Dietary Chitosan Nanoparticles Enhance Growth, Antioxidant Defenses, Immunity, and Aeromonas veronii biovar sobria Resistance in Nile tilapia Oreochromis niloticus

Abstract

While chitosan is widely used in aquaculture feed, chitosan nanoparticles (CNPs) offer potential advantages due to their enhanced absorption. This study investigated the safe use of CNP levels in Nile tilapia feed, evaluating its impact on growth, immunity, and disease resistance. Five experimental diets were formulated and supplemented with zero chitosan (served as a control group), 1g/kg of chitosan (CS), and 1, 3, and 5 g/kg of CNPs. Each diet was randomly assigned to three replicate groups of 45 fish per group (15 fish/tank) with an average weight of (42.10 ± 0.05g, mean ± S.E.) twice daily (09:00 a.m. and 4:00 p.m.) to apparent satiation for two months. At the end of the feeding trial, fish fed 5 g/ kg of CNPs had the highest growth performance. However, no significant variations (p > 0.05) in somatic index were seen between the experimental groups. All chitosan and CNP-enriched groups exhibited improved intestinal morphology compared to the control group, characterized by increased villus length and width, reduced necrosis of intestinal tips, and better overall tissue integrity, with the CNP 3g and 5g groups demonstrating the most favorable intestinal structure. The CNP-treated groups (3, 5 g/kg) had significantly higher blood indices and serum globulin. Malondialdehyde (MDA) levels were lower in the CNP-treated groups compared to the chitosan macromolecule group. There was a substantial rise in glutathione (GSH), total antioxidant capacity (TAC), phagocytic index, and respiratory burst activity in the 5 g/kg CNP-treated group. The dietary addition of 5 g/kg of CNPs raised mRNA expression for TLR-2, MUC-2, and IGF-1, but there was no significant difference in HSP70 expression across treatments. After the experimental challenge with Aeromonas veronii biovar sobria, the groups that received 3 and 5 g/kg of CNPs exhibited the lowest mortality rates. Overall, the results suggest that including 5g/kg of CNPs in fish food is safe and effective for enhancing their health and growth, making it a promising addition to aquaculture feed.

1. Introduction

Aquaculture has emerged as a cornerstone of global food security, with Nile tilapia (Oreochromis niloticus) as a prominent and rapidly expanding species [1]. Its robust growth, adaptability, and consumer acceptance have driven its status as a major aquaculture commodity [2]. However, optimizing tilapia production requires a comprehensive understanding of factors influencing growth, health, and disease resistance [3].

Dietary supplementation has emerged as a promising strategy to enhance tilapia performance. Among various feed additives, chitosan, a natural biopolymer derived from chitin, has garnered considerable attention for its potential applications in aquaculture [4]. Possessing unique properties such as biocompatibility, biodegradability, and antimicrobial activity, chitosan has been explored as a feed additive to improve fish health and growth performance [5]. Several studies have investigated the effects of dietary chitosan supplementation on various aquatic species, reporting a range of outcomes depending on the concentration used and the species studied. Chen et al. [6] found that 4–7.5 g/kg of chitosan feed optimized growth and intestinal morphology in juvenile gibel carp (Carassius auratus gibelio). Similarly, Wu [7] found that 4 g/kg of chitosan significantly improved growth and physiological parameters in Nile tilapia (Oreochromis niloticus), while 8 g/kg negatively affected growth. Zaki et al. [8] observed improved growth and feed utilization in European sea bass (Dicentrarchus labrax) at 1–2 g/kg of chitosan diet but inhibited development at higher concentrations.

Chen and Chen [9] noted augmented growth and digestive enzyme activities in loaches (Misgurnus anguillicadatus) at 1–5 g/kg of chitosan feed, with diminishing effects at higher levels. Akbary and Younesi [10] reported peak growth performance in grey mullet (Mugil cephalus) at 10 g/kg of chitosan diet. Furthermore, Dawood et al. [11] reported higher catalase (CAT) and glutathione peroxidase (GSH-Px) activity with 1 g/kg of chitosan diet in mullet (Liza ramada). In addition, Harikrishnan et al. [12] revealed that dietary chitosan decreased the mortality of kelp groupers (Epinephelus bruneus) infected with Vibrio alginolyticus. Collectively, these studies show that aquatic species respond well to low to moderate levels of chitosan supplementation, while larger concentrations may have neutral or adverse effects. This emphasizes the significance of optimizing dose for individual species [7,10,13]. Recent interest has shifted towards the use of chitosan nanoparticles (CNPs) in aquaculture due to their enhanced bioavailability and potential for improved efficacy [14].

While CNPs have shown promise in promoting growth, immunity, and disease resistance in some studies, their effects can vary depending on factors such as particle size, concentration, electrokinetic potential (ζ-potential), and fish species. Moreover, the potential toxicity of CNPs remains a concern and requires careful evaluation. Further research is needed to establish safe and effective application rates correlated to the physicochemical characteristics of the particles.

Therefore, this study was performed to evaluate the effects of graded dietary chitosan nanoparticle concentrations (1, 3, 5 g/kg diet) on growth performance, intestinal morphometry, nonspecific immunity, antioxidant capacity, mRNA (TLR, MUC-2, IGF, and HSP70) expression levels, and resistance to Aeromonas veronii biovar sobria in Nile tilapia (Oreochromis niloticus). By comparing the responses of tilapia to varying levels of CNPs, we aimed to determine the optimal concentration for maximizing benefits while minimizing potential risks.

2. Materials and Methods

2.1. Ethical Statement

Our present study followed the ethical guidelines of the Faculty of Veterinary Medicine, Cairo University Experimental Animal Ethics Committee, and the experimental protocol was approved with the number Vet CU 08072023712.

