1. Introduction
Human lung cancer is highly invasive and most malignant among human tumors, which is classified into non-small cell lung cancer and small cell lung cancer. Non-small cell lung cancer accounts for about 85% of lung cancers and the current therapeutic strategy includes surgical resection together with radiation and/or chemo-treatment. Radiation resistance is the severe outcome of lung cancer radiotherapy and therefore poses a critical barrier for the radio-therapeutic effect. Hence, how to avoid the radiation resistance and to improve its treatment efficiency is a major challenge [
1,
2].
Ionizing radiation initiates DNA damage and arrests cell cycle progression, leading to cellular genomic instability and loss of genetic information. In response to the damage stress, the ataxia telangiectasia mutated kinase (ATM) and ataxia telangiectasia and Rad3-related protein (ATR) are activated. ATM and ATR can also engage in cell division control via activating cyclins and cyclin-dependent kinases (Cdks) [
3,
4]. A recent study found that in the cell division, there is a very important cytokinetic abscission checkpoint regulated by CHMP4C, which controls abscission time to coordinate mid-body resolution and prevents accumulation of DNA damage. CHMP4C can check the abscission timing through Aurora B-directed phosphorylation [
5].
Aurora B kinase is the key kinase of CPC (Chromosomal Passenger Complex) essential for the mitotic processes. Aurora B expression and activity are altered during the cell cycle and peaks at the G2-M transition. Aurora B is elevated in a variety of human tumors and its over-expression is susceptible to tumor formation and poor outcomes of non-small cell lung cancer radiotherapy, therefore indicating that Aurora B might be a drug target for lung cancer [
6,
7,
8]. However, whether Aurora B directly participates in lung cancer development is still unknown.
That ESCRT (Endosomal sorting complex) is required for the CPC (Chromosomal passenger complex)-mediated cytokinetic abscission, during which CPC monitors the right abscission time of two daughter cells. ESCRT has six distinct complexes (containing ESCRT-0, -I, -II, -III, ALIX and Vps4) engaging in multi-vesicular body formation, cytokinesis and HBV (Hepatitis B virus) budding [
9,
10,
11]. ESCRT-III (Endosome sorting complex-III) mediates membrane fission at the end of cytokinesis. A recent study reported that CHMP4C, a subunit of ESCRT-III, retards abscission and inhibits DNA damage accumulation in abscission checkpoint [
12,
13,
14,
15]. Meanwhile, CHMP4C enhances autophagy and endosome production, during which p53 transcriptionally regulates CHMP4C via binding the CHMP4C promoter from −512~−450 DNA sequence in response to stress [
16,
17]. As the common target of Aurora B and p53, CHMP4C has lower expression in normal tissues and high expression in cancers [
18]. Overall, despite CHMP4C is involved in abscission checkpoint and autophagy, how it serves its function in DNA damage response as well as in lung cancer formation still remains unclear.
In the study, we first demonstrate that the subunit of ESCRT-III CHMP4C is involved in cellular radiation reactions. Radiation enhances Aurora B expression and CHMP4C phosphorylation in NSCLC cells, collectively directing cell cycle check-point and promoting cell survival. CHMP4C silencing increases cellular sensitivity to radiation, hinders S-phase progression in cell cycle and diminishes ionizing radiation (IR)-triggered γH2AX foci formation. We show that CHMP4C is the major target of Aurora B and has a similar effect with Aurora B upon radiation. We further reveal that the phosphorylation level of CHMP4C is rising both in p53-positive and-negative cells, showing that the close correlation between CHMP4C and Aurora B signaling pathway in mediating radiation resistance is not p53 dependent. Overall, our work discovers a novel action of CHMP4C in radiation resistance, suggesting CHMP4C as a new drug target for non-small cell lung cancer treatments.
