Next Article in Journal
Expression and Significance of CD44, CD47 and c-met in Ovarian Clear Cell Carcinoma
Previous Article in Journal
Dietary Polyphenols in Prevention and Treatment of Prostate Cancer
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Predicted Trans-Acting siRNAs in the Human Brain

1
The State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093, China
2
College of Horticulture, Jinling Institute of Technology, Nanjing 210038, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2015, 16(2), 3377-3390; https://doi.org/10.3390/ijms16023377
Submission received: 27 October 2014 / Revised: 10 December 2014 / Accepted: 25 December 2014 / Published: 3 February 2015
(This article belongs to the Section Biochemistry)

Abstract

:
Endogenous small non-coding RNAs play pivotal roles in regulating gene expression in eukaryotes. Many studies have investigated the function and molecular mechanism of microRNAs in the development and disease of various organisms via mRNA repression of protein-coding genes. Recent findings indicate microRNAs might trigger the generation of trans-acting small interfering RNAs (ta-siRNAs). The interaction among different types of small RNA molecules reveals an even more complicated and elaborate pattern of RNA regulation during gene expression than previously thought. We developed a method for mining ta-siRNA sequences and evaluated the performance of our novel method using data from Arabidopsis thaliana. Additionally, using small RNA and degradome data for the human brain, we identified 155 small RNAs that satisfied ta-siRNA characteristics. The DRAXIN and ATCAY genes, which are preferentially expressed in the human brain, were predicted to be the targets of 12 potential ta-siRNAs.

Graphical Abstract

1. Introduction

Endogenous non-coding small RNAs (20–25 nt) that regulate gene expression are important to the growth and development of organisms. Two classes of small RNAs that have been widely studied are microRNAs (miRNAs) and small interfering RNAs (siRNAs). In general, miRNAs are about 21 nt in length, are encoded by eukaryotic nuclear DNA, and are involved in transcriptional and post-transcriptional regulation during gene expression. A given miRNA may have different mRNA targets, and the target mRNA sequence may be subject to regulation by numerous miRNAs. In the nucleus, genes corresponding to a miRNA are transcribed by RNA polymerase II to produce an imperfect, self-complementary, hairpin-loop structure known as Pri-miRNA [1]. The Pri-miRNA structure is cut by Drosha to yield pre-miRNA, which is subsequently transported to the cytoplasm by Exportin 5 and then catalyzed by Dicer to generate a double-stranded fragment known as the miRNA/miRNA* duplex. One of the duplex fragments interacts with the RNA-induced silencing complex to target mRNAs. Some miRNAs inhibit the translation of target genes, and some can cleave target genes between bases 10 and 11 from the 5' end of the miRNA, resulting in two fragments.
The biogenesis of siRNAs and the mechanisms by which they engage in post-transcriptional suppression differ from those of miRNAs. Endogenous siRNAs are generated from inverted or direct repeat sequences [2]. Double-stranded RNAs (dsRNAs) are formed by these repeat sequences—A process initiated by the Dicer enzyme—to form double-stranded RNAs that are about 22 nt and have been designated as siRNAs. One of the strands is subsequently incorporated by the RNA-induced silencing complex and then targets homologous mRNAs for cleavage [3]. In plants and nematodes, some cleaved mRNA fragments might also function as templates for dsRNA synthesis, giving rise to transitive RNA-interfering effects [4,5,6,7,8].
Despite the many differences between miRNAs and siRNAs, they are both induced and processed by proteins during their biogenesis. Peragine et al. [9] and Vazquez et al. [10] identified a third class of small RNA molecules that are now known as trans-acting siRNAs (ta-siRNAs). Their biogenesis is initiated by miRNA-directed cleavage of primary transcripts, thus providing a link between miRNA and siRNA regulation [11,12]. These ta-siRNAs suppress the expression of genes that have little overall resemblance to the genes from which they originated. Two enzymes—RDR6 and SGS3—are essential for the production of ta-siRNAs in Arabidopsis thaliana. The biogenesis of certain ta-siRNAs requires dual miRNA cleavage sites [13]. It has been shown that in some cases miRNAs suppress gene expression by directing the cleavage of transcripts. The resulting RNA fragments are further processed by SGS3 and RDR6 (RdRP) to produce a dsRNA molecule; this is then cleaved by DICER-like 4 (DCL4) to produce an array of 21-nt small RNAs. Of these small RNAs, some can further regulate gene expression in a miRNA-like manner by cooperating with the Argonaute protein; these small RNAs are referred to as ta-siRNAs [11,14,15].
Four TAS gene families have been identified in A. thaliana: TAS1 (TAS1a, TAS1b, TAS1c), TAS2, TAS3 (TAS3a, TAS3b, TAS3c), and TAS4 [11,12,16]. Each TAS gene produces a number of ta-siRNAs that can regulate genes whose functions range from RNA editing to cell fate [17,18]. Ta-siRNAs have also been found in other plants, such as moss [14], rice [19,20], maize [19], grapevine [21], apple [22] and peach [23].
The discovery of ta-siRNA molecules has provided a link between miRNA and siRNA regulation. Ta-siRNAs are able to enhance the impact of miRNAs through tandem cascade amplification effects [24]. One or two miRNAs might have a wide effect on genes that might be completely unrelated to their original targets. Because ta-siRNAs were found to have highly efficient modes of regulation, they could be adopted by a wider range of organisms. In animals, RdRP activity, which is key to the production of ta-siRNAs, has been detected [25]. In addition, we found that many small RNA clusters exist in the mRNA sequence of animals. We believe that these new siRNAs also exist in animals and take part in gene regulation. We propose a pipeline to predict the potential ta-siRNAs based on the biogenesis of ta-siRNAs. In our current study, we identified a series of TAS genes and ta-siRNAs in the human brain through the use of small RNA and degradome datasets.

2. Results and Discussion

2.1. A. thaliana ta-siRNA Prediction Analysis

To evaluate the performance of our ta-siRNA prediction pipeline, mRNA, small RNA and degradome datasets of A. thaliana were used. We identified six ta-siRNAs and seven TAS genes in A. thaliana (Table 1). Different TAS genes can produce similar or identical ta-siRNA sequences, and differing ta-siRNAs can be generated from a single TAS gene. Of the seven TAS genes, four were confirmed to be ta-siRNA-generating loci; the other three have been predicted to be potential TAS genes [24,26]. Two of these three genes are PPR genes, with some PPR genes previously shown to be TAS loci [13,24,26,27,28,29], while some are the targets of ta-siRNAs generated from TAS1 and TAS2. Because of the cascade amplification effect of small RNAs, these might also be TAS gene locations. These results suggest a very high specificity of our prediction pipeline.
Table 1. Prediction results for A. thaliana TAS genes and ta-siRNAs.
Table 1. Prediction results for A. thaliana TAS genes and ta-siRNAs.
Predicted TAS Genes ata-siRNA SequenceTAS Gene Description bReferences
AT1G63400TGATCAAAAGGTCTATApentatricopeptide repeat protein (PPR)Prediction [24,26]
AT1G62930TGATCAAAAGGTCTATARNA processing factor 3, RPF3Prediction [24,30]
AT1G63130TGATCAAAAGGTCTATATetratricopeptide repeat (TPR)-like superfamily proteinTAS2 [9,11,12,13,24,26,27,29,31]
AT1G62910TGATCAAAAGGTCTATApentatricopeptide repeat protein (PPR)Prediction [24,26]
AT1G63150TGTGGAAGTTGCTGTTGpentatricopeptide repeat protein (PPR)TAS2 [13,24,26,28,29]
TGATCTTCAACACAATCpentatricopeptide repeat protein (PPR)TAS2 [13,24,26,28,29]
AT2G39675GTTGCTAATACAGTTACTAS1C; other RNA TAS1C [11,12,24,26,32,33]
TCTAAGTCCAACATAGCTAS1C; other RNA TAS1C [11,12,24,26,32,33]
TTCTAAGTCCAACATAGTAS1C; other RNA TAS1C [11,12,24,26,32,33]
AT2G27400TTCTAAGTCCAACATAGTAS1A; other RNA TAS1A [11,19,26,33,34,35,36,37]
TCTAAGTCCAACATAGCTAS1A; other RNATAS1A [11,19,26,33,34,35,36,37]
a Names of predicted TAS genes are from TAIR; b From TAIR.

2.2. Predicted ta-siRNAs in the Human Brain

Small RNA and degradome datasets for the human brain were used to predict potential ta-siRNAs. Data were pre-processed by discarding small RNAs with fewer than two reads, and discarding degradome sequences with fewer than ten reads. From our prediction pipeline, 365 small RNA clusters were identified. Of these, 155 potential ta-siRNAs belonging to 324 potential TAS genes were predicted. We named the TAS genes after the ensemble transcript ID; for example, if a human TAS gene was at loci ENST00000547850, we named it hsTAS (ENST00000547850), where “hs” indicates Homo sapiens. Some of the predicted TAS genes were uncharacterized protein genes or non-protein coding genes. The other TAS genes were related to an extensive range of metabolic processes, such as vesicle-mediated transport, phosphorylation, phosphate metabolic processes, and ribonucleotide binding. The ta-siRNAs generated from these TAS genes could regulate a wide range of genes and thus have an extensive effect on different aspects of biological processes (Supplementary File 1). The 155 ta-siRNAs are regulated by 13 miRNAs (Supplementary File 2), most of them are poorly conserved in animals. And the predicted targets of these ta-siRNAs were used as search queries in Tissue-specific Gene Expression and Regulation [38,39,40,41]. Two target genes preferentially expressed in the brain were DRAXIN and ATCAY (Table 2 and Figure 1).
Table 2. Uncharacterized TAS genes and ta-siRNAs with specific targets in the human brain.
Table 2. Uncharacterized TAS genes and ta-siRNAs with specific targets in the human brain.
miRNATAS Geneta-siRNA
Ensembl Transcript IDPositionSequenceNo. of Reads
hsa-miR-1972ENST00000547850184GTGCTGGGATTACAGGCGTGAGC3
ENST00000547850280TTTTGAGACGGAGTCTCG2
ENST00000547850304CCCAGGCTGGAGTGCAGTGGC2
ENST00000547850304CCCAGGCTGGAGTGCAGTGG2
ENST00000547850306CAGGCTGGAGTGCAGTGGC4
hsa-miR-5096ENST00000409982785GGTGGATCACCTGAGGTCAGGAGT2
ENST00000409982791TCACCTGAGGTCAGGAGT24
ENST00000409982902ACTTGGGAGGCTGAGGCA2
ENST00000409982904TTGGGAGGCTGAGGCAGGAGAATC2
ENST00000409982904TTGGGAGGCTGAGGCAGGAGAA2
ENST00000409982906GGGAGGCTGAGGCAGGAG3
ENST00000409982907GGAGGCTGAGGCAGGAGAATCGCT2
ENST00000409982915AGGCAGGAGAATCGCTTGAAC2
Figure 1. Ta-siRNAs with specific targets site in brain. (a) ta-siRNAs targeting DRAXIN, TAS1-hsTAS (ENST00000547850); (b) ta-siRNAs targeting ATCAY, TAS2-hsTAS (ENST00000409982). The arrows represent the locations of TAS genes where ta-siRNAs were produced from.
Figure 1. Ta-siRNAs with specific targets site in brain. (a) ta-siRNAs targeting DRAXIN, TAS1-hsTAS (ENST00000547850); (b) ta-siRNAs targeting ATCAY, TAS2-hsTAS (ENST00000409982). The arrows represent the locations of TAS genes where ta-siRNAs were produced from.
Ijms 16 03377 g001

2.3. Murine ta-siRNA Prediction Analysis

To confirm our prediction results in the human brain and study the conservation of ta-siRNAs, we compared our findings with those in mice. Degradome data were obtained for the brain, lungs, liver, kidney, ovary and spleen. Small RNA data were from cultured embryonic stem cells [42]. According to distributions of sequence reads for small RNAs and from the degradome data, we removed small RNAs with fewer than two reads. We identified 1038 small RNA clusters. From these clusters, 77 small RNAs from 499 potential TAS genes were predicted as potential ta-siRNAs. They are regulated by 24 miRNAs (Supplementary File 2). Similar to the situation in human brain, most of them have a weak conservation. The predicted targets of these ta-siRNAs also had an extensive impact on many biological processes, similar to our findings in the human brain (Supplementary File 3).

2.4. Comparison of Human and Murine Predicted ta-siRNAs

The sequencees of three ta-siRNAs in the human brain were similar to a single ta-siRNA in mice (Table 3a). The targets of these ta-siRNAs are related to different aspects of cellular function, such as ion binding, endoplasmic reticulum functions, cell apoptosis, and generation/modification of zinc finger proteins [43,44]. These ta-siRNAs also participate in the FAS and TNFR1 signaling pathways (Table 3b).
Table 3. (a) Similarities of ta-siRNAs in the human brain and mice; (b) Similarity of a mouse ta-siRNA with three human ta-siRNAs.
(a)
(a)
miRNATAS Geneta-siRNA
Ensembl Transcript IDDescriptionPositionSequenceNo. of Reads
hsa-miR-5095ENST00000338352OTU domain containing 6A1382ATTAGCCGGGCGTGGTGGCA2
ENST00000338352OTU domain containing 6A1380AAATTAGCCGGGCGTGGTGGCA2
ENST00000338352OTU domain containing 6A1382ATTAGCCGGGCGTGGTGG3
ENST00000563601no protein product949ATTAGCCGGGCGTGGTGG 3
ENST00000574727no protein product4185ATTAGCCGGGCGTGGTGG3
ENST00000595787iduronate 2-sulfatase5423ATTAGCCGGGCGTGGTGG 3
ENST00000340855iduronate 2-sulfatase5423ATTAGCCGGGCGTGGTGG 3
ENST00000470730no protein product2102ATTAGCCGGGCGTGGTGG3
hsa-miR-5585-3pENST00000586372no protein product2887ATTAGCCGGGCGTGGTGGCA2
ENST00000586372no protein product2885AAATTAGCCGGGCGTGGTGGCA2
ENST00000586372no protein product2887ATTAGCCGGGCGTGGTGG3
ENST00000600661uncharacterized protein1644ATTAGCCGGGCGTGGTGG3
hsa-miR-1285-5pENST00000599386p21 protein (Cdc42/Rac)-activated kinase45587ATTAGCCGGGCGTGGTGG3
(b)
(b)
miRNATAS Geneta-siRNA
Ensembl Transcript IDDescriptionPositionSequenceNo. of Reads
mmu-miR-1186aENSMUST00000151163no protein product586AGCCGGGCGTGGTGGCGC2
ENSMUST00000030080sorting nexin family member 304190AGCCGGGCGTGGTGGCGC2
ENSMUST00000094892interleukin 111112AGCCGGGCGTGGTGGCGC2
mmu-miR-1186bENSMUST00000146029no protein product482AGCCGGGCGTGGTGGCGC2
mmu-miR-3470aENSMUST00000125996no protein product3721AGCCGGGCGTGGTGGCGC2
ENSMUST00000124097no protein product192AGCCGGGCGTGGTGGCGC2
ENSMUST00000143616coenzyme Q4 homolog (yeast)2848AGCCGGGCGTGGTGGCGC2
ENSMUST00000046525kringle containing transmembrane protein 21903AGCCGGGCGTGGTGGCGC2
ENSMUST00000111820Transmembrane protein with metallophosphoesterase domain3083AGCCGGGCGTGGTGGCGC2
ENSMUST00000144897SLX1 structure-specific endonuclease subunit homolog B (S. cerevisiae)1957AGCCGGGCGTGGTGGCGC2
mmu-miR-3470bENSMUST00000179291no protein product1868AGCCGGGCGTGGTGGCGC2
ENSMUST00000168013MAU2 chromatid cohesion factor homolog (C. elegans)4087AGCCGGGCGTGGTGGCGC2
ENSMUST00000050561MAU2 chromatid cohesion factor homolog (C. elegans)4133AGCCGGGCGTGGTGGCGC2
ENSMUST00000142269no protein product4313AGCCGGGCGTGGTGGCGC 2
mmu-miR-1196-5pENSMUST00000121443No protein product458AGCCGGGCGTGGTGGCGC 2
mmu-miR-3473dENSMUST00000098942SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)995AGCCGGGCGTGGTGGCGC 2

2.5. Discussion

The ta-siRNA class of RNA molecules was first identified in A. thaliana. Ta-siRNAs produced from TAS1 and TAS2 transcripts can target PPRs. There are around 450 PPR-related genes in A. thaliana, and these may play a role in RNA editing or binding [45,46]. The PPR genes are also regulated by miR161.1, miR161.2 and miR1427 in rice [20]. TAS4 is generated by miR828 and regulates v-myb avian myeloblastosis viral oncogene homolog (MYB)-related family members, which are also the targets of miR828. To date, three TAS3 loci have been identified in A. thaliana: TAS3a, TAS3b, and TAS3c [26]. These three loci regulate auxin response factors (ARFs; also known as tasiARFs), which are signaling molecules that promote the vegetative development of A. thaliana from the juvenile to the adult stage. Although only four TAS families have been classified, the members of these families have been shown to have remarkable effects on A. thaliana. The generation of ta-siRNAs is initiated by miRNAs, and can target genes in a similar way as miRNAs. Thus, the effects of miRNAs can be amplified, resulting in further regulation of target genes. The majority of plant miRNAs function through mRNA cleavage, and several mammalian miRNAs employ this mechanism of action. The siRNA-like mode of plant miRNAs action may therefore be an ancestral mechanism. In support, miRNA has been found to frequently regulate targets via cleavage in members of the ancient phylum Cnidaria. Therefore, it is possible that miRNAs in plants and animals share a common ancestry and that these ancestral miRNAs act via slicing. Slicing generally has fewer targets and a stronger effect on target silencing than do other modes of miRNA action [47]. miRNA-ta-siRNA functions in a manner similar to slicing, so we suspected that the miRNA-ta-siRNA mechanism may exist in mammals.
The predicted ta-siRNAs identified in this study result from a small number of reads. Studies of Caenorhabditis elegans and Drosophila melanogaster RNAi have revealed the transitive RNAi model, in which dsRNA is amplified to ensure the RNAi response is maintained [7,48,49]. Fire et al. also found that small amounts of dsRNA can effectively initiate gene silencing [50]. Therefore, ta-siRNA molecules could function as a form of transitive RNAi, amplifying the miRNA effect in a manner similar to that identified in plants. We suspect that ta-siRNAs and their trigger miRNAs, which exhibited few reads in humans and mice, may also exhibit biological functions via some amplification mechanisms during the RNAi cascade. However, the miRNA-directed ta-siRNA cleavage pathway is different from that of general RNAi directed by exogenous dsRNA. It is highly controlled and the initiation of RNAi is highly selective.
The protein complex RdRP appears to be an important component in the generation of plant ta-siRNAs. In higher eukaryotes, such as the fly, human, and mouse, the role of RdRP may be performed by various functional homologs [51,52,53,54]. Furthermore, ta-siRNAs can be bound by Argonaute and function as miRNAs. To assess Argonaute-bound ta-siRNAs, a dataset from mice was used [55]. Of the 77 predicted ta-siRNAs in mice, 12 are in the Argonaute-bound small RNA dataset (Supplementary File 4). This data further support our claim of the existence of mammal ta-siRNAs.
In plants, some ta-siRNAs are from the 21-nt phase positions on the transcripts cleaved by miRNAs, such as ta-siRNAs arising from the TAS1 loci in A. thaliana [11]. However, some ta-siRNAs are from “non-phased” positions on transcripts, such as those from the TAS3 loci in Vitis vinifera [56]. Our prediction pipeline includes both “phased” and “non-phased” situations to achieve better prediction results.
Although research into ta-siRNAs is not as popular as miRNA research, their importance in regulating the relationship between miRNAs and mRNAs is crucial. There are many ta-siRNA-related mechanisms and functions that remain unclear, and are thus potential avenues of future research. Understanding more about ta-siRNAs would likely help us better understand miRNAs and siRNAs, and their interactions. The prediction pipeline we have designed offers a new method to identify potential ta-siRNAs, which could be applied to future studies.

3. Experimental Section

3.1. Datasets and Tools

Small RNA datasets sequenced by Illumina, and degradome datasets were downloaded from the Gene Expression Omnibus repository (http://www.ncbi.nlm.nih.gov/gds, Supplementary File 5). The miRNA sequences were downloaded from miRbase (release 19) and cDNA sequences were from Ensembl (release 69). Bowtie [57], RNAhybrid [58] and BLASTn [59] were integrated into our prediction pipeline.

3.2. Prediction Flow

The principle of prediction is based on the generating process of ta-siRNAs found in plants. The binding sites of human miRNAs on mRNAs were predicted through an imperfect complementary match. RNAhybrid was then used to find the minimum free energy for the hybridization of miRNAs with the potential target mRNAs. According to previous studies [60], the free energy of a microRNA:mRNA duplex below −25 kcal/mol would be a relatively stringent threshold value. Therefore, sites with less than −25 kcal/mol energy were viewed as potential miRNA targets.
The Illumina small RNAs were mapped to mRNA sequences to determine small RNA clusters. According to the mechanism described above, ta-siRNA features a cluster of small RNAs that are derived from the same TAS gene. An mRNA region with at least three small RNA hits and a maximum distance of 100 nt between hits was considered a small RNA cluster [61]. The predicted targets of miRNAs were used to screen small RNA clusters for ta-siRNA candidates.
The degradome dataset was used to further ensure the accuracy of our predictions. The targets of small RNAs in the clusters (ta-siRNA candidates) were predicted because ta-siRNAs can amplify tandem cascades with respect to miRNA functions. We used the same parameters that were employed for miRNA target prediction. If fragments cleaved by the ta-siRNA candidate matched the sequence from the degradome data, it was regarded as a potential ta-siRNA. The whole prediction flow is shown in Figure 2.

3.3. Model Assessment

We used known A. thaliana TAS genes to evaluate the performance of our prediction pipeline. The mRNA sequences of the relevant A. thaliana TAS genes were from The Arabidopsis Information Resource (TAIR; http://www.arabidopsis.org/). We downloaded the small RNA data from Arabidopsis MPSS Plus [62,63], while the degradome data were downloaded from the Gene Expression Omnibus database.

3.4. Conservation of ta-siRNAs between Human and Mouse

To investigate the conservation of ta-siRNAs between mice and humans, we predicted murine ta-siRNAs using our pipeline and compared them with known human ta-siRNAs.
Figure 2. (a) Schematic of our ta-siRNA prediction pipeline; (b) Generation of ta-siRNAs.
Figure 2. (a) Schematic of our ta-siRNA prediction pipeline; (b) Generation of ta-siRNAs.
Ijms 16 03377 g002

4. Conclusions

Based on the process by which ta-siRNAs are generated, we designed a prediction pipeline to identify novel ta-siRNAs in humans. As the research continues, many new characteristics of miRNAs have been shown. In our algorithm, we designed a new method to predict the targets of miRNAs. The differences between our method and other target prediction tools are: (1) we do not require the conservation of mRNAs; (2) the targets of miRNAs are not restricted to the 3' UTR; (3) the “seed” sequence can be 1–7 nts. The criteria for target prediction were set based on miRNA properties and experimental experiences. The binding energy of miRNA to its target was below −25 kcal/mol and the least continuous match was 7 bp based on the “seed sequence” of miRNAs. Our prediction pipeline was first applied to A. thaliana to estimate its accuracy. Seven ta-siRNAs were predicted, of which four were known ta-siRNAs with the remaining three were predicted by other algorithms. Our prediction results in A. thaliana were highly specific. When our prediction analysis was applied to humans, we identified 324 potential TAS genes and 155 potential ta-siRNAs. In mice, 499 potential TAS genes and 77 potential ta-siRNAs were identified. Among these predicted ta-siRNAs, three ta-siRNAs in humans were similar to a single ta-siRNA in mice. The trigger miRNAs of ta-siRNAs predicted in human brain and mice are also poorly conserved. These findings suggest that ta-siRNAs are weakly conserved, which is in accordance with a recent finding that non-coding genes exhibit relatively low levels of conservation [64].

Supplementary Materials

Supplementary files can be found at https://www.mdpi.com/1422-0067/16/02/3377/s1.

Acknowledgments

This work was supported by the National Science Foundation of China (Grant No. J1103512 and 31171273). The authors would acknowledge the Center of High Performance Computation of Nanjing University for the support of computational resources. This project was partly supported by the Funding from NJU-Yangzhou Institute of Optoelectronics.

Author Contributions

Xiaoshuang Liu performed the research and wrote the manuscript. Guangxin Zhang and Changqing Zhang contributed to the study design. Jin Wang supervised the work. All authors have read and approved the final manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Allen, E.; Howell, M.D. miRNAs in the biogenesis of trans-acting siRNAs in higher plants. Semin. Cell Dev. Biol. 2010, 21, 798–804. [Google Scholar] [CrossRef] [PubMed]
  2. Slotkin, R.K.; Martienssen, R. Transposable elements and the epigenetic regulation of the genome. Nat. Rev. Genet. 2007, 8, 272–285. [Google Scholar] [CrossRef] [PubMed]
  3. Hannon, G.J. RNA interference. Nature 2002, 418, 244–251. [Google Scholar] [CrossRef] [PubMed]
  4. Cogoni, C.; Macino, G. Gene silencing in Neurospora crassa requires a protein homologous to RNA-dependent RNA polymerase. Nature 1999, 399, 166–169. [Google Scholar] [CrossRef] [PubMed]
  5. Dalmay, T.; Hamilton, A.; Rudd, S.; Angell, S.; Baulcombe, D.C. An RNA-dependent RNA polymerase gene in Arabidopsis is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell 2000, 101, 543–553. [Google Scholar] [CrossRef] [PubMed]
  6. Mourrain, P.; Beclin, C.; Elmayan, T.; Feuerbach, F.; Godon, C.; Morel, J.B.; Jouette, D.; Lacombe, A.M.; Nikic, S.; Picault, N.; et al. Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell 2000, 101, 533–542. [Google Scholar] [CrossRef] [PubMed]
  7. Sijen, T.; Fleenor, J.; Simmer, F.; Thijssen, K.L.; Parrish, S.; Timmons, L.; Plasterk, R.H.; Fire, A. On the role of RNA amplification in dsRNA-triggered gene silencing. Cell 2001, 107, 465–476. [Google Scholar] [CrossRef] [PubMed]
  8. Smardon, A.; Spoerke, J.M.; Stacey, S.C.; Klein, M.E.; Mackin, N.; Maine, E.M. EGO-1 is related to RNA-directed RNA polymerase and functions in germ-line development and RNA interference in C. elegans. Curr. Biol. 2000, 10, 169–178. [Google Scholar] [CrossRef] [PubMed]
  9. Peragine, A.; Yoshikawa, M.; Wu, G.; Albrecht, H.L.; Poethig, R.S. SGS3 and SGS2/SDE1/RDR6 are required for juvenile development and the production of trans-acting siRNAs in Arabidopsis. Genes Dev. 2004, 18, 2368–2379. [Google Scholar] [CrossRef] [PubMed]
  10. Vazquez, F.; Vaucheret, H.; Rajagopalan, R.; Lepers, C.; Gasciolli, V.; Mallory, A.C.; Hilbert, J.L.; Bartel, D.P.; Crete, P. Endogenous trans-acting siRNAs regulate the accumulation of Arabidopsis mRNAs. Mol. Cell 2004, 16, 69–79. [Google Scholar] [CrossRef] [PubMed]
  11. Allen, E.; Xie, Z.; Gustafson, A.M.; Carrington, J.C. microRNA-directed phasing during trans-acting siRNA biogenesis in plants. Cell 2005, 121, 207–221. [Google Scholar] [CrossRef] [PubMed]
  12. Yoshikawa, M.; Peragine, A.; Park, M.Y.; Poethig, R.S. A pathway for the biogenesis of trans-acting siRNAs in Arabidopsis. Genes Dev. 2005, 19, 2164–2175. [Google Scholar] [CrossRef] [PubMed]
  13. Axtell, M.J.; Jan, C.; Rajagopalan, R.; Bartel, D.P. A two-hit trigger for siRNA biogenesis in plants. Cell 2006, 127, 565–577. [Google Scholar] [CrossRef] [PubMed]
  14. Talmor-Neiman, M.; Stav, R.; Klipcan, L.; Buxdorf, K.; Baulcombe, D.C.; Arazi, T. Identification of trans-acting siRNAs in moss and an RNA-dependent RNA polymerase required for their biogenesis. Plant J. Cell Mol. Biol. 2006, 48, 511–521. [Google Scholar] [CrossRef]
  15. Xie, Z.; Qi, X. Diverse small RNA-directed silencing pathways in plants. Biochim. Biophys. Acta 2008, 1779, 720–724. [Google Scholar] [CrossRef] [PubMed]
  16. Rajagopalan, R.; Vaucheret, H.; Trejo, J.; Bartel, D.P. A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana. Genes Dev. 2006, 20, 3407–3425. [Google Scholar] [CrossRef] [PubMed]
  17. Mach, J. Chloroplast RNA editing by pentatricopeptide repeat proteins. Plant Cell 2009, 21. [Google Scholar] [CrossRef] [PubMed]
  18. Stracke, R.; Werber, M.; Weisshaar, B. The R2R3-MYB gene family in Arabidopsis thaliana. Curr. Opin. Plant Biol. 2001, 4, 447–456. [Google Scholar] [CrossRef] [PubMed]
  19. Williams, L.; Carles, C.C.; Osmont, K.S.; Fletcher, J.C. A database analysis method identifies an endogenous trans-acting short-interfering RNA that targets the Arabidopsis ARF2, ARF3, and ARF4 genes. Proc. Nat. Acad. Sci. USA 2005, 102, 9703–9708. [Google Scholar] [CrossRef] [PubMed]
  20. Heisel, S.E.; Zhang, Y.; Allen, E.; Guo, L.; Reynolds, T.L.; Yang, X.; Kovalic, D.; Roberts, J.K. Characterization of unique small RNA populations from rice grain. PLoS One 2008, 3, e2871. [Google Scholar] [CrossRef] [PubMed]
  21. Zhang, C.; Li, G.; Wang, J.; Fang, J. Identification of trans-acting siRNAs and their regulatory cascades in grapevine. Bioinformatics 2012, 28, 2561–2568. [Google Scholar] [CrossRef] [PubMed]
  22. Xia, R.; Zhu, H.; An, Y.Q.; Beers, E.P.; Liu, Z. Apple miRNAs and tasiRNAs with novel regulatory networks. Genome Biol. 2012, 13. [Google Scholar] [CrossRef]
  23. Zhu, H.; Xia, R.; Zhao, B.; An, Y.Q.; Dardick, C.D.; Callahan, A.M.; Liu, Z. Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs. BMC Plant Biol. 2012, 12. [Google Scholar] [CrossRef] [PubMed]
  24. Chen, H.M.; Li, Y.H.; Wu, S.H. Bioinformatic prediction and experimental validation of a microRNA-directed tandem trans-acting siRNA cascade in Arabidopsis. Proc. Natl. Acad. Sci. USA 2007, 104, 3318–3323. [Google Scholar] [CrossRef] [PubMed]
  25. Tuschl, T.; Borkhardt, A. Small interfering RNAs: A revolutionary tool for the analysis of gene function and gene therapy. Mol. Interv. 2002, 2, 158–167. [Google Scholar] [CrossRef] [PubMed]
  26. Howell, M.D.; Fahlgren, N.; Chapman, E.J.; Cumbie, J.S.; Sullivan, C.M.; Givan, S.A.; Kasschau, K.D.; Carrington, J.C. Genome-wide analysis of the RNA-DEPENDENT RNA POLYMERASE6/DICER-LIKE4 pathway in Arabidopsis reveals dependency on miRNA- and tasiRNA-directed targeting. Plant Cell 2007, 19, 926–942. [Google Scholar] [CrossRef] [PubMed]
  27. Allen, E.; Xie, Z.; Gustafson, A.M.; Sung, G.H.; Spatafora, J.W.; Carrington, J.C. Evolution of microRNA genes by inverted duplication of target gene sequences in Arabidopsis thaliana. Nat. Genet. 2004, 36, 1282–1290. [Google Scholar] [CrossRef] [PubMed]
  28. Colinas, J.; Schmidler, S.C.; Bohrer, G.; Iordanov, B.; Benfey, P.N. Intergenic and genic sequence lengths have opposite relationships with respect to gene expression. PLoS One 2008, 3, e3670. [Google Scholar] [CrossRef] [PubMed]
  29. Geddy, R.; Brown, G.G. Genes encoding pentatricopeptide repeat (PPR) proteins are not conserved in location in plant genomes and may be subject to diversifying selection. BMC Genomics 2007, 8. [Google Scholar] [CrossRef] [PubMed]
  30. Quatrini, R.; Lefimil, C.; Veloso, F.A.; Pedroso, I.; Holmes, D.S.; Jedlicki, E. Bioinformatic prediction and experimental verification of Fur-regulated genes in the extreme acidophile Acidithiobacillus ferrooxidans. Nucleic Acids Res. 2007, 35, 2153–2166. [Google Scholar] [CrossRef] [PubMed]
  31. Lobbes, D.; Rallapalli, G.; Schmidt, D.D.; Martin, C.; Clarke, J. SERRATE: A new player on the plant microRNA scene. EMBO Rep. 2006, 7, 1052–1058. [Google Scholar] [CrossRef] [PubMed]
  32. Montgomery, T.A.; Yoo, S.J.; Fahlgren, N.; Gilbert, S.D.; Howell, M.D.; Sullivan, C.M.; Alexander, A.; Nguyen, G.; Allen, E.; Ahn, J.H.; et al. AGO1-miR173 complex initiates phased siRNA formation in plants. Proc. Natl. Acad. Sci. USA 2008, 105, 20055–20062. [Google Scholar] [CrossRef] [PubMed]
  33. Rajeswaran, R.; Aregger, M.; Zvereva, A.S.; Borah, B.K.; Gubaeva, E.G.; Pooggin, M.M. Sequencing of RDR6-dependent double-stranded RNAs reveals novel features of plant siRNA biogenesis. Nucleic Acids Res. 2012, 40, 6241–6254. [Google Scholar] [CrossRef] [PubMed]
  34. Dal Bosco, C.; Lezhneva, L.; Biehl, A.; Leister, D.; Strotmann, H.; Wanner, G.; Meurer, J. Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. J. Biol. Chem. 2004, 279, 1060–1069. [Google Scholar] [CrossRef] [PubMed]
  35. Dunoyer, P.; Himber, C.; Voinnet, O. DICER-LIKE 4 is required for RNA interference and produces the 21-nucleotide small interfering RNA component of the plant cell-to-cell silencing signal. Nat. Genet. 2005, 37, 1356–1360. [Google Scholar] [CrossRef]
  36. Willmann, M.R.; Endres, M.W.; Cook, R.T.; Gregory, B.D. The Functions of RNA-Dependent RNA Polymerases in Arabidopsis. Arabidopsis Book Am. Soc. Plant Biol. 2011, 9. [Google Scholar] [CrossRef]
  37. Zhang, X.; Yuan, Y.R.; Pei, Y.; Lin, S.S.; Tuschl, T.; Patel, D.J.; Chua, N.H. Cucumber mosaic virus-encoded 2b suppressor inhibits Arabidopsis Argonaute1 cleavage activity to counter plant defense. Genes Dev. 2006, 20, 3255–3268. [Google Scholar] [CrossRef] [PubMed]
  38. Liu, X.; Yu, X.; Zack, D.J.; Zhu, H.; Qian, J. TiGER: A database for tissue-specific gene expression and regulation. BMC Bioinform. 2008, 9. [Google Scholar] [CrossRef]
  39. Yu, X.; Lin, J.; Masuda, T.; Esumi, N.; Zack, D.J.; Qian, J. Genome-wide prediction and characterization of interactions between transcription factors in Saccharomyces cerevisiae. Nucleic Acids Res. 2006, 34, 917–927. [Google Scholar] [CrossRef] [PubMed]
  40. Yu, X.; Lin, J.; Zack, D.J.; Qian, J. Computational analysis of tissue-specific combinatorial gene regulation: Predicting interaction between transcription factors in human tissues. Nucleic Acids Res. 2006, 34, 4925–4936. [Google Scholar] [CrossRef] [PubMed]
  41. Yu, X.; Lin, J.; Zack, D.J.; Qian, J. Identification of tissue-specific cis-regulatory modules based on interactions between transcription factors. BMC Bioinform. 2007, 8. [Google Scholar] [CrossRef]
  42. Babiarz, J.E.; Ruby, J.G.; Wang, Y.; Bartel, D.P.; Blelloch, R. Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs. Genes Dev. 2008, 22, 2773–2785. [Google Scholar] [CrossRef] [PubMed]
  43. Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef] [PubMed]
  44. Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Bioinformatics enrichment tools: Paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 2009, 37, 1–13. [Google Scholar] [CrossRef] [PubMed]
  45. Saha, D.; Prasad, A.M.; Srinivasan, R. Pentatricopeptide repeat proteins and their emerging roles in plants. Plant Physiol. Biochem. 2007, 45, 521–534. [Google Scholar] [CrossRef] [PubMed]
  46. Lurin, C.; Andres, C.; Aubourg, S.; Bellaoui, M.; Bitton, F.; Bruyere, C.; Caboche, M.; Debast, C.; Gualberto, J.; Hoffmann, B.; et al. Genome-wide analysis of Arabidopsis pentatricopeptide repeat proteins reveals their essential role in organelle biogenesis. Plant Cell 2004, 16, 2089–2103. [Google Scholar] [CrossRef] [PubMed]
  47. Moran, Y.; Fredman, D.; Praher, D.; Li, X.Z.; Wee, L.M.; Rentzsch, F.; Zamore, P.D.; Technau, U.; Seitz, H. Cnidarian microRNAs frequently regulate targets by cleavage. Genome Res. 2014, 24, 651–663. [Google Scholar] [CrossRef] [PubMed]
  48. Alder, M.N.; Dames, S.; Gaudet, J.; Mango, S.E. Gene silencing in Caenorhabditis elegans by transitive RNA interference. RNA 2003, 9, 25–32. [Google Scholar] [CrossRef] [PubMed]
  49. Lipardi, C.; Wei, Q.; Paterson, B.M. RNAi as random degradative PCR: siRNA primers convert mRNA into dsRNAs that are degraded to generate new siRNAs. Cell 2001, 107, 297–307. [Google Scholar] [CrossRef] [PubMed]
  50. Fire, A.; Xu, S.; Montgomery, M.K.; Kostas, S.A.; Driver, S.E.; Mello, C.C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998, 391, 806–811. [Google Scholar] [CrossRef] [PubMed]
  51. Lehmann, E.; Brueckner, F.; Cramer, P. Molecular basis of RNA-dependent RNA polymerase II activity. Nature 2007, 450, 445–449. [Google Scholar] [CrossRef] [PubMed]
  52. Lipardi, C.; Paterson, B.M. Identification of an RNA-dependent RNA polymerase in Drosophila involved in RNAi and transposon suppression. Proc. Natl. Acad. Sci. USA 2009, 106, 15645–15650. [Google Scholar] [CrossRef] [PubMed]
  53. Maida, Y.; Yasukawa, M.; Furuuchi, M.; Lassmann, T.; Possemato, R.; Okamoto, N.; Kasim, V.; Hayashizaki, Y.; Hahn, W.C.; Masutomi, K. An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. Nature 2009, 461, 230–235. [Google Scholar] [CrossRef] [PubMed]
  54. Pelczar, H.; Woisard, A.; Lemaitre, J.M.; Chachou, M.; Andeol, Y. Evidence for an RNA polymerization activity in axolotl and Xenopus egg extracts. PLoS One 2010, 5, e14411. [Google Scholar] [CrossRef] [PubMed]
  55. Zamudio, J.R.; Kelly, T.J.; Sharp, P.A. Argonaute-bound small RNAs from promoter-proximal RNA polymerase II. Cell 2014, 156, 920–934. [Google Scholar] [CrossRef] [PubMed]
  56. Zhang, C.Q.; Li, G.P.; Wang, J.; Zhu, S.N.; Li, H.L. Cascading cis-cleavage on transcript from trans-acting siRNA-producing locus 3. Int. J. Mol. Sci. 2013, 14, 14689–14699. [Google Scholar] [CrossRef] [PubMed]
  57. Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10. [Google Scholar] [CrossRef]
  58. Rehmsmeier, M.; Steffen, P.; Hochsmann, M.; Giegerich, R. Fast and effective prediction of microRNA/target duplexes. RNA 2004, 10, 1507–1517. [Google Scholar] [CrossRef] [PubMed]
  59. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
  60. Miranda, K.C.; Huynh, T.; Tay, Y.; Ang, Y.S.; Tam, W.L.; Thomson, A.M.; Lim, B.; Rigoutsos, I. A pattern-based method for the identification of MicroRNA binding sites and their corresponding heteroduplexes. Cell 2006, 126, 1203–1217. [Google Scholar] [CrossRef] [PubMed]
  61. Johnson, C.; Kasprzewska, A.; Tennessen, K.; Fernandes, J.; Nan, G.L.; Walbot, V.; Sundaresan, V.; Vance, V.; Bowman, L.H. Clusters and superclusters of phased small RNAs in the developing inflorescence of rice. Genome Res. 2009, 19, 1429–1440. [Google Scholar] [CrossRef] [PubMed]
  62. Meyers, B.C.; Tej, S.S.; Vu, T.H.; Haudenschild, C.D.; Agrawal, V.; Edberg, S.B.; Ghazal, H.; Decola, S. The use of MPSS for whole-genome transcriptional analysis in Arabidopsis. Genome Res. 2004, 14, 1641–1653. [Google Scholar] [CrossRef] [PubMed]
  63. Meyers, B.C.; Galbraith, D.W.; Nelson, T.; Agrawal, V. Methods for transcriptional profiling in plants. Be fruitful and replicate. Plant Physiol. 2004, 135, 637–652. [Google Scholar] [CrossRef] [PubMed]
  64. Ezkurdia, I.; Juan, D.; Rodriguez, J.M.; Frankish, A.; Diekhans, M.; Harrow, J.; Vazquez, J.; Valencia, A.; Tress, M.L. Multiple evidence strands suggest that there may be as few as 19,000 human protein-coding genes. Hum. Mol. Genet. 2014, 23, 5866–5878. [Google Scholar] [CrossRef] [PubMed]

Share and Cite

MDPI and ACS Style

Liu, X.; Zhang, G.; Zhang, C.; Wang, J. Predicted Trans-Acting siRNAs in the Human Brain. Int. J. Mol. Sci. 2015, 16, 3377-3390. https://doi.org/10.3390/ijms16023377

AMA Style

Liu X, Zhang G, Zhang C, Wang J. Predicted Trans-Acting siRNAs in the Human Brain. International Journal of Molecular Sciences. 2015; 16(2):3377-3390. https://doi.org/10.3390/ijms16023377

Chicago/Turabian Style

Liu, Xiaoshuang, Guangxin Zhang, Changqing Zhang, and Jin Wang. 2015. "Predicted Trans-Acting siRNAs in the Human Brain" International Journal of Molecular Sciences 16, no. 2: 3377-3390. https://doi.org/10.3390/ijms16023377

APA Style

Liu, X., Zhang, G., Zhang, C., & Wang, J. (2015). Predicted Trans-Acting siRNAs in the Human Brain. International Journal of Molecular Sciences, 16(2), 3377-3390. https://doi.org/10.3390/ijms16023377

Article Metrics

Back to TopTop