone and isoeugenol as inhibitors of lipid peroxidation and as free radical scavengers. Biochem. Pharmacol. 1993, 46, 2067–2072. [Google Scholar] [CrossRef] [PubMed]
  38. Nie, J.Y.; Lv, D.G.; Li, J.; Li, P.; Liu, F.Z. Condition optimization for spectrophotometric method of total flavonoids in apple fruit. J. Fruit Sci. 2010, 27, 466–470. (In Chinese) [Google Scholar]
  39. Giannopolitis, C.N.; Ries, S.K. Superoxide dismutases I. Occurrence in higher plants. Plant Physiol. 1977, 59, 309–314. [Google Scholar] [CrossRef]
  40. Díaz-Vivancos, P.; Clemente-Moreno, M.J.; Rubio, M.; Olmos, E.; García, J.A.; Martínez-Gómez, P.; Hernández, J.A. Alteration in the chloroplastic metabolism leads to ROS accumulation in pea plants in response to plum pox virus. J. Exp. Bot. 2008, 59, 2147–2160. [Google Scholar] [CrossRef]
  41. Jaakola, L.; Pirttilä, A.M.; Halonen, M.; Hohtola, A. Isolation of high quality RNA from bilberry (Vaccinium myrtillus L.) fruit. Mol. Biotechnol. 2001, 19, 201–203. [Google Scholar] [CrossRef]
  42. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-time Quantitative PCR and the 2−∆∆CT Method. Methods 2010, 25, 402–408. [Google Scholar] [CrossRef]
  43. Kaur, R.; Kapoor, N.; Aslam, L.; Mahajan, R. Molecular characterization of PgUFGT gene and R2R3-PgMYB transcription factor involved in flavonoid biosynthesis in four tissues of wild pomegranate (Punica granatum L.). J. Genet. 2019, 98, 94. [Google Scholar] [CrossRef] [PubMed]
  44. Kaur, R.; Aslam, L.; Kapoor, N.; Mahajan, R. Identification and comparative expression analysis of chalcone synthase, flavanone 3-hydroxylase and dihydroflavonol 4-reductase genes in wild pomegranate (Punica granatum L.) organs. Braz. J. Bot. 2020, 43, 883–896. [Google Scholar] [CrossRef]
  45. Wang, Y.; Chen, X.; Li, X.; Song, Y.; Wang, J.; Huang, J.; Xue, R. Exogenous application of 5-aminolevulinic acid alleviated damage to wheat chloroplast ultrastructure under drought stress by transcriptionally regulating genes correlated with photosynthesis and chlorophyll biosynthesis. Acta Physiol. Plant. 2022, 44, 1–12. [Google Scholar] [CrossRef]
  46. Buran, T.J.; Sandhu, A.K.; Azeredo, A.M.; Bent, A.H.; Williamson, J.G.; Gu, L. Effects of exogenous abscisic acid on fruit quality, antioxidant capacities, and phytochemical contents of southern high bush blueberries. Food Chem. 2012, 132, 1375–1381. [Google Scholar] [CrossRef] [PubMed]
  47. Youssef, T.; Awad, M.A. Mechanisms of enhancing photosynthetic gas exchange in date palm seedlings (Phoenix dactylifera L.) under salinity stress by a 5-Aminolevulinic acid-based fertilizer. J. Plant Growth Regul. 2008, 27, 1–9. [Google Scholar] [CrossRef]
  48. An, Y.; Qi, L.; Wang, L. ALA pretreatment improves waterlogging tolerance of fig plants. PLoS ONE 2016, 11, e0147202. [Google Scholar] [CrossRef] [PubMed]
  49. Killiny, N.; Hijaz, F.; Nehela, Y.; Hajeri, S.; Gowda, S. Effects of δ-aminolevulinic acid dehydratase silencing on the primary and secondary metabolisms of citrus. Plant Direct 2018, 2, e00072. [Google Scholar] [CrossRef] [Green Version]
  50. Sasaki, K.; Marquez, F.J.; Nishio, N.; Nagai, S. Promotive effects of 5-aminolevulinic acid on the growth and photosynthesis of Spirulina platensis. J. Ferment. Bioeng. 1995, 79, 453–457. [Google Scholar] [CrossRef]
  51. Wang, L.J.; Jiang, W.B.; Huang, B.J. Promotion of 5-aminolevulinic acid on photosynthesis of melon (Cucumis melo) seedlings under low light and chilling stress conditions. Physiol. Plant 2004, 121, 258–264. [Google Scholar] [CrossRef] [PubMed]
  52. Zheng, J.; Liu, L.B.; Tao, H.H.; An, Y.Y.; Wang, L.J. Transcriptomic profiling of apple calli with a focus on the key genes for ALA-induced anthocyanin accumulation. Front. Plant Sci. 2021, 12, 640606. [Google Scholar] [CrossRef]
  53. Habiba, U.; Ali, S.; Rizwan, M.; Hussain, M.B.; Hussain, A.; Alam, P.; Alqarawi, A.A.; Hashem, A.; AbdAllah, E.F. The Ameliorative role of 5-Aminolevulinic acid (ALA) under Cr stress in two maize cultivars showing differential sensitivity to Cr stress tolerance. J. Plant Growth Regul. 2019, 38, 788–798. [Google Scholar] [CrossRef]
  54. Zheng, J.; An, Y.Y.; Feng, X.X.; Wang, L.J. Rhizospheric application with 5-aminolevulinic acid improves coloration and quality in ‘Fuji’ apples. Sci. Hortic. 2017, 224, 74–83. [Google Scholar] [CrossRef]
  55. Xu, F.; Cheng, S.; Zhu, J.; Zhang, W.; Wang, Y. Effects of 5-Aminolevulinic acid on chlorophyll, photosynthesis, soluble sugar and flavonoids of Ginkgo biloba. Not. Bot. Horti Agrobot. Cluj-Napoca 2011, 39, 41–47. [Google Scholar] [CrossRef] [Green Version]
  56. Tavallali, V.; Jandoust, S.; Mehrjerdi, A.A. Foliar application of 5-aminolevulinic acid to promote bioactive potential and nutritional value of purslane, a vegetable for future. J. Appl. Bot. Food Qual. 2019, 92, 25–32. [Google Scholar] [CrossRef]
  57. Wang, J.; Zhang, J.; Li, J.; Dawuda, M.M.; Ali, B.; Wu, Y.; Yu, J.; Tang, Z.; Lyu, J.; Xiao, X.; et al. Exogenous application of 5-Aminolevulinic acid promotes coloration and improves the quality of tomato fruit by regulating carotenoid metabolism. Front. Plant Sci. 2021, 12, 683868. [Google Scholar] [CrossRef]
Horticulturae 09 00860 g001 550