2.2. Synthesis of Chitosan Nanoparticles Using the Ionic Gelation Method

Chitosan nanoparticles were prepared according to Hossam-Elden et al. [3]. Chitosan solution was obtained by dissolving chitosan (Sigma-Aldrich, St. Louis, MO, USA) (0.5%, w/v) in a 1% (w/v) glacial acetic acid solution and magnetically stirring for 30 min at room temperature to dissolve fully. Sodium tripolyphosphate (TPP) solution (0.25%, w/v) (Sigma-Aldrich St. Louis, MO, USA) was added dropwise to the chitosan solution at a ratio of 1:3 while stirring for 30 min to allow ionic cross-linking and prepare CNPs. After magnetic stirring, the CNP suspension was centrifuged at 10,000× g for 20 min, washed three times for purification, collected with further centrifugation, and lyophilized to be easily stored and used.

The prepared nanoparticles were characterized using infrared spectroscopy (IR) to identify the structure elucidation and functional groups of CNPs by using Bruker VERTEX 80 (Karlsruhe, Germany) combined Platinum Diamond ATR recording infrared spectra in the range 4000–400 cm⁻¹ with a refractive index of 2.4 and a resolution of 4 cm⁻¹. Transmission electron microscopy (TEM) was used to evaluate the average diameter and for morphological examination using HR-TEM (JEOL, JEM-2100, Tokyo, Japan), operated at 200 KV. Dynamic light scattering was used to estimate surface charge, particle size, and zeta potential, which controls the stability of the prepared suspension.

2.3. Fish and Experimental Diets

A total of 225 healthy O. niloticus weighing 42.10 ± 0.05 g were purchased from a private fish farm in Kafr El Sheikh Governorate, Egypt. They were kept in 15 tanks of 100L supplemented with aerated de-chlorinated tap water at 23–25 °C. After acclimatization for two weeks, fish were divided into five groups (45 fish/group with three replicates). The study employed a static tank-based aquaculture system. Each tank was equipped with an air generator and heater, and 10% of the water changed daily using pre-warmed, aerated water. This setup allowed precise control of water quality parameters throughout the duration of the experiment with average values including a temperature of 23.2 ± 0.33 °C, a pH of 6.8 ± 0.13, dissolved oxygen at 7.4 ± 0.2 mg/L, and total ammonia-nitrogen: 0.05 ± 0.1 mg/L. G1 was served as the control group and fed a basal diet. Groups (2–5) were nourished on a diet supplemented with chitosan and chitosan nanoparticles for two months, at a concentration of chitosan 1g/kg diet (G2) and chitosan nanoparticle diets at concentrations of 1, 3, and 5 g/kg (G3, G4, and G5, respectively). Fish groups were fed to satiation twice daily (8:00 and 4:00).

The experimental diets were formulated to contain 30% crude protein, 8.37% lipid, and 4100 Kcal/Kg total energy (Table S1). The base diet pellets were manufactured according to this formulation. Subsequently, the pellets were coated with a 1% gelatin solution. For the treatment groups, chitosan or chitosan nanoparticles were incorporated into the gelatin coating at the specified concentrations before application to the pellets. The control group pellets were coated with the gelatin solution without additives [15].

2.4. Growth Performance and Feed Utilization

Two months after the start of the feeding trial, fish in each experimental group were weighted on an individual basis for the calculation of growth indices according to Abu-Elala et al. [16] and Jang et al. [17], as follows:

• Weight gain (WG) (g) = W₂ (g) − W₁ (g), where W₂ is the final weight and W₁ is the initial weight of the fish.
• Specific growth rate (SGR) (%/day) = 100 (Ln W₂ − Ln W₁)/T, where Ln is the natural logarithm and T is the experimental period (day).
• Feed intake (FI) = total amount of feed consumed during the experiment/the number of fish
• Feed conversion ratio (FCR) = FI, g/WG, g
• Condition factor (CF) = 100 × fish weight/(total fish length)³
• Spleen somatic index (SSI) = 100 (spleen weight/body weight)
• Hepatosomatic index (HSI) = 100 (liver weight/body weight)
• Viscerosomatic index (VSI) = 100 (visceral weight/body weight)

2.5. Assessment of the Intestinal Morphometry

Following the two-month feeding trial, proximal intestinal segments (about one cm in length) were removed from each group and preserved in 10% neutral buffered formalin. After being dehydrated by submerging in ascending concentrations of ethyl alcohol (70–100%) to eliminate formalin and water, the specimens were cleaned using xylene to eliminate alcohol and allow for infiltration. Then they were embedded in paraffin wax. Using a rotary microtome (Leica^®, Wetzlar, Germany), the specimen was sectioned at a thickness of 5 µm. Hematoxylin and eosin (H&E) stains were used to investigate histological traits. Using a Ceti England microscope with a connected AmScope digital camera, slides were examined for intestinal histological appraisals and photographed for intestinal morphometric analysis. To perform morphometric analysis, 20 photos of each fish at 40× were needed, using the AmScope Toup View 3.7 program (AmScope, Irvine, CA, USA) for determination of the average intestinal villus length (AIVL), villus width (AIVW), and villus depth (AIVD) [18].

2.6. Haemato-Biochemical Tests

At the end of the experimental period, five fish from each replicate were randomly sampled and anesthetized using MS-222 10 mg/L (Sigma-Aldrich, St. Louis, MO, USA) for blood collection from caudal vessels. The heparinized blood samples were used for the determination of erythrocytes, leukocyte count [19], hemoglobin concentration, PCV [20], blood indices mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC); however, non-heparinized blood samples were clotted and centrifuged at 3000 rpm for 15 min at 4 °C to separate serum for the determination of serum transaminases ALT and AST [21], total protein, albumin, globulin, creatinine [22], and blood urea nitrogen [23].

