Glucosamine Improves Non-Alcoholic Fatty Liver Disease Induced by High-Fat and High-Sugar Diet through Regulating Intestinal Barrier Function, Liver Inflammation, and Lipid Metabolism
Abstract
:1. Introduction
2. Results
2.1. Changes in Food Intake, Body Weight, Serum Glucose, and Insulin Levels
2.2. GLC Can Improve Serum Lipid Metabolism in NAFLD Mice
2.3. GLC Improves Serum Transaminase Levels as well as Inflammation and Oxidative Function in NAFLD Mice
2.4. GLC Can Improve Liver Lipid Accumulation and Oxidative Function in NAFLD Mice
2.5. The Effect of GLC on Liver Lipid Metabolism at the mRNA Expression Level in NAFLD Mice
2.6. GLC Ameliorates Liver Inflammation in NAFLD Mice through the LPS/TLR4/NF-κB Signaling Pathway
2.7. GLC Improves Gut Barrier Function Composition in NAFLD Mice
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Animals and Experimental Design
4.3. Serum Biochemical Analyses
4.4. Hepatic Biochemical Assays
4.5. ELISA
4.6. Histological Staining
4.7. Quantitative Real-Time PCR
4.8. Western Blotting
4.9. Immunohistochemistry
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Duell, P.B.; Welty, F.K.; Miller, M.; Chait, A.; Hammond, G.; Ahmad, Z.; Cohen, D.E.; Horton, J.D.; Pressman, G.S.; Toth, P.P. Nonalcoholic Fatty Liver Disease and Cardiovascular Risk: A Scientific Statement From the American Heart Association. Arterioscler. Thromb. Vasc. Biol. 2022, 42, e168–e185. [Google Scholar] [CrossRef]
- Friedman, S.L.; Neuschwander-Tetri, B.A.; Rinella, M.; Sanyal, A.J. Mechanisms of NAFLD development and therapeutic strategies. Nat. Med. 2018, 24, 908–922. [Google Scholar] [CrossRef] [PubMed]
- Tilg, H.; Moschen, A.R. Evolution of inflammation in nonalcoholic fatty liver disease: The multiple parallel hits hypothesis. Hepatology 2010, 52, 1836–1846. [Google Scholar] [CrossRef]
- Luo, F.; Smagris, E.; Martin, S.A.; Vale, G.; McDonald, J.G.; Fletcher, J.A.; Burgess, S.C.; Hobbs, H.H.; Cohen, J.C. Hepatic TM6SF2 Is Required for Lipidation of VLDL in a Pre-Golgi Compartment in Mice and Rats. Cell Mol. Gastroenterol. Hepatol. 2022, 13, 879–899. [Google Scholar] [CrossRef]
- Luo, F.; Oldoni, F.; Das, A. TM6SF2: A Novel Genetic Player in Nonalcoholic Fatty Liver and Cardiovascular Disease. Hepatol. Commun. 2022, 6, 448–460. [Google Scholar] [CrossRef] [PubMed]
- Cotter, T.G.; Rinella, M. Nonalcoholic Fatty Liver Disease 2020: The State of the Disease. Gastroenterology 2020, 158, 1851–1864. [Google Scholar] [CrossRef]
- Bechmann, L.P.; Hannivoort, R.A.; Gerken, G.; Hotamisligil, G.S.; Trauner, M.; Canbay, A. The interaction of hepatic lipid and glucose metabolism in liver diseases. J. Hepatol. 2012, 56, 952–964. [Google Scholar] [CrossRef] [PubMed]
- Fisher, S.J.; Kahn, C.R. Insulin signaling is required for insulin’s direct and indirect action on hepatic glucose production. J. Clin. Investig. 2003, 111, 463–468. [Google Scholar] [CrossRef]
- Huh, J.Y.; Saltiel, A.R. Roles of IkappaB kinases and TANK-binding kinase 1 in hepatic lipid metabolism and nonalcoholic fatty liver disease. Exp. Mol. Med. 2021, 53, 1697–1705. [Google Scholar] [CrossRef]
- Suk, K.T.; Kim, D.J. Gut microbiota: Novel therapeutic target for nonalcoholic fatty liver disease. Expert. Rev. Gastroenterol. Hepatol. 2019, 13, 193–204. [Google Scholar] [CrossRef]
- Kolodziejczyk, A.A.; Zheng, D.; Shibolet, O.; Elinav, E. The role of the microbiome in NAFLD and NASH. EMBO Mol. Med. 2019, 11, e9302. [Google Scholar] [CrossRef]
- Nier, A.; Huber, Y.; Labenz, C.; Michel, M.; Bergheim, I.; Schattenberg, J.M. Adipokines and Endotoxemia Correlate with Hepatic Steatosis in Non-Alcoholic Fatty Liver Disease (NAFLD). Nutrients 2020, 12, 699. [Google Scholar] [CrossRef]
- Qiu, S.; Chen, J.; Bai, Y.; He, J.; Cao, H.; Che, Q.; Guo, J.; Su, Z. GOS Ameliorates Nonalcoholic Fatty Liver Disease Induced by High Fat and High Sugar Diet through Lipid Metabolism and Intestinal Microbes. Nutrients 2022, 14, 2749. [Google Scholar] [CrossRef]
- Wong, V.W.; Wong, G.L.; Chan, R.S.; Shu, S.S.; Cheung, B.H.; Li, L.S.; Chim, A.M.; Chan, C.K.; Leung, J.K.; Chu, W.C.; et al. Beneficial effects of lifestyle intervention in non-obese patients with non-alcoholic fatty liver disease. J. Hepatol. 2018, 69, 1349–1356. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.Y.; Sun, D.; Lin, W.S.; Lin, Y.L.; Chao, Y.M.; Chen, S.Y.; Chen, Y.R.; Wu, Y.L. Glucosamine regulation of fibroblast growth factor 21 expression in liver and adipose tissues. Biochem. Biophys. Res. Commun. 2020, 529, 714–719. [Google Scholar] [CrossRef] [PubMed]
- Chiu, H.W.; Li, L.H.; Hsieh, C.Y.; Rao, Y.K.; Chen, F.H.; Chen, A.; Ka, S.M.; Hua, K.F. Glucosamine inhibits IL-1beta expression by preserving mitochondrial integrity and disrupting assembly of the NLRP3 inflammasome. Sci. Rep. 2019, 9, 5603. [Google Scholar] [CrossRef] [PubMed]
- Adebowale, A.; Du, J.; Liang, Z.; Leslie, J.L.; Eddington, N.D. The bioavailability and pharmacokinetics of glucosamine hydrochloride and low molecular weight chondroitin sulfate after single and multiple doses to beagle dogs. Biopharm. Drug Dispos. 2002, 23, 217–225. [Google Scholar] [CrossRef]
- Ibrahim, A.; Gilzad-kohan, M.H.; Aghazadeh-Habashi, A.; Jamali, F. Absorption and bioavailability of glucosamine in the rat. J. Pharm. Sci. 2012, 101, 2574–2583. [Google Scholar] [CrossRef]
- Shmagel, A.; Demmer, R.; Knights, D.; Butler, M.; Langsetmo, L.; Lane, N.; Ensrud, K. The Effects of Glucosamine and Chondroitin Sulfate on Gut Microbial Composition: A Systematic Review of Evidence from Animal and Human Studies. Nutrients 2019, 11, 294. [Google Scholar] [CrossRef]
- Han, C.; Wei, Y.; Wang, X.; Ba, C.; Shi, W. Protective effect of Salvia miltiorrhiza polysaccharides on liver injury in chickens. Poult. Sci. 2019, 98, 3496–3503. [Google Scholar] [CrossRef]
- Todoric, J.; Di Caro, G.; Reibe, S.; Henstridge, D.C.; Green, C.R.; Vrbanac, A.; Ceteci, F.; Conche, C.; McNulty, R.; Shalapour, S.; et al. Fructose stimulated de novo lipogenesis is promoted by inflammation. Nat. Metab. 2020, 2, 1034–1045. [Google Scholar] [CrossRef] [PubMed]
- Rui, L. Energy metabolism in the liver. Compr. Physiol. 2014, 4, 177–197. [Google Scholar] [CrossRef] [PubMed]
- Dam-Larsen, S.; Franzmann, M.; Andersen, I.B.; Christoffersen, P.; Jensen, L.B.; Sorensen, T.I.; Becker, U.; Bendtsen, F. Long term prognosis of fatty liver: Risk of chronic liver disease and death. Gut 2004, 53, 750–755. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhang, Y.; Yang, J.; Li, H.; Wang, J.; Geng, W. Lactobacillus plantarum MA2 Ameliorates Methionine and Choline-Deficient Diet Induced Non-Alcoholic Fatty Liver Disease in Rats by Improving the Intestinal Microecology and Mucosal Barrier. Foods 2021, 10, 3126. [Google Scholar] [CrossRef]
- Su, G.L. Lipopolysaccharides in liver injury: Molecular mechanisms of Kupffer cell activation. Am. J. Physiol. Gastrointest. Liver Physiol. 2002, 283, G256–G265. [Google Scholar] [CrossRef]
- Albillos, A.; de Gottardi, A.; Rescigno, M. The gut-liver axis in liver disease: Pathophysiological basis for therapy. J. Hepatol. 2020, 72, 558–577. [Google Scholar] [CrossRef]
- Leng, Y.R.; Zhang, M.H.; Luo, J.G.; Zhang, H. Pathogenesis of NASH and Promising Natural Products. Chin. J. Nat. Med. 2021, 19, 12–27. [Google Scholar] [CrossRef]
- Ipsen, D.H.; Lykkesfeldt, J.; Tveden-Nyborg, P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell Mol. Life Sci. 2018, 75, 3313–3327. [Google Scholar] [CrossRef]
- Huang, X.; Liu, G.; Guo, J.; Su, Z. The PI3K/AKT pathway in obesity and type 2 diabetes. Int. J. Biol. Sci. 2018, 14, 1483–1496. [Google Scholar] [CrossRef]
- Than, N.N.; Newsome, P.N. A concise review of non-alcoholic fatty liver disease. Atherosclerosis 2015, 239, 192–202. [Google Scholar] [CrossRef]
- Hodson, L.; Gunn, P.J. The regulation of hepatic fatty acid synthesis and partitioning: The effect of nutritional state. Nat. Rev. Endocrinol. 2019, 15, 689–700. [Google Scholar] [CrossRef]
- Kumashiro, N.; Erion, D.M.; Zhang, D.; Kahn, M.; Beddow, S.A.; Chu, X.; Still, C.D.; Gerhard, G.S.; Han, X.; Dziura, J.; et al. Cellular mechanism of insulin resistance in nonalcoholic fatty liver disease. Proc. Natl. Acad. Sci. USA 2011, 108, 16381–16385. [Google Scholar] [CrossRef]
- Wang, G.; Yang, X.; Wang, J.; Zhong, D.; Zhang, R.; Zhang, Y.; Feng, L.; Zhang, Y. Walnut green husk polysaccharides prevent obesity, chronic inflammatory responses, nonalcoholic fatty liver disease and colonic tissue damage in high-fat diet fed rats. Int. J. Biol. Macromol. 2021, 182, 879–898. [Google Scholar] [CrossRef]
- Luci, C.; Vieira, E.; Perchet, T.; Gual, P.; Golub, R. Natural Killer Cells and Type 1 Innate Lymphoid Cells Are New Actors in Non-alcoholic Fatty Liver Disease. Front. Immunol. 2019, 10, 1192. [Google Scholar] [CrossRef] [PubMed]
- Lei, N.; Song, H.; Zeng, L.; Ji, S.; Meng, X.; Zhu, X.; Li, X.; Feng, Q.; Liu, J.; Mu, J. Persistent Lipid Accumulation Leads to Persistent Exacerbation of Endoplasmic Reticulum Stress and Inflammation in Progressive NASH via the IRE1alpha/TRAF2 Complex. Molecules 2023, 28, 3185. [Google Scholar] [CrossRef] [PubMed]
- Xue, J.; Zhao, M.; Liu, Y.; Jia, X.; Zhang, X.; Gu, Q.; Xie, Y.; Qin, S.; Liu, B. Hydrogen inhalation ameliorates hepatic inflammation and modulates gut microbiota in rats with high-fat diet-induced non-alcoholic fatty liver disease. Eur. J. Pharmacol. 2023, 947, 175698. [Google Scholar] [CrossRef]
- Sharifnia, T.; Antoun, J.; Verriere, T.G.; Suarez, G.; Wattacheril, J.; Wilson, K.T.; Peek, R.M., Jr.; Abumrad, N.N.; Flynn, C.R. Hepatic TLR4 signaling in obese NAFLD. Am. J. Physiol. Gastrointest. Liver Physiol. 2015, 309, G270–G278. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.; Wang, Q.; Chang, R.; Zhou, X.; Xu, C. Intestinal Barrier Function-Non-alcoholic Fatty Liver Disease Interactions and Possible Role of Gut Microbiota. J. Agric. Food Chem. 2019, 67, 2754–2762. [Google Scholar] [CrossRef] [PubMed]
- Milosevic, I.; Vujovic, A.; Barac, A.; Djelic, M.; Korac, M.; Radovanovic Spurnic, A.; Gmizic, I.; Stevanovic, O.; Djordjevic, V.; Lekic, N.; et al. Gut-Liver Axis, Gut Microbiota, and Its Modulation in the Management of Liver Diseases: A Review of the Literature. Int. J. Mol. Sci. 2019, 20, 395. [Google Scholar] [CrossRef]
- Tripathi, A.; Debelius, J.; Brenner, D.A.; Karin, M.; Loomba, R.; Schnabl, B.; Knight, R. The gut-liver axis and the intersection with the microbiome. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 397–411. [Google Scholar] [CrossRef]
- An, L.; Wirth, U.; Koch, D.; Schirren, M.; Drefs, M.; Koliogiannis, D.; Niess, H.; Andrassy, J.; Guba, M.; Bazhin, A.V.; et al. The Role of Gut-Derived Lipopolysaccharides and the Intestinal Barrier in Fatty Liver Diseases. J. Gastrointest. Surg. 2022, 26, 671–683. [Google Scholar] [CrossRef] [PubMed]
- Yu, D.; Feng, J.; You, H.; Zhou, S.; Bai, Y.; He, J.; Cao, H.; Che, Q.; Guo, J.; Su, Z. The Microstructure, Antibacterial and Antitumor Activities of Chitosan Oligosaccharides and Derivatives. Mar. Drugs 2022, 20, 69. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer | Reverse Primer |
---|---|---|
ACC | GGCCAGTGCTATGCTGAGAT | AGGGTCAAGTGCTGCTCCA |
CPT1 | AGGACCCTGAGGCATCTATT | ATGACCTCCTGGCATTCTCC |
SREBP1c | GGAGCCATGGATTGCACATT | GGCCCGGGAAGTCACTGT |
PPARγ | TCTCCATGACAGACATGGACA | GTCAGGCTGTTGGTCTCACA |
GADPH | GGGAAGCCCATCACCATCTTC | AGAGGGGCCATCCACAGTCT |
IL-1β | TGGACTTCGCAGCACAAAATG | CACTTCACGCTCTTGGATGA |
IL-6 | AGACCGCTGCCTGTCTAAAA | TTTGATGTCGTTCACCAGGA |
TNF-α | CCCACACCGTCAGCCGATTT | GTCTAAGTACTTGGGCAGATTGACC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, F.; Zhang, Z.; Bai, Y.; Che, Q.; Cao, H.; Guo, J.; Su, Z. Glucosamine Improves Non-Alcoholic Fatty Liver Disease Induced by High-Fat and High-Sugar Diet through Regulating Intestinal Barrier Function, Liver Inflammation, and Lipid Metabolism. Molecules 2023, 28, 6918. https://doi.org/10.3390/molecules28196918
Li F, Zhang Z, Bai Y, Che Q, Cao H, Guo J, Su Z. Glucosamine Improves Non-Alcoholic Fatty Liver Disease Induced by High-Fat and High-Sugar Diet through Regulating Intestinal Barrier Function, Liver Inflammation, and Lipid Metabolism. Molecules. 2023; 28(19):6918. https://doi.org/10.3390/molecules28196918
Chicago/Turabian StyleLi, Feng, Zhengyan Zhang, Yan Bai, Qishi Che, Hua Cao, Jiao Guo, and Zhengquan Su. 2023. "Glucosamine Improves Non-Alcoholic Fatty Liver Disease Induced by High-Fat and High-Sugar Diet through Regulating Intestinal Barrier Function, Liver Inflammation, and Lipid Metabolism" Molecules 28, no. 19: 6918. https://doi.org/10.3390/molecules28196918
APA StyleLi, F., Zhang, Z., Bai, Y., Che, Q., Cao, H., Guo, J., & Su, Z. (2023). Glucosamine Improves Non-Alcoholic Fatty Liver Disease Induced by High-Fat and High-Sugar Diet through Regulating Intestinal Barrier Function, Liver Inflammation, and Lipid Metabolism. Molecules, 28(19), 6918. https://doi.org/10.3390/molecules28196918