Figure 1. Different applications of 5-ALA treatment on the physiological parameters of pomegranate leaves. (A) represents chlorophyll content, (B) represents quantum yield, (C) represents photosystem quantum, (D) represents photochemical quenching, and (E) represents non-photochemical components of chlorophyll. Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Figure 1. Different applications of 5-ALA treatment on the physiological parameters of pomegranate leaves. (A) represents chlorophyll content, (B) represents quantum yield, (C) represents photosystem quantum, (D) represents photochemical quenching, and (E) represents non-photochemical components of chlorophyll. Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Horticulturae 09 00860 g001
Horticulturae 09 00860 g002 550
Figure 2. Different applications of 5-ALA treatments on anthocyanin contents of pomegranate fruit peel. (A) represents anthocyanin contents contained in peel and (B) represents the anthocyanin contents of juice. Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Figure 2. Different applications of 5-ALA treatments on anthocyanin contents of pomegranate fruit peel. (A) represents anthocyanin contents contained in peel and (B) represents the anthocyanin contents of juice. Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Horticulturae 09 00860 g002
Horticulturae 09 00860 g003 550
Figure 3. Relative gene expression level based on qRT-PCR; different applications of 5-ALA treatments on fruit containing genes of pomegranate. (A–F) represents relative expression of genes (PgCHS, PgCHI, PgF3H, PgDFR, PgANS, and PgUFT). Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Figure 3. Relative gene expression level based on qRT-PCR; different applications of 5-ALA treatments on fruit containing genes of pomegranate. (A–F) represents relative expression of genes (PgCHS, PgCHI, PgF3H, PgDFR, PgANS, and PgUFT). Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Horticulturae 09 00860 g003
Horticulturae 09 00860 g004 550
Figure 4. Applications of 5-ALA treatments on the morphological parameters of pomegranate. (A) represents fresh weight (g), (B) represents the weight of 100 grains (g), (C) represents fruit diameter (mm), and (D) represents fruit length (mm). Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Figure 4. Applications of 5-ALA treatments on the morphological parameters of pomegranate. (A) represents fresh weight (g), (B) represents the weight of 100 grains (g), (C) represents fruit diameter (mm), and (D) represents fruit length (mm). Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Horticulturae 09 00860 g004
Horticulturae 09 00860 g005 550
Figure 5. Applications of 5-ALA treatments on the physio-chemical parameters of pomegranate. (A) represents total sugars, (B) represents total soluble solids, (C) represents titratable acid, (D) represents soluble proteins, and (E) represents the pH level of juice. Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Figure 5. Applications of 5-ALA treatments on the physio-chemical parameters of pomegranate. (A) represents total sugars, (B) represents total soluble solids, (C) represents titratable acid, (D) represents soluble proteins, and (E) represents the pH level of juice. Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Horticulturae 09 00860 g005
Horticulturae 09 00860 g006 550
Figure 6. Applications of 5-ALA treatments on the antioxidant characters of pomegranate. (A) represents ascorbic acid, (B) represents total phenols, and (C) represents total flavonoids. Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Figure 6. Applications of 5-ALA treatments on the antioxidant characters of pomegranate. (A) represents ascorbic acid, (B) represents total phenols, and (C) represents total flavonoids. Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Horticulturae 09 00860 g006
Horticulturae 09 00860 g007 550
Figure 7. Applications of 5-ALA treatments on the antioxidant enzymatic activity of pomegranate. (A) represents superoxide dismutase (SOD) and (B) represents catalase activity (CAT). Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Figure 7. Applications of 5-ALA treatments on the antioxidant enzymatic activity of pomegranate. (A) represents superoxide dismutase (SOD) and (B) represents catalase activity (CAT). Error bars demonstrate the standard error (SE) containing three biological replicates, and lowercase letters demonstrate significant differences at (p ≤ 0.05) values.
Horticulturae 09 00860 g007
Table
Table 1. The detailed primers used for qRT-PCR analysis are listed here.
Table 1. The detailed primers used for qRT-PCR analysis are listed here.
GeneAccession No.FP Sequence (5′-3′)RP Sequence (3′-5′)Sizes in (bp)
PgActinGU376750GATTCTGGTGATGGTGTGAGGACAATTTCCCGTTCAGCAG168
PgCHSKF841615CTGGGGCTGAAGGAGGAGAATCCGAACCCGAAGAGGACAC174
PgCHIKF841616TTCTGGAAATCCGTGGGCATCCGCTGGGCGATTGAGT127
PgF3HKF841617GCAACGGGAGGTTCAAGATGAGCGGGTACACTATGGC114
PgDFRKF841618GGCATCGCAAAGCTCCTATCCCTGCAACACTCCACA179
PgANSKF841619GAGGAAGGCAGGCTGGAGAATTAGGGCGCTGATGTCGGT136
PgUFGTKF841620GGCTTTCGTGACGCATTGTCCTTGGTTATGGCTCCC165
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, S.; Liu, Y.; He, H.; Lin, Z.; Sun, J.; Zhang, F.; Zhou, L.; Wang, Z.; Zhang, Z.; Zou, H. Effects of 5-Aminolevulinic Acid (5-ALA) on Physicochemical Characteristics and Growth of Pomegranate (Punica granatum L.). Horticulturae 2023, 9, 860. https://doi.org/10.3390/horticulturae9080860