2.7. Cellular Innate Immunological Parameters

2.7.1. Phagocytic Activity/Index

Five sodium-heparinized 3 mL blood samples/replicate were collected from caudal vessels and carefully overlaid onto an equal volume of a histo-paque medium (1.077 g/mL, Sigma-Aldrich chemical, St. Louis, MO, USA). After centrifugation at 1500× g for 20 min at 4 °C, viable leucocytes were collected from the interface layer with a Pasteur pipette, washed three times with RPMI-1640 supplemented with inactivated tilapia serum, 1 mg/mL of streptomycin, and 100 IU/mL of penicillin, and evaluated by the trypan blue exclusion method to detect the number of viable cells. The leukocytes (1 mL) adjusted to 10⁷ cells/mL using culture medium were incubated with Saccharomyces cerevisiae (1 mL) adjusted to 10⁶ cells/mL for 1 h at 37 °C. The mixture (10 µL) was smeared on a clean glass slide, fixed with methanol for 10 min, air dried, then stained with Giemsa stain, and observed under an oil immersion lens. The percentage of phagocytic cells and the phagocytic index were calculated using the following equations [24]:

$$\mathrm{The} \mathrm{percent} \mathrm{of} \mathrm{phagocytic} \mathrm{cells}= {\displaystyle \frac{The number of ingesting phagocytes}{Total number of phagocytes}}$$

$$\mathrm{The} \mathrm{phagocytic} \mathrm{index}=\frac{The number of ingested yeast }{Numbers of ingesting phagocytes}$$

2.7.2. Oxygen Radicals (NBT Reduction Activity)

To measure NBT, 100 µL of blood suspension (1 × 10⁷ cells) was incubated in a 96-well plate at 25 °C for 120 min to permit cell attachment. The plate was washed with RPMI 1640 medium (1875085, Thermofisher Scientific, Vilnius, Lithuania) supplemented with 3% tilapia serum three times to remove unattached cells. (100 μL/well) of a mixture of nitroblue tetrazolium dye (NBT; 34035, Thermofisher Scientific, Vilnius, Lithuania) and phorbol 12-myristate 13-acetate (PMA, Sigma Aldrich; 1 mg/mL) was added to the plate and incubated for 60 min at 25 °C. After incubation, the supernatants were discarded, and absolute ethanol was added for fixation for 10 min, then washed with 70% methanol and allowed to air dry. The reduced NBT formazan crystals were dissolved using dimethyl sulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO, USA), and the optical density (OD) was measured with the ELISA reader at an absorbance of 630 nm [25].

2.8. Oxidant and Antioxidant Biomarkers

At the termination of the feeding trial, oxidative stress markers, including total antioxidant capacity (TAC), malondialdehyde (MDA), and reduced glutathione (GSH), were determined. Total antioxidant capacity (TAC) was measured calorimetrically in serum according to Koracevic et al. [26], using a commercial kit (Biodiagnostic Company, Giza, Egypt). This method is based on the interaction of the antioxidants in the serum sample with a known quantity of exogenous H₂O₂, and the remaining H₂O₂ reacts with 3,5-dichloro-2-hydroxybenzene sulphonate. This reaction resulted in a red complex that had an inverse relationship with the antioxidant capacity of the sample. To determine TAC (mM/L), the absorbance at 505 nm was measured against the blank and multiplied by 3.33.

Malondialdehyde (MDA) levels and glutathione (GSH) activity were measured in the intestine. At the end of the experimental period, five fish from each replicate were randomly sampled and anesthetized using MS-222 (10 mg/L; Sigma-Aldrich, St. Louis, MO, USA). Following anesthesia, the intestines were carefully dissected. The samples were homogenized using an electric tissue homogenizer (DAIHAN Scientific Co., Ltd., Wonju-si, Republic of Korea) in 5 mL of cold buffer (50 mM potassium phosphate, pH 7.5) for MDA, and (50 mM potassium phosphate, pH 7.5, 1 mM EDTA) for GSH per gram of tissue. Subsequently, the homogenates were centrifuged at 1800 × g for 15 min. According to Beutler et al. [27] and Ohkawa et al. [28], the supernatants were collected and used to measure the MDA levels and GSH activity, respectively, using commercial kits (Biodiagnostic Company, Giza, Egypt).

2.9. Quantitative Real-Time PCR Analysis of Growth, Immune, and Stress-Related Genes in the Fish

Tissue samples (intestine and liver) were taken from the fish (3 fish/each group) after the end of the feeding trial (60 days) and stored at −80 °C for gene expression analysis. The expression levels of some immune-nutritive-related (IGF-1, MUC-2, TLR-2) and stress-related (HSP70) genes were measured in the intestine and liver using quantitative real-time PCR (qRT-PCR). Total RNA from 100mg of liver and intestine tissue samples was extracted using the QIAmp RNA mini kit (QIAGEN, Hilden, Germany) as indicated by the manufacturer. Total RNA purity and concentration were obtained using a nanodrop ND-1000 spectrophotometer. The isolated RNA was used for cDNA synthesis using reverse transcriptase (RevertAid RT (200 U/μL) (Thermo Scientific, Cat. No. EP0441, Waltham, MA, USA). qRT-PCR was performed in a total volume of 20 μL using a mixture of 1 μL cDNA, 0.5 mM of each primer (

Table 1. Primer sequences of growth, immune, and stress-related genes of Oreochromis niloticus for RT-qPCR amplification.

Target Gene	Forward and Reverse Primer Sequence (5′ to 3′)	Accession Number	Reference
β-actin (reference gene)	F: 5′-GCTGTACATGCACTCCAAGG-3′ R: 5′-CAGGTCCAGACGCAGGAT-3′	KJ126772.1	[30]
TLR-2	F: 5′-CCCACAATGGATTCACCAG-3′ R: 5′-AAAGATCAAGACTCAAGGCACTG -3′	JQ809459.1	[31]
MUC-2	F:5′-CAACTGTTTTTGAGACAACTTCAGA-3′ R:5′-CTGAAGTGACCGTGGAAGG-3′	XM_005466350	[32]
IGF-1	F:5′- CATCGTGGACGAGTGCTG-3′ R:5′- ACAGGTGCACAGTACATCTCAAG-3′	EU272149	[33]
HSP70	F: AAAGGTGTAGCGATCGGCAT R: CCACATAACTGGGGGTGGTC	XM_003442456.5	[34]

TLR-2: toll-like receptor; MUC-2: mucin 2; IGF-1: insulin growth factor 1; HSP70, heat shock protein 70.

), and iQ SYBR Green Premix (Bio-Rad 170-880, Hercules, CA, USA). PCR amplification and analysis were achieved using the Bio-Rad iCycler thermal cycler and the MyiQ real-time PCR detection system. The qPCR reactions were performed under the following conditions: an initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s, annealing at the optimal temperature for each primer pair (β-actin: 60 °C, TLR-2: 58 °C, MUC-2: 56 °C, IGF-1: 60 °C, HSP70: 59 °C) for 30 s, and extension at 72 °C for 30 s. Each assay includes triplicate samples for each tested cDNA and a no-template negative control; the expression relative to the control is calculated using the equation 2^−ΔΔCT [29].

2.10. Challenge Test

At the end of the experimental period (60 days), fish groups (15 fish/group) were challenged with A. veronii biovar sobria (Accession no. MW831507) to assess fish resistance against infection. A. sobria was cultivated in tryptic soya agar (TSA, Himedia, India), incubated at 30 °C for 24–48 h for growth, and suspended in sterile phosphate-buffered saline (PBS). The lethal dose (LD₅₀) of A. sobria was 3.2 × 10⁷ CFU/mL, according to Ibrahim et al. [35]. A sub-lethal dose of A. sobria, 1.5 × 10⁷ CFU/mL, was used in the challenge test. The fish groups were intraperitoneally injected with 0.1 mL of 1.5 × 10⁷ CFU/mL of pathogenic A. sobria and observed for 7 days to record any pathological signs or symptoms.

2.11. Histopathological Analysis

The intestine and liver were taken from the fish (3 fish/each group) after the end of the feeding trial (2 months) for histopathological examination. The tissue samples were rinsed in 10% buffered formalin for 24 h and then dehydrated in ascending grades of alcohol for 30 min. The tissues were mounted in xylene until they became clear and then embedded in paraffin. The paraffin blocks were sliced into microtomes at 4–6 µm thick. The tissue morphological analysis was done using the Hematoxylin-Eosin staining method [36]. The slides with stained samples were mounted with D.P.X. and examined with a microscope (Motic AE 21, Xiamen, China). Photographs were taken using the Moticam 1000 camera.

2.12. Statistics Analysis

Using the SPSS software version 20 (SPSS, Richmond, VA, USA), a one-way ANOVA was used to analyze the collected data to determine the impact of dietary CS and CNP supplementation. The normality of the data and the homogeneity of variance were assessed using a Shapiro-Wallis test and a Levene test, respectively. Least significant difference (LSD) multiple range tests were utilized to assess the significance of differences between the experimental groups, which considered significant differences at p < 0.05.

3. Results

3.1. Characterization of CNPs

The particle size characterization of chitosan nanoparticles was measured by transmission electron microscopy (TEM) and dynamic laser scattering (DLS) (Figure 1). TEM images revealed spherical-shaped particles with sizes in the range of 70–90 nm. DLS was used to measure the average diameter of 263.1 nm with a zeta potential of +39.70 mV (Figure 1).

3.2. Growth Indices and Morphometry

Feed intake and growth indices of Nile tilapia after 60 days of growth trials are illustrated in

Table 2. Growth performance, biological parameters, and intestinal morphometric of Nile tilapia submitted to different experimental diets in comparison to the basal diet.

Parameters	C	CS (1 g/kg Diet)	CNPs (1 g/kg Diet)	CNPs (3 g/kg Diet)	CNPs (5 g/kg Diet)	p-Value
IW (g)	42.10 ± 0.05	42.05 ± 0.03	42.19 ± 0.02	42.14 ± 0.07	42.11 ± 0.06	0.395
FW (g)	70.67 ± 0.88 d	77.42 ± 0.07 c	78.61 ± 0.12 bc	79.80 ± 0.11 b	82.39 ± 0.10 a	0.000
WG (g)	28.57 ± 0.88 d	35.37 ± 0.06 c	36.42 ± 0.10 bc	37.65 ± 0.13 b	40.29 ± 0.05 a	0.000
SGR (%/day)	0.86 ± 0.02 d	1.02 ± 0.00 c	1.04 ± 0.00 bc	1.06 ± 0.00 b	1.12 ± 0.00 a	0.000
FI (g/fish)	62.79 ± 1.56 c	74.71 ± 0.54 b	76.17 ± 1.23 b	73.51 ± 0.75 b	69.19 ± 1.00 a	0.000
FCR	2.20 ± 0.02 a	2.11 ± 0.01 b	2.09 ± 0.03 b	1.95 ± 0.03 c	1.72 ± 0.03 d	0.000
CF (%)	1.61 ± 0.02 c	1.69 ± 0.06 bc	1.72 ± 0.01 ab	1.73 ± 0.02 ab	1.79 ± 0.02 a	0.020
HSI (%)	4.15 ± 0.26	3.88 ± 0.77	4.63 ± 0.27	4.18 ± 0.12	3.96 ± 0.44	0.769
SSI (%)	0.15 ± 0.04	0.12 ± 0.04	0.14 ± 0.02	0.13 ± 0.05	0.14 ± 0.02	0.974
VSI (%)	7.16 ± 0.55	7.23 ± 0.88	7.78 ± 0.41	6.93 ± 0.12	7.06 ± 0.74	0.874
AIVL (µm)	349.67 ± 1.76 c	393.07 ± 2.07 b	431.42 ± 2.49 a	437.33 ± 2.40 a	433.33 ± 3.38 a	0.000
AIVW (µm)	96.33 ± 2.02 c	115.37 ± 2.57 b	121.67 ± 2.33 ab	124.67 ± 2.40 a	125.48 ± 1.06 a	0.000
AIVD (µm)	60.05 ± 2.12 c	64.88 ± 2.19 bc	70.09 ± 2.56 ab	72.33 ± 2.96 ab	73.33 ± 3.28 a	0.026

IW: initial weight; FW: final weight; WG: weight gain; SGR: specific growth rate; FI: feed intake; FCR: feed conversion ratio; CF: condition factor; HIS: hepatosomatic index; SSI: spleen somatic index; VSI: viscerosomatic index; AIVL: average intestinal villous length; AIVW: average intestinal villous width; AIVD: average intestinal villous depth. The mean ± SD is used to express all the data. A row’s mean values with distinct superscript letters indicate significantly different data (p ≤ 0.05).

. At the end of the feeding trial, fish fed with 5 g/kg of chitosan nanoparticles displayed higher weight gain (WG), specific growth rate (SGR), and condition factor (CF) than other groups. However, no significant differences (p > 0.05) were observed in the somatic index between the experimental groups. As shown in Table 2, the average intestinal villous length (AIVL), average intestinal villous width (AIVW), and average intestinal villous depth (AIVD) in the intestine of Nile tilapia were significantly (p ≤ 0.05) greater in all chitosan and chitosan nanoparticle-enriched groups compared to the control group, with the highest increase observed in the CNP groups 3 and 5.

3.3. Hematological and Biochemical Analysis

The CNPs-treated group (3, 5 g/kg) showed a significant enhancement in leukocyte count, erythrocyte count, hemoglobin concentration, hematocrit value, and blood indices, including the mean corpuscular volume MCV, total protein, and globulin level (

Table 3. Hematological and biochemical blood characteristics of Nile tilapia supplemented with experimental and control diets.

Parameters	C	CS (1 g/kg Diet)	CNPs (1 g/kg Diet)	CNPs (3 g/kg Diet)	CNPs (5 g/kg Diet)	p-Value
RBCs count	2.62 ± 0.06 b	2.79 ± 0.05 b	2.87 ± 0.11 ab	3.11 ± 0.12 a	3.15 ± 0.11 a	0.013
WBCs count	83.00 ± 1.73 c	86.33 ± 1.45 c	108.33 ± 1.45 b	116.67 ± 2.03 a	119.00 ± 1.15 a	0.000
PCV	39.00 ± 1.15 b	40.67 ± 0.88 b	42.33 ± 1.45 ab	45.67 ± 1.45 a	44.67 ± 1.20 a	0.019
HB	6.25 ± 0.12 c	6.61 ± 0.12 bc	6.76 ± 0.22 b	7.28 ± 0.10 a	7.44 ± 0.16 a	0.001
MCV	149.10 ± 1.39 a	145.92 ± 0.97 ab	147.71 ± 0.83 ab	147.16 ± 3.49 ab	142.07 ± 1.49 b	0.049
MCH	23.90 ± 0.09	23.72 ± 0.13	23.61 ± 0.27	23.48 ± 0.60	23.66 ± 0.32	0.927
MCHC	16.03 ± 0.18	16.26 ± 0.19	15.98 ± 0.22	15.96 ± 0.34	16.66 ± 0.18	0.240
ALT (U/L)	3.02 ± 0.16	3.39 ± 0.28	3.32 ± 0.24	2.92 ± 0.28	3.09 ± 0.09	0.563
AST (U/L)	25.43 ± 2.25	22.94 ± 1.65	21.20 ± 0.58	22.20 ± 2.08	25.87 ± 1.45	0.295
BUN (mg/dL)	3.41 ± 0.24	2.89 ± 0.35	3.07 ± 0.39	3.49 ± 0.22	3.56 ± 0.16	0.447
Creatinine(mg/dL)	0.38 ± 0.04	0.34 ± 0.01	0.33 ± 0.02	0.37 ± 0.01	0.34 ± 0.02	0.536
Total protein (g/dL)	3.21 ± 0.05 c	3.59 ± 0.08 b	3.92 ± 0.05 a	3.97 ± 0.10 a	3.80 ± 0.05 ab	0.000
Albumin (g/dL)	1.66 ± 0.03 d	1.90 ± 0.04 c	2.04 ± 0.04 ab	2.07 ± 0.06 a	1.93 ± 0.03 bc	0.000
Globulin	1.55 ± 0.02 c	1.69 ± 0.04 b	1.88 ± 0.02 a	1.89 ± 0.04 a	1.87 ± 0.03 a	0.000
A/G	1.10 ± 0.00 a	1.10 ± 0.00 a	1.07 ± 0.03 ab	1.10 ± 0.00 a	1.03 ± 0.03 b	0.000

RBCs: red blood cells; WBCs: white blood cells; PCV: packed cell volume; Hb: hemoglobin; MCV: mean corpuscular volume; MCH: mean corpuscular hemoglobin; MCHC: mean corpuscular hemoglobin concentration. ALT: alanine aminotransferase; AST: aspartate aminotransferase; BUN: blood urea nitrogen; A/G: albumin/globulin ratio. A significant difference (p ≤ 0.05) between experimental groups is indicated by different letters.

), with no significant difference in mean corpuscular hemoglobin MCH, mean corpuscular hemoglobin concentration MCHC, or liver and kidney function tests, compared to the chitosan macromolecule and control groups.

3.4. Antioxidant Biomarkers and Lipid Peroxidation Measurements

The antioxidant parameters were significantly (p < 0.05) enhanced by dietary chitosan nanoparticles. The intestinal GSH and serum TAC values improved significantly in the CNP-supplemented group in a dose-dependent manner. On the contrary, the intestinal MDA value significantly (p ≤ 0.05) decreased in the fish group fed with 5 g CNPs/kg diets compared to the control group (Figure 2).

3.5. Immunological Assay

As shown in Figure 3, immunological parameters including phagocytic activity, phagocytic index, and respiratory burst improved significantly (p < 0.05) in both CNP-supplemented groups, particularly with the CNPs 5 g/kg diet, in comparison to the control group.

3.6. Expression of Immune-Growth-and Stress-Related Genes Findings

The HSP70 mRNA expression in the intestine and liver of the experimental groups showed no significant differences (p < 0.05) due to dietary administration of CS and CNPs to O. niloticus. On the contrary, as the concentration of CNPs increased, the expression of pattern recognition receptors (TLR2) and MUC-2, as well as growth-related genes (IGF), was significantly up-regulated (p ≤ 0.05) (Figure 4 and Figure 5).

3.7. Challenge Test

Experimentally infected fish displayed common signs of aeromonads infection, such as poor feeding responses and swimming close to the edges and surfaces of the tanks. In addition, there are external hemorrhages, skin ulcers, eroded fins, and ascites with exophthalmia. The death of fish started two days post-challenge and remained for 7 days. The mortality rate in the control group was 60%, and the lowest mortalities were recorded in groups fed on CNPs 3 and 5 g/kg at 25% and 20%, respectively. Figure 6 shows the cumulative survivability % of fish groups challenged with A. veronii biovar sobria. All diseased and dead fish were subjected to re-isolation of A. veronii biovar sobria from the spleen, liver, kidney, and brain to validate the cause of mortality.

3.8. Histopathology Examination

Microscopy of the intestine after challenge showed necrosis of intestinal villi tips in the control group (Figure 7a), in the Cs group (Figure 7b), severe goblet cell hyperplasia in the CS Nps (1 g/kg) group (Figure 7c), mild histopathological alteration in the CS NPs (3 g/kg) group (Figure 7d), and in the CS NPs (5 g/kg) group (Figure 7e). Microscopy of the hepatopancreas revealed mild histopathological alterations in the control group (Figure 7f), in the CS group (Figure 7g), in CS NPs 1 g/kg (Figure 7h), CS NPs 3 g/kg (Figure 7i), and CS NPs 5 g/kg (Figure 7j).

4. Discussion

The present study offers a comprehensive assessment of chitosan nanoparticle (CNP) effects on Nile tilapia (Oreochromis niloticus), addressing several gaps in existing literature. This research integrates a wide range of physiological and molecular parameters, including growth performance, immune function, antioxidant capacity, disease resistance, gene expression, and intestinal morphology, providing a holistic view of CNP’s impacts on tilapia health and performance. The study uniquely compares conventional chitosan with CNPs at various concentrations, elucidating dose-dependent effects and the relative efficacy of these formulations.

Dietary CNPs could be regarded as an effective growth promoter [37]. This may be explained by enhancing the villi length of the small intestine, which improves nutrient absorption, feed utilization, and consequent growth performance [8]. Chitosan suppresses the potential pathogens and boosts the beneficial bacteria, promoting the secretion of digestive enzymes that may be responsible for its possible significance in improving growth performance [38]. In this research, the administration of CNPs in varying levels at 1, 3, and 5 g CNPs/kg diets for 60 days showed marked enhancement in fish growth and feed utilization parameters compared to chitosan as a macromolecule and the control diet. Wang and Li [39] observed that Nile tilapia fed CNP at a rate of 5.0 g/kg for 60 days significantly enhanced weight gain, final weight, and feed conversion ratio compared to fish fed a diet containing chitosan and the control diet. Similarly, Abd El-Naby et al. [40] found significant improvements in feed utilization and growth performance of Nile tilapia (O. niloticus) fed on dietary supplements containing chitosan nanoparticles at varying concentrations (0, 1.0, 3.0, and 5.0 g CNPs/kg diet) for 70 days, particularly at levels of 3 and 5 g CNPs/kg.

Nevertheless, it is crucial to acknowledge that not all studies have demonstrated consistently beneficial impacts of chitosan on the growth and performance of fish. While low to moderate doses of nanochitosan have shown promising results in enhancing fish growth and health; several studies have reported negative impacts when administered at high doses. For instance, Wang [39] observed that when tilapia (O. niloticus) were fed diets containing nanochitosan at concentrations exceeding 10 g/kg, there was a significant decrease in growth rate and feed efficiency ratio compared to the control group. In loaches (Misgurnus anguillicadatus), chitosan levels higher than 5 g/kg feed led to diminishing growth effects [9].

Despite these conflicting results, our findings and those of several other studies suggest potential benefits of CNPs, which could be attributed to the lower molecular weight of the polymer, which probably affects the bioavailability, distribution, and systemic absorption of chitosan after oral administration [41]. Furthermore, intestinal epithelial cells can absorb chitosan, which reduces the absorption of dietary fat in the intestines [42]. Chitosan achieves this by binding to negatively charged lipids and bile acids, forming a gel-like substance that hinders fat emulsification and solubilization, ultimately reducing lipid absorption. Additionally, by promoting bile acid excretion, chitosan stimulates the conversion of cholesterol into new bile acids, thereby lowering blood lipid levels. However, a decline in the average molecular weight of chitosan is concurrent with its absorption rate. Thus, chitosan nanoparticles are more effective than chitosan macromolecules in improving feed utilization and growth performance due to their enhanced absorption and bioavailability [43].

Moreover, the compatibility of feed supplements can be evaluated using hematological and biochemical parameters such as erythrocyte count, leukocyte count, hematocrit levels, hemoglobin concentrations, albumin, globulin, total protein, ALT, AST, BUN, and creatinine. The health and nutritional status of the fish may cause changes in the values of these factors [44]. Remarkably, our results showed that Nile tilapia-fed chitosan nanoparticles increased RBCs, WBCs, hematocrit, hemoglobin, total protein, globulin, and albumin values; however, there is no significant difference in liver function tests (ALT and AST) and kidney function tests (BUN and creatinine). These findings support the safe application of chitosan nanoparticles and their potential effects on Nile tilapia’s health. Also, Abd El-Naby et al. [45] and Younus et al. [46] revealed that the hematological profile and serum proteins of Nile tilapia and silver carp that were fed chitosan nanoparticles increased.

Maintaining metabolic homeostasis in the fish body depends on the balance between the generation and clearance of reactive oxygen species (ROS). Cells produce ROS in a physiologically normal state. However, the body is protected from excessive ROS that might seriously damage DNA and other macromolecules by a complicated network of antioxidant systems [47]. Evaluation of antioxidants can reveal the antioxidant capacity of the animals and act as a marker for oxidative stress [48,49]. Oxidative stress causes a rise in reactive oxygen species (ROS) generation in cellular constituents, potentially accumulating peroxides in cells and lipid peroxidation [50]. Antioxidant capacity is an essential measurement to assess the state of oxidative stress and the MDA level indicates lipid peroxidation. In the current study, TAC and GSH levels were considerably higher in the 5g CNPs/kg diet, followed by the 3 g/kg diet, while MDA values significantly declined in comparison to the basal diet. Several researchers have used chitosan as an antioxidant in aquafeed and observed that the antioxidant properties of the chitosan improved with increasing concentration [51]. The antioxidant capacity of chitosan could be attributed to its ability to scavenge free radicals from the cells of the body and reduce or prevent the damage caused by oxidation by donating hydrogen or one pair of electrons and chelating metal ions [52,53].

The impact of chitosan as an antioxidant in fish diets has been the subject of several studies. For example, research has been done on the antioxidant activity of chitosan with various molecular weights in salmon (Salmo salar) diets [54] and in European carp (Cyprinus carpio) exposed to cadmium chloride [55]. Dawood et al. [11] examined the effect of dietary CNPs as an antioxidant in grey mullet (Liza ramada). Fish fed 1 and 2 g/kg of chitosan nanoparticles exhibited higher CAT and GPx activities than fish fed 0 and 0.5 g/kg (p ≤ 0.05) with a reduction in MDA levels.

The immuno-protective efficacy of chitosan nanoparticles has been determined by observing significant differences in the phagocytic activity, lysozyme activity, respiratory burst activity, and expression levels of immune genes in treated groups in comparison with the control group [56]. The present study indicates that orally administering chitosan nanoparticles to O. niloticus with an optimal level of 5.0g CNPs/kg diet for 60 days boosted the immunological parameters, including respiratory burst activities and phagocytic activity/index, more than chitosan macromolecules and control. These results elucidate the potential of chitosan nanoparticles as an immunostimulatory additive for fish feed. In a similar study, Wu [7] studied the effects of chitosan supplementation on immunological markers, antioxidant capacity, and disease resistance against Aeromonas hydrophila in Nile tilapia. After the trial, the findings showed that chitosan dramatically raised the Nile tilapia’s lysozyme, catalase activity, superoxide dismutase activity, and survival rate.

El-Naggar et al. [57] supported the immunostimulatory effect of nanoscale (0.5%) chitosan than ordinary ones for 70 days increasing some immune parameters in Nile tilapia, such as phagocytic activity and phagocytic index, as well as antioxidant system activities. Furthermore, Hossam-Elden et al. [3] assessed the immunostimulatory effect of Nile tilapia supplemented with chitosan nanoparticles with a significant increment to immune parameters like phagocytic activity/index and respiratory burst, as well as antioxidant activity like SOD, TAC, and MDA in comparison to control and chitosan macromolecules.

This may be attributed to the fact that chitin or chitosan isn’t a naturally occurring component of fish cells; fish innate immunity may recognize them after being exposed. Fish that exhibit both direct phagocytosis of chitin and chitosan particles and phagocyte activation are excellent examples of the immunostimulatory potential of chitin and chitosan. This demonstrates how particular immune cell receptors function in recognition and subsequent activation [58]. Although fish do not yet have a definitive identification of these receptors, in rainbow trout (Oncorhynchus mykiss), a chitin-binding interlectin-like protein has been found and is detected in the fish’s intestine, skin, swim bladder, gills, spleen, hepatic sinusoid, renal interstitial, and leucocytes. It also exhibited similarities to human and murine interlectins [59]. The exact methods by which chitosan modulates immunological responses are unknown. The amount of amino or imino residues in chitosan that the leucocytes’ mannose or fucose receptors can recognize is thought to be the cause of immunological recognition and subsequent immune responses [60].

The results showed a linear relationship between CNP level, growth rate, and the expression of IGF-1. The IGF-1 value was compatible with the growth result, where the IGF-1 value was considerably greater in the CNPs 1, 3, and 5 g/ kg diet treatments than in the other groups (p ≤ 0.05). Similarly, Elabd et al. [61] reported that the IGF-1 and cc5 gene expression patterns were significantly upregulated (p ≤ 0.05) in the groups that were fed diets supplemented with nano-curcumin (NCur) and nano-curcumin/chitosan blend (NCur/Ch), compared to the control, with the most marked increase in the NCur/Ch, which recommended that chitosan have a positive effect on growth in O. niloticus.

These results indicated the effect of nano chitosan on growth-related genes that was indirectly supported by different studies that have demonstrated up-regulation of the IGF gene and enhancement of growth performance. Tang et al. [62] observed that increased levels of plasma GH and IGF-I can be achieved through feeding oligosaccharides like COS and GMOS, which can enhance growth and feed conversion efficiency. Similarly, when barramundi (Lates calcarifer) was fed the Biotronic^® Top3 (OCAP: organic acids, cinnamaldehyde, and permeabilizing complex), growth rates along with IGF-1 were significantly increased [63]. In the same pattern, Hendam et al. [64] reported that dietary baobab fruit extract powder (BP) supplementation significantly upregulated growth-related gene expression (IGF-1) in the liver of Nile tilapia with enhanced growth performance in all BP groups compared with the control group, with the best values in a dose-dependent manner.

Aquatic animals rely mainly on their innate immunity, where adaptive immunity is not fully developed [65,66,67]. The first line of innate immunity to protect the host from invading pathogens is pattern recognition receptors (PRR), such as toll-like receptors (TLR), which represent the mechanism of action of cellular innate immunity defense [68,69]. Pattern recognition receptors (PRRs) are a family of proteins that have a highly specialized structure that makes them able to recognize conserved microbial motifs and pathogen-associated molecular patterns (PAMPs) such as lipopolysaccharides (LPS), nucleic acids, peptides (flagellin), peptidoglycans (PGN), lipoproteins, glucans, muramyl dipeptide (MDP), N formylmethionine, and γ-D-glutamyl-meso-diaminopimelic acid (iE-DAP). TLRs are the most studied PRRs in fish and have the best characterized PAMP selectivity in comparison with other PRRs [70]. The expression of TLR-2 in our results was upregulated with increasing levels of CNPs in diets. These findings were supported by Mahboub et al. [71] who revealed upregulation of the immune-related gene (TLR-2) in Nile tilapia (Oreochromis niloticus) after aqueous supplementation with chitosan nanogel (CNG) exhibited a vital role in fish immunity. Similarly, Kole et al. [72] found that the CNP-DNA vaccine increases the expression of immune-related genes (TLR22), strengthening the Labeo rohita fish’s resistance to the Edwardisella tarda bacteria. Chen et al. [73] revealed that gene expression levels of TLR22 increased, at chitosan oligosaccharide (COS) supplementation levels of 0.2% and 0.4%. Shi et al. [74] investigated the immunological responses triggered by oligochitosan in O. niloticus through CSF, IL-1β, IgM, TLR2, and TLR3 mRNA gene expression levels from the head kidney with considerable up-regulation in the 400 mg/kg group compared to the control.

In the present study, CNPs probably preserve the mucus layers due to elevated mucin 2 (MUC-2) gene expression, the most crucial gene for defending intestinal epithelial cells. Udayangani et al. [75] evaluated the influence of dietary chitosan silver nanocomposites (CAgNCs) on goblet cell density, gut microbial community, and mRNA expression of mucin-encoding and immune-related genes in zebrafish. The results showed that a diet supplemented with CAgNCs benefits fish gut immunology by improving villi length, goblet cell density, immune-related and mucin-encoding gene transcription, and beneficial microbial populations.

When cells are exposed to stressful conditions such as upset in the environment (high temperature, reactive oxygen species (ROS), metal toxicity, and toxins) and pathophysiological (apoptosis, aging, ischemia, hypertrophy, inflammation, and bacterial or viral infection), a natural response is triggered by a small group of proteins known as molecular chaperones or heat shock proteins (HSPs) [76]. Our results revealed no significant difference in HSP70 across treatments, demonstrating that the fish was not under stress. Chitooligosaccharide (COS) administration at a moderate level (0.3–0.9 g/kg) to Pacific white shrimp (Litopenaeus vannamei) downregulated the expression of HSP70 [77]. Abdel-Tawwab et al. [78] revealed that dietary supplementation with garlic powder (GP) and/or chitosan (CH) significantly (p < 0.05) downregulated the mRNA expression levels of HSP70 in zearalenone (ZEN)-exposed European seabass. Furthermore, Sotoudeh and Esmaeili [63] showed no significant difference in HSP70 in a barramundi (Lates calcarifer)-supplemented diet containing Biotronic^® Top3 (OCAP: organic acids, cinnamaldehyde, and permeabilizing complex).

The antimicrobial activity of chitosan could be attributed to the cationic amine groups of chitosan and the anionic lipopolysaccharides of gram-negative bacteria [79]. The second method speculated for chitosan’s antibacterial effect involves the chitosan reaching the bacteria’s nuclei, thereby coming into direct contact with the microorganisms’ DNA and subsequently inhibiting the mRNA and protein formation [80,81]. Another explanation for chitosan’s antibacterial properties is that it can effectively chelate metals by drawing metal ions to its deprotonated amino groups [82].

Nanotechnology developed and started to play a remarkable role, with the ability to deliver antimicrobial therapy to the atomic level [83]. High-antimicrobial-activity nanoparticles are currently thought to be one of the most innovative and promising ways to counteract the use of antibiotics for aquaculture disease control [84]. A different study found that chitosan nanoparticles have greater antibacterial activity than chitosan due to their unique properties, most likely due to their larger surface area and stronger attraction for bacterial cells, which produces a quantum-size effect [85].

Following the same pattern, Abd El-Naby et al. [40] administered chitosan nanoparticles at concentrations of 0, 1, 3, or 5 g/kg in the diet of O. niloticus and observed a concentration-dependent decrease in the number of aerobic and anaerobic microorganisms. In another encouraging study, Fadl et al. [86] used O. niloticus to evaluate different amounts of chitosan in their diets (0, 3, and 5 g/kg diet). The results suggested that chitosan significantly enhanced serum lysozyme and bactericidal activities as well as improved resistance against Streptococcus agalactiae. Ahmed et al. [87] observed that the addition of 5 g/kg of chitosan nanoparticles in the diets of Rainbow Trout (Oncorhynchus mykiss) showed increased antibacterial resistance against ERM infection.

5. Conclusions

In conclusion, our study indicated the high dietary inclusion level of CNPs (5 g/kg) with particle size 263.1 nm and +39.7 mv zeta potential increased growth performance and feed utilization, enhanced antioxidant capacity, and immune response and disease resistance against A. veronii biovar sobria in O. niloticus.