3. Discussion
Current investigations on CHMP4C mainly focus its function on endosome generation. However, whether and how it serves its part in cell cycle, viability and apoptosis under irradiation is not clear. It has been reported that p53 regulates transcription of CHMP4C in the autophagy and endosome production [
16]. p53 plays a critical role in regulating DNA-damage-associated cell cycle progression, DNA repair, or apoptosis in the p53/p21 pathway. As the classic target gene of p53, p21 regulates the cyclin-Cdk and PCNA complexes required for the G
1 to S transition [
19,
20,
21]. We then supposed that they might have similar function in p53-directed cell cycle switch. In support of this hypothesis, our results indicated that CHMP4C knockdown was engaged in cellular S-phase delay, showing the similar regulation with p21 in cell cycle progression in A549. Moreover, double knockdown of CHMP4C and p21 produced an additive effect in S-phase delay of the cell cycle. However, CHMP4C knockdown has no influence on p21 expression and p21 depletion cannot effect CHMP4C expression, which reveals that the novel role of CHMP4C in cell cycle shows an alternative pathway paralleling the p21 signal pathway (
Figure 9).
Figure 9.
The summary of CHMP4C signaling in response to stress. CHMP4C is phosphorylated by Aurora B to regulate the abscission timing checkpoint and cell cycle progression, promote cell survival and cell viability and resist apoptosis (Blue arrows). The ataxia telangiectasia mutated kinase (ATM) is activated in mitosis in Aurora B-dependent manner (Green arrows). p53 transcriptionally regulates CHMP4C to enhance autophagy and endosome production (Red arrows). p21 is the target gene of p53 and functions in the G1 to S checkpoint (Green arrows).
Figure 9.
The summary of CHMP4C signaling in response to stress. CHMP4C is phosphorylated by Aurora B to regulate the abscission timing checkpoint and cell cycle progression, promote cell survival and cell viability and resist apoptosis (Blue arrows). The ataxia telangiectasia mutated kinase (ATM) is activated in mitosis in Aurora B-dependent manner (Green arrows). p53 transcriptionally regulates CHMP4C to enhance autophagy and endosome production (Red arrows). p21 is the target gene of p53 and functions in the G1 to S checkpoint (Green arrows).
Further, our results also showed that CHMP4C can promote cell survival and cell viability upon IR, indicating that CHMP4C offer the radioresistance to the irradiated cells. We next studied if CHMP4C was connected with DNA repair, and found that CHMP4C inhibition repressed DNA repair by decreasing γH2AX and 53BP1 foci reacting to radiation stress. Hence, the novel functions of CHMP4C in cell cycle control and DNA repair not only enriches the content of the DNA damage pathway but also extends its specific role in cell regulation.
p53 is often mutated in NSCLC and its mutation increases sensitivity to ionizing radiation in tumor cells [
22]. CHMP4C transcription is controlled by p53 in endosome function [
16]. CHMP4C functions in the Aurora B-dependent abscission checkpoint and inhibits abscission upon phosphorylation by Aurora B, eventually preventing premature resolution of intercellular chromosome bridges and DNA damage accumulation. Our results reveal that increased Aurora B kinase enhances the CHMP4C phosphorylation after IR, which is independent of p53. This is also supported by the facts that the cell lines displayed higher sensitivities to IR after CHMP4C inhibition compared to IR alone, and CHMP4C can increase cell survival both in A549 and H1299 cells.
Several Aurora kinase inhibitors are tested in clinical trials [
23]. Studies have shown that inhibition of Aurora B radiosensitizes tumor cells [
6,
7]. In the study, we observed the reduction of CHMP4C protein level but its mRNA expression remains unchanged following silencing of Aurora B, revealing that Aurora B might regulate the CHMP4C protein stability. Inhibited Aurora kinase B activity by AZD1152 suppresses CHMP4C phosphorylation. However, overexpression of Aurora kinase B upregulates CHMP4C phosphorylation because of the large amount of Aurora B proteins. Furthermore, CHMP4C suppression also radiosensitizes NSCLC cells similar to that during Aurora B inhibition. We demonstrate that Aurora B kinase is essential to phosphorylate CHMP4C and the role of CHMP4C in radioresistance is dependent on Aurora B, which proves that CHMP4C is the major downstream target of Aurora B. Therefore, we identify the close relation between CHMP4C and Aurora B signaling pathway in mediating radiation resistance in NSCLC cells, which is independent on p53.
CHMP4C can check the cytokinetic abscission to prevent premature and accumulated DNA damage as an abscission timer. CHMP4C deficiency generates the defective abscission check, which makes injured cells quickly pass through M to S phase, leading to DNA repair disability and genomic instability. These data suggests that CHMP4C deficiency disorganizes the cell cycle and enhances cell sensitivity to radiation, thus providing a new combined strategy to diagnosis and treatment of the lung cancer.
We propose that ATM is activated by Aurora B, followed by p53-mediated activation of CHMP4C. In turn, CHMP4C promotes cell viability and proliferation. However, there is another major tumor suppressor factor, the alternative reading frame (ARF), which is negatively regulated by ATM in a transcription-independent manner. Contrary to the function of CHMP4C on cell fate, inhibition of ATM enhances ARF levels and stimulates the tumor-suppressive effects of ARF in human oncogene-transformed and cancer cells [
24]. These findings provide insights into our study and broaden the aspects of our further research.
4. Materials and Methods
4.1. Cell Culture and Irradiation
The human NSCLC cell lines A549 (p53 wild type) and H1299 (p53 deficient) (Cell resource center, Peking union medical college, Beijing, China) were cultured in RPMI-1640 containing 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA), incubated in 37 °C humidified incubator with 5% CO2 and treated with different radiation of 2, 4, and 6 Gy using Co60 γ-rays with a dose rate of 1 Gy/min in the Irradiation (IR) Center (Beijing Radiation Center, Beijing Academy of Science and Technology, Beijing, China).
4.2. siRNAs and Plasmids Transfection
A549 and H1299 cells were grown at 80% confluence and then introduced with siRNAs against CHMP4C (Ambion, Austin, TX, USA), Aurora B (Ambion), p53 and p21 (GenePharma, Beijing, China) as well as control siRNA (Ambion). CHMP4C, Aurora B, p53 and p21 siRNA sequence is respectively: 5′-CCUGCGUCUCUACAACUAU-3′, 5′-CAUGGAUCUGAACAAAAUATT-3′, 5′-CUACUUCCUGAAAACAACG-3′ and 5′-CCUCUGGCAUUAGAAUUAUTT-3′. siRNA tansfections were performed using Lipofectamine RNAi MAX reagent (Invitrogen). Twenty-four hours after transfection, the cells were irradiated and harvested.
pcDNA3.1-CHMP4C or -Aurora B was contrasted and transfected into A549 or H1299 cells using Lipofectamine 3000 reagent (Invitrogen). Twenty-four hours later, cells were collected and performed for subsequent experiments as siRNAs treatment.
4.3. Kinase Inhibition Assays
Aurora B kinase inhibitor AZD1152-HQPA was dissolved in dimethyl sulphoxide (DMSO). The A549 and H1299 cells were treated with AZD1152-HQPA at the concentration of 10, 100 and 1000 nM. After 24 h of treatment, CHMP4C phosphorylation was examined by Western blot.
4.4. Western Blot
The cells were harvested and lysed in RIPA lysis buffer (Thermo Scientific Pierce, Waltham, MA, USA). The protein was collected at 12,000× g for 15 min at 4 °C and measured by BCA protein assay kit (Thermo Scientific Pierce). Equal amounts of protein were separated on 10% sodium dodecyl sulfate (SDS)-polyacrylamide gels and blotted on nitrocellulose membranes for Western blot analysis. The membranes were blocked in 5% nonfat milk and then incubated with the following primary antibodies: CHMP4C (Abcam, Cambridge, UK), phosphorylated (p)—CHMP4C (Abmart, Arlington, MA, USA), Aurora B (Abcam), p53 (Cell Signaling Technology, Boston, MA, USA), p21 (Cell Signaling Technology) and β-actin (Cell Signaling Technology). The CHMP4C antibody is diluted in 1:500, and the rest were used in 1:1000 dilutions. Membranes were washed in tris-buffered saline containing 0.5% tween-20 and then incubated with goat anti-rabbit lgG (Abcam, 1:2000) or goat anti-mouse lgG (Abcam, 1:3000) conjugated to horseradish peroxidase for 1 h at room temperature. The membranes were detected using Chemiluminescence liquid (Thermo Scientific Pierce) according to the manufacturer’s protocol and analyzed by the Image J software (Bio-Rad, Hercules, CA, USA).
4.5. Real-Time PCR
Total RNA was extracted using SV total RNA isolation system kit (Promega, Madison, WI, USA) followed by reverse transcription using the GoScript reverse transcription system kit (Promega). The subsequent cDNA products were used as templates to perform the real-time PCR assays. The primers for the amplification of Aurora B or CHMP4C are as follows; Aurora B forward: TTTGAGATTGGGCGTCCTCT and reverse: CGCCCTCCTTCTCTATCTGG; CHMP4C forward: AGAAGCCCTGGAGAACTCAC and reverse: CTTGGGCAGTATCCTGTTGC. The β-actin was used as the internal control using primers forward: TGCCAGAAAACAAGATGAG and reverse: CACCTTCACCGTTCCAGTTT. PCR amplifications were performed in triplicate wells and each experiment was repeated for three times. The relative expression levels of genes were analyzed through the use of the 2−∆∆Ct method.
4.6. Cell Cycle Assay
Cells were harvested and treated with Vibrant Dyecycle green stain (Invitrogen) at 37 °C for 30 min in a dark place. Then, cell cycle was analyzed on a flow cytometer using 488-nm excitation and green emission.
4.7. Colony Formation Assay
To analyze colony formation, Single cell was plated in the 6 cm dish at a density of 1000 cells/mL for 10 to 14 days to form spheres. Colonies were fixed with 4% paraformaldehyde for 20 min and then stained with 1% crystal violet for 15 min. Colonies were counted and surviving fraction was calculated as the mean number of colonies/(cells seeded × plating efficiency).
4.8. Cell Apoptosis Assay
Cells were harvested and washed twice with cold PBS. Cells were resuspended in 1× binding buffer (BD) at a concentration of 1 × 106 cells/mL and stained with PE AnnexinV and 7-AAD (BD) for 15 min at room temperature in the dark. Samples were analyzed by flow cytometry.
4.9. γH2AX and 53BP1 Foci Formation
Cells were seeded on the glass sheets into 6-well plates. Cells were transfected with siRNAs and then exposed to 4 Gy of irradiation. 30 min later, cells were washed twice in PBS, and then incubated with anti-γH2AX (Millipore, FITC conjugate, Billerica, MA, USA), anti-53BP1 (Abcam) or anti-CHMP4C antibody at a dilution of 1:200 overnight at 4 °C. After washing twice in washing buffer (0.05% Tween-20 in PBS), the cells were incubated with goat anti-rabbit lgG (Abcam, Alexa fluor conjugate) at 37 °C for 1 h. Cells were washed twice with washing buffer and once with PBS. The coverslips were then mounted with mounting medium for fluorescence with DAPI (Vectashield). The image of γH2AX and 53BP1 foci was detected using a Leica DMRXA fluorescent microscope (Leica, Wetzlar, Germany). γH2AX and 53BP1 foci were counted in cells with more than five foci.
4.10. Statistical Analysis
Data are presented as the mean ± S.E. of three independent experiments, and the statistics were analyzed by students’ t test using Microsoft Excel (Microsoft Campus, Redmond, WA, USA). p-value <0.05 indicates statistical significance.