AMA Style

Liu S, Liu Y, He H, Lin Z, Sun J, Zhang F, Zhou L, Wang Z, Zhang Z, Zou H. Effects of 5-Aminolevulinic Acid (5-ALA) on Physicochemical Characteristics and Growth of Pomegranate (Punica granatum L.). Horticulturae. 2023; 9(8):860. https://doi.org/10.3390/horticulturae9080860

Chicago/Turabian Style

Liu, Sushuang, Yanmin Liu, Hongtai He, Ziyi Lin, Jiong Sun, Feixue Zhang, Lili Zhou, Zebo Wang, Zaibao Zhang, and Huasong Zou. 2023. "Effects of 5-Aminolevulinic Acid (5-ALA) on Physicochemical Characteristics and Growth of Pomegranate (Punica granatum L.)" Horticulturae 9, no. 8: 860. https://doi.org/10.3390/horticulturae9080860

APA Style

Liu, S., Liu, Y., He, H., Lin, Z., Sun, J., Zhang, F., Zhou, L., Wang, Z., Zhang, Z., & Zou, H. (2023). Effects of 5-Aminolevulinic Acid (5-ALA) on Physicochemical Characteristics and Growth of Pomegranate (Punica granatum L.). Horticulturae, 9(8), 860. https://doi.org/10.3390/horticulturae9080860

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop