Next Article in Journal
Elasmobranch Mark–Recapture Experiment off the Balearic Islands: Insight into Scyliorhinus canicula Growth, Mobility, and Population Size
Previous Article in Journal
Acute Hypercapnia at South African Abalone Farms and Its Physiological and Commercial Consequences
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 9
Issue 8
10.3390/fishes9080314
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic and Pathogenic Characterization of an Iridovirus from the Cultured Largemouth Bass Micropterus salmoides

by
Yi-Fan Zhang
1,†,
Ying Li
2,†,
Peng-Tian Li
1,
Jing Jiang
1,
Wei-Hang Zeng
1,
Kun Ye
1,
Yi-Lei Wang
1 and
Peng-Fei Zou
1,*
1
Key Laboratory of Healthy Mariculture for the East China Sea, Ministry of Agriculture and Rural Affairs, Fisheries College, Jimei University, Xiamen 361021, China
2
Key Laboratory of Estuarine Ecological Security and Environmental Health, Tan Kah Kee College, Xiamen University, Zhangzhou 363105, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Fishes 2024, 9(8), 314; https://doi.org/10.3390/fishes9080314
Submission received: 7 June 2024 / Revised: 25 July 2024 / Accepted: 3 August 2024 / Published: 8 August 2024
(This article belongs to the Section Fish Pathology and Parasitology)
Browse Figures
Versions Notes

Abstract

:
The largemouth bass is a freshwater aquacultured fish species of great economic importance in China. With the rapid development of aquaculture industry and the increase in the aquaculture density of the fish, various infectious pathogens, including parasites, bacteria, and viruses, have been widely spread, which have caused huge losses to the aquaculture industry. Among them, largemouth bass iridovirus (LMBV) is one of the most harmful pathogens. In the present study, a virus strain named LMBV-GDSD was isolated from cultured largemouth bass and was successfully proliferated in FHM and EPC cells, with numerous viral particles observed in the infected cells under transmission electron microscopy analysis. The annotated complete genome of LMBV-GDSD was 99,285 bp and contained 102 ORFs. Based on genomic sequence alignment and phylogenetic analysis, the identified LMBV-GDSD belonged to the genus Ranavirus of Iridoviridae and was pathogenic to largemouth bass under regression infection experiments. In addition, the infection of LMBV-GDSD in largemouth bass could significantly up-regulate the expression of antiviral immune-related genes such as IRF3, IRF7, and Mx. It is thus providing valuable genetic data for a deeper understanding of the pathogenic mechanism of iridovirus in largemouth bass.
Keywords:
iridovirus; LMBV; virus isolation; immune response; pathogenic; Micropterus salmoides
Key Contribution: This study successfully isolated an iridovirus strain named LMBV-GDSD from cultivated largemouth bass and proliferated it in FHM and EPC cells. The genome of LMBV-GDSD was sequenced and annotated, and the pathogenicity of LMBV-GDSD to largemouth bass was characterized. It is thus providing a deeper understanding of the pathogenic mechanism of iridovirus in largemouth bass.

1. Introduction

Iridoviridae family members are composed of a series of large double-stranded DNA viruses, either of which possess enveloped or nonenveloped virions [1], with a diameter of 120–350 nm and a genome range from 105 to 212 kbp [2]. Currently, according to the released data on the International Committee on Taxonomy of Viruses (ICTV) (https://ictv.global/taxonomy, 2022 Release, MSL #38, accessed on 25 July 2024), the members of the Iridoviridae family are divided into two subfamilies (Alphairidovirinae and Betairidovirinae) and seven genera, namely Lymphcystivirus, Megalocytivirus, Ranavirus, Chloriridovirus, Daphniairidovirus, Decapodirivirus, and Iridovirus. Among those seven genera of the Iridoviridae family, Ranavirus, Lymphocystivirus, and Megalocytivirus have been shown to cause infections in freshwater and marine fish worldwide [3]. Notably, viruses of the Ranavirus were globally distributed and could cause infections in ectothermic species including fish [4], amphibians [5], and reptiles [6,7,8].
The largemouth bass (Micropterus salmoides) is a kind of freshwater fish with the advantages of rapid growth, fresh and tender meat, and rich nutrition that has been cultured and popularized around the world since the 1970s [9]. Despite the advancements in artificial breeding techniques, the issue of diseases has emerged as a significant concern within the largemouth bass farming industry, particularly regarding the outbreak of largemouth bass virus (LMBV), which poses a substantial threat to the health of the fish and severely impedes its industry growth.
LMBV, a member of the Ranavirus genus within the Iridoviridae family, was initially isolated from largemouth bass in Vall Lake, FL, USA in 1991 [10]. The first occurrence of fish mortality caused by LMBV was observed in 1995 when approximately 1000 largemouth bass perished in the Santee Cooper Reservoir located in South Carolina [11]. Subsequently, in 2006, LMBV was first reported in China during an outbreak of ulcer syndrome among farmed largemouth bass in Guangdong Province, China, and this syndrome exhibited a progressively deteriorating trend over subsequent years [12]. In cases of LMBV infections, the infected fish exhibit ulceration in the skin and muscle, enlargement of the spleen and kidney, and a mortality rate reaching up to 60%. These detrimental effects result in significant economic losses for farmers and pose a grave threat to the largemouth bass farming industry. In 2008, Deng et al. successfully isolated a virus from diseased largemouth bass, which was identified as Ranavirus of the Iridoviridae family and named largemouth bass ulcerative syndrome virus (LBUSV) [13]. Nevertheless, the subsequent confirmation revealed that the virus in question was indeed identical to the iridovirus found in largemouth bass specimens collected from Vall Lake, FL, USA in 1991.
In the present study, a virus from diseased largemouth bass was isolated. The features of the virus, including its cytopathic effect, genomic information, and the virulence of the virus, were detected. Itis thus providing new information on viral diseases in largemouth bass, which is essential for the disease control and prevention of the fish.

2. Materials and Methods

2.1. Sample Collection

The samples were collected from diseased farming largemouth bass in the freshwater aquaculture pond located in Shunde District, Foshan City, Guangdong Province, China. The samples of the liver and spleen were collected from the fish exhibiting obvious symptoms and then used for subsequent DNA extraction and pathogenicity study.

2.2. DNA Extraction

A small piece of the mixed liver and spleen tissue of the diseased fish was collected with a sterilized dissection tool and put into a 1.5 mL centrifuge tube, adding 600 μL extraction buffer (10 mM Tris-HCL, pH = 8.0; 5 mM EDTA; 0.5% (w/v) SDS) together with 10 μL proteinase K (20 mg/mL). They were put into a laboratory water bath kept at 56 °C and fully digested for 2 h. After the sample was digested to transparency, an equal volume of phenol–chloroform–isoamyl alcohol (phenol/chloroform/isoamyl alcohol = 25:24:1) was added. The supernatants were collected by centrifugation at 12,000× g for 10 min at 4 °C, and the DNA was precipitated with isopropanol at −20 °C for 1 h. Finally, 600 μL of 70% alcohol was added, and the DNA was gently reversed and mixed several times. Following centrifugation at 13,400× g for 10 min at 4 °C, the precipitate was redissolved in 30 μL ddH2O for further use in subsequent experiments.

2.3. Virus Detection

The specific primers targeting fish viral pathogens were selected, and the extracted DNA mentioned above was subjected to PCR analysis. The reaction mixture was prepared with 1 μL of DNA template, 12.5 μL of 2 × Taq Master Mix buffer, and 1 μL of primers (10 μM), together with an appropriate amount of ddH2O added to a total amount of 25 μL. The amplification protocol involved denaturation at 98 °C for 30 s, annealing at the specific temperature (indicated in Table 1) for 45 s, and extension at 72 °C for 1 min during each cycle (35 cycles in total), followed by a final extension step at 72 °C for an additional duration of 10 min using an Eppendorf Master cycler. The products were then electrophoresed on an agarose gel with a 2000 bp DNA marker, and the bands were visualized under a gel luminescence system (BIO-OI 1000, China). The primers used are listed in Table 1.

2.4. Virus Proliferation

Fathead minnow muscle (FHM) cells were cultured in L-15 medium (BOSTER, Wuhan, China) supplemented with 10% fetal bovine serum (FBS, EXCELL) and 100 U/mL of penicillin (P) and streptomycin (S). Epithelioma papulosum cyprinid (EPC) cells were maintained at 28 °C in M199 medium (Procell, China) containing 10% FBS and 100 U/mL of P and S according to our previous reports [14,15,16,17]. For LMBV proliferation, the liver and spleen tissues from naturally LMBV-infected largemouth bass were homogenized in PBS, and the supernatant was collected by centrifugation at 3000× g for 10 min at 4 °C and then passed through a 0.22 μm filter for subsequent virus proliferation. Briefly, FHM and EPC cells were cultured in 25 cm2 cell culture flasks at 28 °C for 24 h, and then the cell medium was removed, followed by incubating with 1 mL of maintenance medium (containing no FBS but 1% PS) together with 200 μL of virus supernatant described above; the supernatant was removed after adsorption for 2 h by gently shaking the culture flask and then replaced with 5 mL normal medium (containing 10% FBS and 1% PS) and cultured at 30 °C. The cells were photographed at 6 h, 12 h, 24 h, 48 h, and 72 h after adding the virus supernatant to evaluate the cytopathic effects (CPEs). When the CPEs reached approximately 70%, the cells were subjected to three cycles of freezing and thawing, followed by collection of the supernatants containing the target virus for subsequent experimental analysis.

2.5. Transmission Electron Microscopy Analysis

For transmission electron microscopy analysis of the LMBV virus in the cell, the EPC cells infected with LMBV for 24 h were washed with PBS (Sangon biotech, Shanghai, China), with the cells collected and fixed in electron microscopy fixative (Servicebio, Wuhan, China) at 4 °C for 24 h before being embedded in the 1% agarose. The specimens were fixed in a light-protected room temperature solution of 1% osmium tetroxide (Ted Pella Inc., Redding, CA, USA) prepared in PBS (0.1 M, pH7.4) for 2 h. Subsequently, a series of graded ethanol solutions (30%, 50%, 70%, 80%, 95%, and 100%) and pure acetone (Sinopharm, Beijing, China) were employed for sample dehydration and embedding in epoxy resin. The samples were sectioned using the LEICA EM UC7, and the sections were then placed on copper grids. These grids were subsequently stained with a saturated alcoholic uranyl acetate solution (SPI Supplies, West Chester, PA, USA) and a 2.6% lead citrate solution (Sinopharm, Beijing, China). Finally, observation and analysis of the prepared samples were conducted using the Hitachi HT7800 transmission electron microscope.

2.6. Virus Titer Detection

The partial fragment of major capsid protein (MCP) gene of LMBV was cloned and constructed into pMD19-T vector, namely pMD19-LMBV-MCP. To quantify the viral titer of LMBV, a standard curve method was performed using dilutions of the known quantity of the plasmid pMD19-LMBV-MCP DNA (determined spectrophotometrically), and the copy numbers of target plasmid or fragment were calculated according to the following formula: plasmid copy number (copies/μL) = (6.02 × 1023 copies/mol) × (concentration ng/μL × 109)/((DNA fragment or constructed plasmid length in bp) g/mol × 660). Eleven consecutive dilutions (dilution factor 1:10) were prepared containing from 1010 to 100 copies/reactions. The amounts of LMBV DNA in tissue samples or cell supernatants were determined by plotting Ct values onto the standard curve. The primers used for qRT-PCR analysis are listed in Table 1.

2.7. Genome Sequencing, Assembly, and Annotation

The sequencing of the obtained LMBV genome was performed by Guangdong Mager Gene Technology Co., LTD. (Guangdong, China). Briefly, the qualified DNA samples of target virus (with the DNA concentration ≥ 50 ng/μL, OD260/280 ≥ 1.5, and OD260/230 ≥ 1.0) were randomly broken to generate DNA fragments of the required length for collection, the sticky ends formed by the break were repaired into flat ends, and then the 3′ end was added with base “A” to make the DNA fragments connect with the 3′ special linker with base “T”. Then, PCR was used to amplify the DNA fragments with the junction at both ends to complete the construction of the whole library. Qualified libraries were then constructed for cluster preparation, and the constructed amplicon libraries were sequenced using the Illumina Nova 6000 platform. After the sequencing data were obtained, SOAPnuke v 2.1.9 [18] software was used to evaluate the data quality and eliminate low-quality data to ensure the credibility of the subsequent analysis results. High-quality reads of each sample were assembled using assembly software, including IDBA-UD version 1.1.3 [19], SPAdes version 3.9 [20], MetaSPAdes, MEGAHIT version 1.0 [21], Trinity, etc. The obtained contigs sequences were aligned with the reference sequences to find out the contigs sequences of viruses of concern in the samples. Based on the alignment results, the viral reference genome was screened, and the final target viral contigs were optimized by using Burrows-Wheeler Alignment tool (BWA) and SAMtools software version 1.6 for reference assembly [22]. The clean reads were aligned with the final target viral contigs sequence to obtain the GC content and sequencing depth map of the genome.

2.8. Genome Analysis

Based on the GenBank data (http://www.ncbi.nlm.nih.gov/genbank, accessed on 12 April 2024), the complete full-length genomes of the representative strains of Iridovirus were collected and aligned with the target virus using MAFFT version 7.526 (https://mafft.cbrc.jp/alignment/software/, accessed on 12 April 2024) [23]. Subsequently, phylogenetic analysis was performed using the neighbor-joining method in MEGA version 7.0 [24]. For visualizing and presenting the genomic characterization of the obtained LMBV, a genome circle map was constructed by using Proksee online software (https://proksee.ca/, accessed on 12 April 2024) [25]. In addition, the whole-genome sequences of representative species of Ranavirus, including frog virus 3 (FV3), Singapore grouper iridovirus (SGIV), ambystoma tigrinum virus (ATV), common midwife toad virus (CMTV) and epizootic hematopoietic necrosis virus (EHIV), were analyzed for their linear relationship by using the Mauve genome alignment software version 2.4.0 [26].

2.9. Regressive Tests of the Isolated LMBV Strain

The healthy largemouth bass were maintained at 30 °C in flow-through water system for one week before artificial infection experiment. The fish were randomly divided into 6 groups with 30 fish in each group. Five groups of fish were intraperitoneally injected with 200 μL of LMBV inoculum obtained from virus proliferation in EPC cells, with the virus titers of 8.4 × 104 copies, 8.4 × 105 copies, 8.4 × 106 copies, 8.4 × 107 copies, and 8.4 × 108 copies, respectively. The control group of fish were injected with the same volume of M199 medium. The fish were monitored three times daily for their status and death, the dead fish infected with the copy number of LMBV described above were removed, and the survival rate was calculated. To determine the viral load in specific tissues, the dead largemouth bass with a total copy number of 8.4 × 107 copies of LMBV were dissected, and total DNA was extracted from the brain, gills, head kidney, heart, liver, spleen, intestine, trunk kidney, gas bladder, intestine, muscle, and dorsal fin, followed by LMBV DNA quantification by qRT-PCR as described above.

2.10. Pathological Analysis of the Tissues under LMBV Infection

The heart, liver, and spleen tissues of largemouth bass infected with 8.4 × 107 copies of LMBV were collected at 48 h post-infection (hpi) and homogenized to achieve a soybean particle size. Following fixation in Bouin’s solution for 24 h, the fixed tissue was dehydrated using an ethanol gradient, made transparent in xylene, and embedded in paraffin. Subsequently, the slides were sectioned using a microtome and stained with hematoxylin and eosin (H.E), followed by application of an appropriate amount of neutral resin onto the slides. Finally, high-resolution images were captured using a fluorescence microscope for subsequent observation and analysis.

2.11. Immune-Related Gene Expression Analysis under LMBV Infection

Based on the regressive tests of the isolated LMBV strain described above, the median lethal dose (LD50) of the obtained LMBV was determined. To determine the expression profiles of immune-related gene expression under LMBV infection, the healthy fish were randomly divided into two groups, with each group containing 30 fish. In the experimental group, each fish was intraperitoneally injected with 200 µL of M199 medium containing the median lethal dose (LD50) of LMBV, whereas the fish of the control group were injected with the same amount of M199 medium. At 72 hpi, nine fish were randomly selected, and various organs including the head kidney and spleen were collected for total RNA extraction.
Total RNA was extracted using Eastep™ Super Total RNA Extraction Kit (Promega, Beijing, China) according to the manufacturer’s protocols, with three equal amounts of RNA combined as one, and then the mixed RNA was reverse transcribed into cDNA using the first-stand cDNA synthesis kit (RevertAid First Stand cDNA Synthesis Kit, #K1622, Thermo Scientific™), followed by qRT-PCR analysis using Go Taq® qPCR Master Mix (Promega, Madison, WI, USA) and performed on a Roche LightCycler® 480 II quantitative real-time detection system (Roche, Switzerland). The expression profiles of immune-related genes, including IRF3, IRF7, and Mx, were normalized to the expression of β-actin and calculated using the 2−ΔΔCt comparative Ct method [27]. The primers used for qRT-PCR are listed in Table 1.

3. Results

3.1. Identification of the Etiological Agent

The liver and spleen tissues were collected and mixed from largemouth bass exhibiting symptoms indicative of viral infection, with the extracted DNA used as a template for initial PCR detection. The results revealed the amplification of the MCP, RNRβS, and ATPase genes specific to LMBV was observed in visible bands (Figure 1, lanes 5~7). In addition, faint bands were observed in infectious spleen and kidney necrosis virus (ISKNV) (Figure 1, lane 1), a representative species of Megalocytivirus, as well as for the MCP and ATPase genes specific to large yellow croaker iridovirus (LYCIV) (Figure 1, lanes 2~3), which belong to the Megalocytivirus family, whereas no bands were detected in the amplification of the MCP genes specific to frog virus 3 (FV3) (Figure 1, lane 4), Singapore grouper iridovirus (SGIV), lymphocystis disease virus (LCDV), or shrimp hemocyte iridescent virus (SHIV) (Figure 1, lanes 8~10).

3.2. LMBV Proliferation and Titer Detection

The liver and spleen homogenates of the largemouth bass described above were filtered and then used for LMBV proliferation in EPC cells and FHM cells. After 12 h of infection, it was found that there were cavities in EPC cells, which began to shrink and round up, eventually floating in the supernatant (Figure 2B). At 24 h post-infection, there was a large-scale rupture of cells, with shedding and rounding of infected cells showing typical cytopathic effects (CPEs), and the cells in the lesion area were distributed in clusters (Figure 2C). In addition, the infected cells exhibited a rounded morphology and reduced adhesion ability at 48 h post-infection, resulting in their detachment upon gentle shaking of the flask (Figure 2D). The FHM cells exhibited the presence of cavities and only a limited area of aggregation rupture after 12 h of infection (Figure 2F). However, at 24 h post-infection, extensive cell rupture was observed with shedding and rounding similar to that observed in EPC cells, and these cells also formed clusters within the lesion area (Figure 2G). At 48 h post-infection, the infected cells displayed a rounded morphology with reduced adhesion ability, leading to their dissolution and detachment from the flask surface (Figure 2H). The control cells, in contrast, exhibited sustained viability even after 72 h of cultivation (Figure 2A,E).
For virus titer detection, the pMD-LMBV-MCP plasmid was utilized as the reference standard. The fluorescence intensity (ΔRn) of the standard was plotted on the y-axis against the cycle number on the x-axis to generate an amplification curve for the standard (Figure 3A). The Ct value of each concentration of the standard was represented on the y-axis, while logarithmic copy numbers were depicted on the x-axis. A linear function relationship between pMD-LMBV-MCP copy number and Ct value was established as y = −3.0849x + 31.05 (Figure 3B), with a high correlation coefficient (R2 = 0.9992) indicating a robust association. According to this methodology, it was determined that the maximum titer of LMBV capable of proliferation in EPC cells was found to be 8.4 × 107 copies/μL, while the highest titer supporting LMBV proliferation in FHM cells reached 1.7 × 106 copies/μL.
Further electron microscopy analysis was conducted on the infected EPC cells, which revealed numerous viral particles within the cytoplasm, with some autophagosome-like vesicles found alongside the viral particles (Figure 4). In addition, the viral particles exhibited an approximate diameter ranging from 150 to 200 nm and possessed a densely packed electron-dense core (Figure 4).

3.3. Full-Length Genomic Sequencing and Phylogenetic Analysis

The full-length genome sequences of the isolated LMBV strain spans 99,285 bp with the GC content of 52.09%. Compared with the reference genome LMBV-GD (GenBank accession number: MW630113.1), the identity was 99.89%. There were 102 ORFs in total, of which 72 ORFs were annotated as regions with known functions or similar functions, including viral replication, transcription, protein synthesis, and modification, whereas the remaining 30 ORFs were not annotated yet (Figure 5).
The taxonomic position of the isolated LMBV strain and its phylogenetic relationship with other members of the Iridovirus family were further investigated through phylogenetic analysis based on complete genome sequencing data. The results demonstrated a close clustering between the isolated LMBV strain and largemouth bass virus strain (LMBV-GD), as well as its inclusion in a clade alongside other members of the Ranavirus genus (Figure 6). It is thus proposed that the isolated LMBV strain be named largemouth bass virus Guangdong Shunde (LMBV-GDSD).

3.4. Gene Collinearity Analysis

To compare the genomic conservation of LMBV-GDSD with other members of Ranavirus, the whole genome of LMBV-GDSD was compared with FV3, ATV, CMTV, and EHIV. Local collinear blocks (LCBs) and their orthologous relationships in the genomes of these species were displayed by using different colored blocks. The results showed that FV3, ATV, CMTV, and EHIV had high genome sequence alignment identity. However, a high level of gene rearrangement was also observed between these species and LMBV-GDSD (Figure 7). Nevertheless, all species exhibit some conserved homology blocks, indicative of evolutionary conservation of those members in Ranavirus.

3.5. Pathogenicity of the LMBV-GDSD in Largemouth Bass

For regressive tests of the isolated LMBV-GDSD strain, the supernatants obtained from LMBV-GDSD-infected EPC cells were intraperitoneally injected into healthy largemouth bass. Fish infected with LMBV-GDSD exhibited distinct clinical manifestations, primarily characterized by surface ulceration (Figure 8A), vertical swimming behavior (Figure 8B), presence of yellowish discharge in the abdominal region (Figure 8C), and enlarged liver and spleen (Figure 8D,E). The fish began to die at 2 d after the injection of LMBV-GDSD-containing supernatant. In the group injected with 8.4 × 108 copies of LMBV-GDSD, the fish exhibited a mortality rate of 100% at 6 d post-injection. On the 7th day, the group injected with 8.4 × 104 copies of LMBV-GDSD showed a mortality rate of 40%, whereas no fatalities were observed in the control group (Figure 9). Based on this information, the LD50 of the obtained LMBV-GDSD strain was calculated and determined to be 1.95 × 105 copies.
To assess the viral load in various tissues of the largemouth bass, the organs/tissues of the fish injected with 8.4 × 107 copies of LMBV-GDSD were collected. Subsequently, qRT-PCR was employed to determine the viral load in 11 different tissues, including the brain, gills, head kidney, heart, liver, spleen, intestine, trunk kidney, gas bladder, muscle, and dorsal fin. The results revealed that among all the examined tissues, the intestine exhibited the highest viral load of LMBV-GDSD, followed by the spleen, gas bladder, liver, gill, trunk kidney, muscle, heart, head kidney, and brain, while the dorsal fin displayed the lowest viral load (Figure 10).

3.6. Histopathological Section Analysis under LMBV-GDSD Infection

The histopathological section analysis of largemouth bass showed that the structures of heart, liver, and spleen in the control group were normal, and the myocardial fibers were crossed and arranged in an orderly manner, forming a complex three-dimensional spatial structure with uniform coloration and normal morphology (Figure 11A,C,E). However, in the challenge group under LMBV-GDSD infection, the atria were widely seen to be loosely arranged, the fibers were necrotic and dissolved, and much cellular debris could be seen (Figure 11B). The intercellular space of hepatocytes was widened, the hepatic sinusoid was dilated, and the hepatocytes were swollen with lysis and necrosis (Figure 11D). In addition, the spleen tissue of the challenge group was loose, and the cells were necrotic (Figure 11F).

3.7. LMBV-GDSD Infection Induced the Antiviral Immune-Related Gene Expression

To explore the induction of antiviral immune-related gene expression under LMBV-GDSD infection, the fish were intraperitoneally injected with a median lethal dose (LD50) (1.95 × 105 copies) of the obtained LMBV-GDSD, and the immune-related tissues, including the spleen and head kidney, were collected for gene expression analysis. The results showed that at 72 hpi, the expression of IRF3, IRF7, and Mx was significantly up-regulated in response to LMBV-GDSD infection, with fold changes of 2.2, 4.0, and 21.1, respectively, in the head kidney (Figure 12A). Similarly, in the spleen, these genes were up-regulated by 2.2-fold, 3.3-fold, and 15.7-fold, respectively (Figure 12B). It is thus suggested that the infection of LMBV-GDSD could significantly induce immune-related gene expression in largemouth bass.

4. Discussion

Among the Iridoviridae family, Ranavirus causes a variety of diseases in freshwater and seawater fish. Ranavirus infection has been reported on all continents except Antarctica [28]. Largemouth bass is an important economic freshwater aquaculture fish that is widely cultured and is one of the rapidly growing species in China. LMBV was first isolated and reported from largemouth bass in China in 2008, when the fatality rate of virus infection was as high as 60% at that time. In this study, a novel LMBV Guangdong Shunde strain (LMBV-GDSD) was isolated and characterized from the cultured largemouth bass in Shunde, Guangdong Province of China. The full-length genome sequence of LMBV-GDSD was obtained and characterized, and the pathogenic character on largemouth bass was also determined, being thus important for further investigation on LMBV-caused disease control and prevention of largemouth bass.
Using PCR analysis with primers designed from the various typical members of the Iridoviridae that have been demonstrated to infect teleost fish, including the Ranavirus genus (LMBV, FV3, and SGIV), Megalocytivirus genus (ISKNV and LYCIV), Lymphocystivirus genus (LCDV), and Decapodiridovirus genus (SHIV), it was revealed that the DNA samples derived from the largemouth bass liver and spleen could be strongly detected by the specific primers of LMBV. In addition, positive results were also detected using specific primers of ISKNV and LYCIV, although with a very weak signal. Further investigation was conducted to confirm whether the detection of ISKNV and LYCIV resulted from a cross-reaction of the two viruses with LMBV. It was revealed that the specific primers of ISKNV and LYCIV could amplify bands using the target genes of LMBV as templates (Supplementary Figure S1), suggesting such positive signaling detected by specific primers of ISKNV and LYCIV was due to a nonspecific amplification of LMBV. Therefore, the genetic similarity of these viruses implies that future detection efforts should prioritize investigating the cross-reactivity among iridoviruses, particularly ISKNV, LYCIV, and LMBV.
Previous studies have demonstrated that raising water temperature is crucial for successful LMBV infection in vitro [29]. Similarly, our present report also observed that the proliferation of the virus in EPC or FHM cells has a relationship with the culture temperature. Compared with the proliferation of the LMBV-GDSD strain at 28 °C, the CPEs appeared earlier, and the virus proliferation phase rate was higher at 30 °C. In addition, the regressive tests of the virus also showed that the fish were more susceptible to LMBV-GDSD at 30 °C compared to 28 °C. Together with previous findings, it has been demonstrated that the temperature-related immune response of the host is exploited by aquatic viral pathogens to facilitate their entry and replication [30]. This suggests a potentially significant role of temperature in both the replication and pathogenicity of LMBV.
The main clinical symptoms of largemouth bass infected with LMBV include abdominal swelling, skin and muscle necrosis, edema of internal organs, and lethargy [31]. In the regressive test experiment of the present study, after artificial infection of largemouth bass with LMBV-GDSD, it was revealed that the fish showed typical symptoms, including difficulty swimming, surface ulcers, yellow secretion from the abdomen, and enlargement of the liver and spleen. As the injection concentration of LMBV-GDSD increased, the death of the fish occurred faster, the mortality rate increased, and the surface ulcers were more obvious. Moreover, all of the fish in the artificially infected group died within one week, which was consistent with the current research progress of LMBV-related disease, implying the damage that LMBV caused in the culture of largemouth bass.

5. Conclusions

In summary, we successfully isolated and characterized a novel largemouth bass iridovirus (LMBV-GDSD) and conducted an artificial infection trial. The genome information and the pathogenic characterization of LMBV-GDSD were further determined. It thus provided a better understanding of the pathogenicity of LMBV as well as a theoretical basis for the prevention and control of viral diseases in largemouth bass.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fishes9080314/s1, Figure S1: Cross-reactivity tests of the primers targeting LMBV, LYCIV, and ISKNV.

Author Contributions

Methodology, P.-F.Z.; Investigation, Y.-F.Z., P.-T.L., J.J., W.-H.Z. and K.Y.; Data curation, Y.-F.Z., P.-T.L. and J.J.; Writing—original draft, Y.-F.Z.; Writing—review & editing, Y.L., Y.-L.W. and P.-F.Z.; Supervision, P.-F.Z.; Funding acquisition, Y.L., K.Y., Y.-L.W. and P.-F.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by a grant (2021J02046) from the Natural Science Foundation of Fujian Province of China, a grant (2022YFD2401001) from the National Key Research and Development Program of China, a grant (2021FJSCZY01) from the Seed Industry Innovation and Industrialization Project of Fujian Province, a grant (31772878) from the National Natural Science Foundation of China, a grant (ZZ2023J18) from the Natural Science Foundation of Zhangzhou City, Fujian Province of China, and a grant (JAT210242) from the Fujian Provincial Department of Education.

Institutional Review Board Statement

This animal study was reviewed and approved by Animal Administration and Ethics Committee of Jimei University (Permit No. 2021-4).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article or Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Eaton, H.E.; Ring, B.A.; Brunetti, C.R. The genomic diversity and phylogenetic relationship in the family Iridoviridae. Viruses 2010, 2, 1458–1475. [Google Scholar] [CrossRef] [PubMed]
  2. Leibovitz, L.; Koulish, S. A viral disease of the ivory barnacle, Balanus eburneus, Gould (Crustacea, Cirripedia). Biol. Bull. 1989, 176, 301–307. [Google Scholar] [CrossRef] [PubMed]
  3. Wang, G.; Luan, Y.; Wei, J.; Li, Y.; Shi, H.; Cheng, H.; Bai, A.; Xie, J.; Xu, W.; Qin, P. Genetic and pathogenic characterization of a new Iridovirus isolated from cage-cultured large yellow croaker (Larimichthys crocea) in China. Viruses 2022, 14, 208. [Google Scholar] [CrossRef] [PubMed]
  4. Whittington, R.J.; Becker, J.A.; Dennis, M.M. Iridovirus infections in finfish-critical review with emphasis on ranaviruses. J. Fish Dis. 2010, 33, 95–122. [Google Scholar] [CrossRef] [PubMed]
  5. Papp, T.; Marschang, R.E. Detection and characterization of invertebrate iridoviruses found in reptiles and prey insects in Europe over the past two decades. Viruses 2019, 11, 600. [Google Scholar] [CrossRef] [PubMed]
  6. Huang, Y.H.; Huang, X.H.; Liu, H.; Gong, J.; Ouyang, Z.L.; Cui, H.C.; Cao, J.H.; Zhao, Y.T.; Wang, X.J.; Jiang, Y.L.; et al. Complete sequence determination of a novel reptile iridovirus isolated from soft-shelled turtle and evolutionary analysis of Iridoviridae. BMC Genom. 2009, 10, 224. [Google Scholar] [CrossRef]
  7. Stöhr, A.C.; López-Bueno, A.; Blahak, S.; Caeiro, M.F.; Rosa, G.M.; de Matos, A.P.A.; Martel, A.; Alejo, A.; Marschang, R.E. Phylogeny and differentiation of reptilian and amphibian Ranaviruses detected in Europe. PLoS ONE 2015, 10, e0118633. [Google Scholar] [CrossRef] [PubMed]
  8. Johnson, A.J.; Pessier, A.P.; Wellehan, J.F.X.; Childress, A.; Norton, T.M.; Stedman, N.L.; Bloom, D.C.; Belzer, W.; Titus, V.R.; Wagner, R.; et al. Ranavirus infection of free-ranging and captive box turtles and tortoises in the United States. J. Wildl. Dis. 2008, 44, 851–863. [Google Scholar] [CrossRef]
  9. Ma, D.; Bai, J.; Deng, G.; Li, S.; Ye, X.; Jiang, X. Sequence analysis of MCP gene from largemouth bass ulcerative syndrome virus and rapid detection by PCR assay. J. Fish. Sci. China 2010, 17, 1149–1156. [Google Scholar]
  10. Grizzle, J.M.; Altinok, I.; Fraser, W.A.; Francis-Floyd, R. First isolation of largemouth bass virus. Dis. Aquat. Org. 2002, 50, 233–235. [Google Scholar] [CrossRef]
  11. Plumb, J.A.; Grizzle, J.M.; Young, H.E.; Noyes, A.D.; Lamprecht, S. An iridovirus isolated from wild largemouth bass. J. Aquat. Anim. Health 1996, 8, 265–270. [Google Scholar] [CrossRef]
  12. Jin, Y.; Bergmann, S.M.; Mai, Q.; Yang, Y.; Liu, W.; Sun, D.; Chen, Y.; Yu, Y.; Liu, Y.; Cai, W.; et al. Simultaneous isolation and identification of largemouth bass virus and Rhabdovirus from moribund largemouth bass (Micropterus salmoides). Viruses 2022, 14, 1643. [Google Scholar] [CrossRef]
  13. Deng, G.; Xie, J.; Li, S.; Bai, J.; Chen, K.; Ma, D.; Jiang, X.; Lao, H. Isolation and preliminary identification of the pathogen from largemouth bass ulcerative syndrome. J. Fish. China 2009, 33, 871–877. [Google Scholar]
  14. Zou, P.F.; Tang, J.C.; Li, Y.; Feng, J.J.; Zhang, Z.P.; Wang, Y.L. MAVS splicing variants associated with TRAF3 and TRAF6 in NF-κB and IRF3 signaling pathway in large yellow croaker (Larimichthys crocea). Dev. Comp. Immunol. 2021, 121, 104076. [Google Scholar] [CrossRef] [PubMed]
  15. Zhang, J.X.; Li, Y.; Tang, J.C.; Li, K.Q.; Shen, J.J.; Liu, C.; Jiang, Y.H.; Zhang, Z.P.; Wang, Y.L.; Zou, P.F. SARM suppresses TRIF, TRAF3, and IRF3/7 mediated antiviral signaling in large yellow croaker (Larimichthys crocea). Front. Immunol. 2023, 13, 1021443. [Google Scholar] [CrossRef]
  16. Jiang, J.; Li, Y.; Li, K.Q.; Shen, Y.J.; Li, F.; Wang, Y.L.; Jiang, Y.H.; Zou, P.F. Functional characterization of RIP2 in large yellow croaker (Larimichthys crocea), a protein involved in the host antiviral responses via NF-kappaB, IRF3/7 related signaling. Fish Shellfish Immunol. 2024, 145, 109374. [Google Scholar] [CrossRef]
  17. Chen, Y.; Li, Y.; Li, P.T.; Luo, Z.H.; Zhang, Z.P.; Wang, Y.L.; Zou, P.F. Novel findings in teleost TRAF4, a protein acts as an enhancer in TRIF and TRAF6 mediated antiviral and inflammatory signaling. Front. Immunol. 2022, 13, 944528. [Google Scholar] [CrossRef] [PubMed]
  18. Chen, Y.X.; Chen, Y.S.; Shi, C.M.; Huang, Z.B.; Zhang, Y.; Li, S.K.; Li, Y.; Ye, J.; Yu, C.; Li, Z.; et al. SOAPnuke: A MapReduce acceleration-supported software for integrated quality control and preprocessing of high-throughput sequencing data. Gigascience 2017, 7, gix120. [Google Scholar] [CrossRef]
  19. Peng, Y.; Leung, H.C.M.; Yiu, S.M.; Chin, F.Y.L. IDBA-UD: A de novo assembler for single-cell and metagenomic sequencing data with highly uneven depth. Bioinformatics 2012, 28, 1420–1428. [Google Scholar] [CrossRef]
  20. Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef]
  21. Li, D.H.; Luo, R.B.; Liu, C.M.; Leung, C.M.; Ting, H.F.; Sadakane, K.; Yamashita, H.; Lam, T.W. MEGAHIT v1.0: A fast and scalable metagenome assembler driven by advanced methodologies and community practices. Methods 2016, 102, 3–11. [Google Scholar] [CrossRef] [PubMed]
  22. Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [PubMed]
  23. Katoh, K.; Misawa, K.; Kuma, K.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef] [PubMed]
  24. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
  25. Grant, J.R.; Enns, E.; Marinier, E.; Mandal, A.; Herman, E.K.; Chen, C.Y.; Graham, M.; Van Domselaar, G.; Stothard, P. Proksee: In-depth characterization and visualization of bacterial genomes. Nucleic Acids Res. 2023, 51, W484–W492. [Google Scholar] [CrossRef] [PubMed]
  26. Darling, A.C.; Mau, B.; Blattner, F.R.; Perna, N.T. Mauve: Multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 2004, 14, 1394–1403. [Google Scholar] [CrossRef]
  27. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  28. Jancovich, J.K.; Steckler, N.K.; Waltzek, T.B. Ranavirus taxonomy and phylogeny. In Ranaviruses: Lethal Pathogens of Ectothermic Vertebrates; Gray, M.J., Chinchar, V.G., Eds.; Springer International Publishing: Cham, Switzerland, 2015; pp. 59–70. [Google Scholar]
  29. Grant, E.C.; Philipp, D.P.; Inendino, K.R.; Goldberg, T.L. Effects of temperature on the susceptibility of largemouth bass to largemouth bass virus. J. Aquat. Anim. Health 2003, 15, 215–220. [Google Scholar] [CrossRef]
  30. Hou, G.; Lv, Z.; Liu, W.; Xiong, S.; Zhang, Q.; Li, C.; Wang, X.; Hu, L.; Ding, C.; Song, R. An aquatic virus exploits the IL6-STAT3-HSP90 signaling axis to promote viral entry. PLoS Pathog. 2023, 19, e1011320. [Google Scholar]
  31. Boonthai, T.; Loch, T.P.; Yamashita, C.J.; Smith, G.D.; Winters, A.D.; Kiupel, M.; Brenden, T.O.; Faisal, M. Laboratory investigation into the role of largemouth bass virus (Ranavirus, Iridoviridae) in smallmouth bass mortality events in Pennsylvania rivers. BMC Vet. Res. 2018, 14, 62. [Google Scholar] [CrossRef]
Fishes 09 00314 g001
Figure 1. Virus detection by PCR analysis. The virus was detected by PCR analysis with various iridovirus genus-specific primers, using the DNA template extracted from a mixture of liver and spleen from the sampling largemouth bass. M: 2000 bp DNA ladder; lane 1: ISKNV-MCP (550 bp); lane 2: LYCIV-ATPase (295 bp); lane 3: LYCIV-MCP (279 bp); lane 4: FV3-MCP (585 bp); lane 5: LMBV-AAA-ATPase (422 bp); lane 6: LMBV-RNRβS (529 bp); lane 7: LMBV-MCP (445 bp); lane 8: SGIV-MCP (250 bp); lane 9: LCDV-C-MCP (442 bp); lane 10: SHIV-MCP (435 bp).
Figure 1. Virus detection by PCR analysis. The virus was detected by PCR analysis with various iridovirus genus-specific primers, using the DNA template extracted from a mixture of liver and spleen from the sampling largemouth bass. M: 2000 bp DNA ladder; lane 1: ISKNV-MCP (550 bp); lane 2: LYCIV-ATPase (295 bp); lane 3: LYCIV-MCP (279 bp); lane 4: FV3-MCP (585 bp); lane 5: LMBV-AAA-ATPase (422 bp); lane 6: LMBV-RNRβS (529 bp); lane 7: LMBV-MCP (445 bp); lane 8: SGIV-MCP (250 bp); lane 9: LCDV-C-MCP (442 bp); lane 10: SHIV-MCP (435 bp).
Fishes 09 00314 g001
Fishes 09 00314 g002
Figure 2. Virus proliferation of the isolated LMBV strain in EPC and FHM cells. (A) EPC cells without LMBV infection for 72 h. (B) EPC cells infected with LMBV for 12 h. (C) EPC cells infected with LMBV for 24 h. (D) EPC cells infected with LMBV for 48 h. (E) FHM cells without LMBV infection for 72 h. (F) FHM cells infected with LMBV for 12 h. (G) FHM cells infected with LMBV for 24 h. (H) FHM cells infected with LMBV for 48 h.
Figure 2. Virus proliferation of the isolated LMBV strain in EPC and FHM cells. (A) EPC cells without LMBV infection for 72 h. (B) EPC cells infected with LMBV for 12 h. (C) EPC cells infected with LMBV for 24 h. (D) EPC cells infected with LMBV for 48 h. (E) FHM cells without LMBV infection for 72 h. (F) FHM cells infected with LMBV for 12 h. (G) FHM cells infected with LMBV for 24 h. (H) FHM cells infected with LMBV for 48 h.
Fishes 09 00314 g002
Fishes 09 00314 g003
Figure 3. Standard curve construction for the viral titer quantification of the LMBV strain by qPCR analysis. (A) qPCR amplification plots of the 10-fold concentration gradients of standard plasmid pMD-LMBV-MCP. (B) The relationship between the copy number and the Ct values of the standard was fitted by the Ct values of the standard at different concentrations and the corresponding log10 (virus copy number). R2 values closer to 1 represent higher confidence in the functional relationship.
Figure 3. Standard curve construction for the viral titer quantification of the LMBV strain by qPCR analysis. (A) qPCR amplification plots of the 10-fold concentration gradients of standard plasmid pMD-LMBV-MCP. (B) The relationship between the copy number and the Ct values of the standard was fitted by the Ct values of the standard at different concentrations and the corresponding log10 (virus copy number). R2 values closer to 1 represent higher confidence in the functional relationship.
Fishes 09 00314 g003
Fishes 09 00314 g004
Figure 4. Electron micrograph of viral particles in the LMBV-infected EPC cells. (A) Numerous viral particles are in the EPC cells. (B) The outer membranes and central electron-lucent core of mature virions are visible in the enlarged image. The dotted black square area of (A) is enlarged in (B). Red arrows indicate mature viral particles, while white arrows indicate immature viral particles.
Figure 4. Electron micrograph of viral particles in the LMBV-infected EPC cells. (A) Numerous viral particles are in the EPC cells. (B) The outer membranes and central electron-lucent core of mature virions are visible in the enlarged image. The dotted black square area of (A) is enlarged in (B). Red arrows indicate mature viral particles, while white arrows indicate immature viral particles.
Fishes 09 00314 g004
Fishes 09 00314 g005
Figure 5. Genome circle mapping of the LMBV-GDSD strain. The green portion denotes the predicted open reading frame (ORF), with the arrow direction indicating the approximate size and transcription direction of the ORFs. The purple is the genome annotation to CDS information, and 72 of these CDS were annotated to their functions. The circle diagram also shows the CG content and CG skew distribution of the genome.
Figure 5. Genome circle mapping of the LMBV-GDSD strain. The green portion denotes the predicted open reading frame (ORF), with the arrow direction indicating the approximate size and transcription direction of the ORFs. The purple is the genome annotation to CDS information, and 72 of these CDS were annotated to their functions. The circle diagram also shows the CG content and CG skew distribution of the genome.
Fishes 09 00314 g005
Fishes 09 00314 g006
Figure 6. Phylogenetic analysis of LMBV-GDSD and other representative iridoviruses based on complete genome nucleotide sequences. The phylogenetic tree was constructed by the neighbor-joining method, with the bootstrap values indicated for each node from 1000 resamplings. The names of the viruses as well as the GenBank accession numbers are shown. The solid black triangle indicates the LMBV-GDSD reported in the present study.
Figure 6. Phylogenetic analysis of LMBV-GDSD and other representative iridoviruses based on complete genome nucleotide sequences. The phylogenetic tree was constructed by the neighbor-joining method, with the bootstrap values indicated for each node from 1000 resamplings. The names of the viruses as well as the GenBank accession numbers are shown. The solid black triangle indicates the LMBV-GDSD reported in the present study.
Fishes 09 00314 g006
Fishes 09 00314 g007
Figure 7. Comparative analysis of the genomic sequences of LMBV-GDSD and other members of Ranavirus. The whole genome of LMBV-GDSD was compared with the typical member of Ranavirus, including FV3, ATV, CMTV, and EHIV. Colored boxes represent local collinear blocks (LCBs), representing homologous regions of sequences that do not contain any major rearrangements. The corresponding LCBs among different viruses were connected by lines. For each genome, ORFs are shown below the LCBs.
Figure 7. Comparative analysis of the genomic sequences of LMBV-GDSD and other members of Ranavirus. The whole genome of LMBV-GDSD was compared with the typical member of Ranavirus, including FV3, ATV, CMTV, and EHIV. Colored boxes represent local collinear blocks (LCBs), representing homologous regions of sequences that do not contain any major rearrangements. The corresponding LCBs among different viruses were connected by lines. For each genome, ORFs are shown below the LCBs.
Fishes 09 00314 g007
Fishes 09 00314 g008
Figure 8. Symptoms of largemouth bass under artificial infection with the isolated LMBV-GDSD strain. The largemouth bass was artificially infected with the isolated LMBV-GDSD strain at 8.4 × 107 copies, and the symptoms of the fish were detected and recorded at 48 hpi, including the ulceration of the body surface of the fish (A), vertical swimming (B), and yellow secretion in the abdominal cavity (C). The liver and spleen of the healthy fish (D), as well as the liver and spleen of fish under LMBV-GDSD (E), were also dissociated and photographed. Black arrows indicate enlarged liver and spleen in the diseased fish compared to the healthy fish.
Figure 8. Symptoms of largemouth bass under artificial infection with the isolated LMBV-GDSD strain. The largemouth bass was artificially infected with the isolated LMBV-GDSD strain at 8.4 × 107 copies, and the symptoms of the fish were detected and recorded at 48 hpi, including the ulceration of the body surface of the fish (A), vertical swimming (B), and yellow secretion in the abdominal cavity (C). The liver and spleen of the healthy fish (D), as well as the liver and spleen of fish under LMBV-GDSD (E), were also dissociated and photographed. Black arrows indicate enlarged liver and spleen in the diseased fish compared to the healthy fish.
Fishes 09 00314 g008
Fishes 09 00314 g009
Figure 9. Survival curves of largemouth bass under artificial infection with the isolated LMBV-GDSD strain at various titers. The largemouth bass was artificially infected with the isolated LMBV-GDSD strain at 8.4 × 104 copies, 8.4 × 105 copies, 8.4 × 106 copies, 8.4 × 107 copies, and 8.4 × 108 copies, respectively. The fish were then checked daily, and the survival rate was calculated until 7 days post-infection.
Figure 9. Survival curves of largemouth bass under artificial infection with the isolated LMBV-GDSD strain at various titers. The largemouth bass was artificially infected with the isolated LMBV-GDSD strain at 8.4 × 104 copies, 8.4 × 105 copies, 8.4 × 106 copies, 8.4 × 107 copies, and 8.4 × 108 copies, respectively. The fish were then checked daily, and the survival rate was calculated until 7 days post-infection.
Fishes 09 00314 g009
Fishes 09 00314 g010
Figure 10. Viral loads of LMBV-GDSD in different organs/tissues of largemouth bass. The largemouth bass was artificially infected with LMBV-GDSD at 8.4 × 107 copies. At 72 hpi, qRT-PCR was employed to determine the viral copies in 11 different tissues of largemouth bass, including the intestine, spleen, gas bladder, liver, gill, trunk kidney, muscle, heart, head kidney, brain, and dorsal fin. Statistical analysis was performed using one-way ANOVA followed by Duncan’s multiple range test. All data are shown as mean ± SE, with bars representing SE and the different letters indicating statistically significant differences (p < 0.05).
Figure 10. Viral loads of LMBV-GDSD in different organs/tissues of largemouth bass. The largemouth bass was artificially infected with LMBV-GDSD at 8.4 × 107 copies. At 72 hpi, qRT-PCR was employed to determine the viral copies in 11 different tissues of largemouth bass, including the intestine, spleen, gas bladder, liver, gill, trunk kidney, muscle, heart, head kidney, brain, and dorsal fin. Statistical analysis was performed using one-way ANOVA followed by Duncan’s multiple range test. All data are shown as mean ± SE, with bars representing SE and the different letters indicating statistically significant differences (p < 0.05).
Fishes 09 00314 g010
Fishes 09 00314 g011
Figure 11. Pathological section analysis of the heart, liver, and spleen of largemouth bass with LMBV-GDSD infection. The largemouth bass was artificially infected with LMBV-GDSD at 8.4 × 107 copies. At 72 hpi, the heart (A), liver (C), and spleen (E) of the fish in the control group without LMBV-GDSD infection, as well as the heart (B), liver (D), and spleen (F) of the fish in the challenge group with LMBV-GDSD infection, were collected for pathological section analysis, respectively. All observations were performed under a microscope at 20× magnification.
Figure 11. Pathological section analysis of the heart, liver, and spleen of largemouth bass with LMBV-GDSD infection. The largemouth bass was artificially infected with LMBV-GDSD at 8.4 × 107 copies. At 72 hpi, the heart (A), liver (C), and spleen (E) of the fish in the control group without LMBV-GDSD infection, as well as the heart (B), liver (D), and spleen (F) of the fish in the challenge group with LMBV-GDSD infection, were collected for pathological section analysis, respectively. All observations were performed under a microscope at 20× magnification.
Fishes 09 00314 g011
Fishes 09 00314 g012
Figure 12. Expression analysis of the antiviral immune-related genes in response to LMBV-GDSD infection. The largemouth bass was artificially infected with LMBV-GDSD at LD50 dose of 1.95 × 105 copies. At 48 hpi, the head kidney and spleen of the fish were collected for RNA extraction, and the expression levels of immune-related genes including IRF3, IRF7, and Mx in the head kidney (A) and spleen (B) were detected by qPCR analysis, with the error bars representing the SE. ** p < 0.01.
Figure 12. Expression analysis of the antiviral immune-related genes in response to LMBV-GDSD infection. The largemouth bass was artificially infected with LMBV-GDSD at LD50 dose of 1.95 × 105 copies. At 48 hpi, the head kidney and spleen of the fish were collected for RNA extraction, and the expression levels of immune-related genes including IRF3, IRF7, and Mx in the head kidney (A) and spleen (B) were detected by qPCR analysis, with the error bars representing the SE. ** p < 0.01.
Fishes 09 00314 g012
Table 1. Primer sequences used in this study.
Table 1. Primer sequences used in this study.
Primer NameAccession No.Sequence (5′ → 3′)Application
ISKNV-MCP-FNC_003494.1CCTTAATTTGCCCATTCCCCTCTTCISKNV detection
ISKNV-MCP-RAGTAGTCTACTCCCATCTGGTGGAG
LYCIV-ATPase-FAY779031.1ATTTGAATGCCAGCCTGAGGLYCIV detection
LYCIV-ATPase-RTGTGCACTTGCTTACACCAC
LYCIV-MCP-FKY765672.1TGCTAATTTCGGCCAGGAGTLYCIV detection
LYCIV-MCP-RCGCATGCCAATCATCTTGTT
FV3-MCP-FDQ897669.1CGCAGTCAAGGCCTTGATGTFV3 detection
FV3-MCP-RAAAGACCCGTTTTGCAGCAAAC
LMBV-ATPase-FAF462345.1ATGTACTACTTAAAACAAGATATGGLMBV detection
LMBV-ATPase-RCTCGTCGTCAGTCTCGCT
LMBV-RNRβS-FUUY86245.1AAAGGTGTAGAGCATACGGTGLMBV detection
LMBV-RNRβS-RTCCCCCTCATAAAATCCAG
LMBV-MCP-FON418985.1ATGTCTTCTGTTACGGGTTCTGLMBV detection
LMBV-MCP-RCAGGATGGGGAAACCCAT
SGIV-MCP-FAAS18179.1TGGCCACGTACGACAATCTCSGIV detection
SGIV-MCP-RGCGCCGAGCCTATTTGTATC
LCDV-C-MCP-FAAS47819.1CAACCTCTAACTATTCCAAGTCCTALCDV detection
LCDV-C-MCP-RAAGTATTTCCACCATTACCACC
SHIV-MCP-FKY990032.1CCGTCCTCAACCCAAATCSHIV detection
SHIV-MCP-RTGGCTTCACCTTCACCCT
q-LMBV-MCP-FON418985.1CCTGTTGTTGGAGCGGGTAAqRT-PCR
q-LMBV-MCP-RGGAATGGCGGGTGCGTAGT
qMs-β-actin-FNC_040022.1AAAGGGAAATCGTGCGTGACqRT-PCR
qMs-β-actin-RAAGGAAGGCTGGAAGAGGG
qMs-IRF3-FNC_040026.1TCTCATCTTTAAGGCGTGGGCqRT-PCR
qMs-IRF3-RGGGGTTAGCGGTGTCGTTC
qMs-IRF7-FNC_040031.1AGAAAGCTGCCCCAGAATACCqRT-PCR
qMs-IRF7-RGAGGGACCACCTTGACTACGAT
qMs-Mx-FNW_020852758.1TAAAATGGCTGGGGTCGGGGqRT-PCR
qMs-Mx-RCATTGCACGGAACGACCACC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, Y.-F.; Li, Y.; Li, P.-T.; Jiang, J.; Zeng, W.-H.; Ye, K.; Wang, Y.-L.; Zou, P.-F. Genetic and Pathogenic Characterization of an Iridovirus from the Cultured Largemouth Bass Micropterus salmoides. Fishes 2024, 9, 314. https://doi.org/10.3390/fishes9080314

AMA Style

Zhang Y-F, Li Y, Li P-T, Jiang J, Zeng W-H, Ye K, Wang Y-L, Zou P-F. Genetic and Pathogenic Characterization of an Iridovirus from the Cultured Largemouth Bass Micropterus salmoides. Fishes. 2024; 9(8):314. https://doi.org/10.3390/fishes9080314

Chicago/Turabian Style

Zhang, Yi-Fan, Ying Li, Peng-Tian Li, Jing Jiang, Wei-Hang Zeng, Kun Ye, Yi-Lei Wang, and Peng-Fei Zou. 2024. "Genetic and Pathogenic Characterization of an Iridovirus from the Cultured Largemouth Bass Micropterus salmoides" Fishes 9, no. 8: 314. https://doi.org/10.3390/fishes9080314

APA Style

Zhang, Y. -F., Li, Y., Li, P. -T., Jiang, J., Zeng, W. -H., Ye, K., Wang, Y. -L., & Zou, P. -F. (2024). Genetic and Pathogenic Characterization of an Iridovirus from the Cultured Largemouth Bass Micropterus salmoides. Fishes, 9(8), 314. https://doi.org/10.3390/fishes9080314

Article Metrics

Back to TopTop