Next Article in Journal
Psoriasis Pathogenesis and Treatment
Next Article in Special Issue
Transcriptome Analysis Reveals the Accumulation Mechanism of Anthocyanins in Buckwheat (Fagopyrum esculentum Moench) Cotyledons and Flowers
Previous Article in Journal
Intravenous Immunoglobulin Therapy Eliminates Candida albicans and Maintains Intestinal Homeostasis in a Murine Model of Dextran Sulfate Sodium-Induced Colitis
Previous Article in Special Issue
Comprehensive Genomic Analysis and Expression Profiling of Diacylglycerol Kinase (DGK) Gene Family in Soybean (Glycine max) under Abiotic Stresses
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 20
Issue 6
10.3390/ijms20061474
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Bioinformatic Exploration of the Targets of Xylem Sap miRNAs in Maize under Cadmium Stress

by
Baoxiang Wang
1,†,
Dan Cheng
2,†,
Ziyan Chen
2,
Manman Zhang
2,
Guoqiang Zhang
2,
Mingyi Jiang
2 and
Mingpu Tan
2,*
1
Lianyungang Institute of Agricultural Sciences in Jiangsu Xuhuai Region, Jiangsu Academy of Agricultural Sciences, Lianyungang 222000, China
2
National Key Laboratory of Crop Genetics and Germplasm Enhancement, College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2019, 20(6), 1474; https://doi.org/10.3390/ijms20061474
Submission received: 11 February 2019 / Revised: 12 March 2019 / Accepted: 14 March 2019 / Published: 23 March 2019
(This article belongs to the Special Issue Transcriptional and Post-transcriptional Gene Regulation in Plants)
Browse Figures
Versions Notes

Abstract

:
Cadmium (Cd) has the potential to be chronically toxic to humans through contaminated crop products. MicroRNAs (miRNAs) can move systemically in plants. To investigate the roles of long-distance moving xylem miRNAs in regulating maize response to Cd stress, three xylem sap small RNA (sRNA) libraries were constructed for high-throughput sequencing to identify potential mobile miRNAs in Cd-stressed maize seedlings and their putative targets in maize transcriptomes. In total, about 199 miRNAs (20–22 nucleotides) were identified in xylem sap from maize seedlings, including 97 newly discovered miRNAs and 102 known miRNAs. Among them, 10 miRNAs showed differential expression in xylem sap after 1 h of Cd treatment. Two miRNAs target prediction tools, psRNAtarget (reporting the inhibition pattern of cleavage) and DPMIND (discovering Plant MiRNA-Target Interaction with degradome evidence), were used in combination to identify, via bioinformatics, the targets of 199 significantly expressed miRNAs in maize xylem sap. The integrative results of these two bioinformatic tools suggested that 27 xylem sap miRNAs inhibit 34 genes through cleavage with degradome evidence. Moreover, nearly 300 other genes were also the potential miRNAs cleavable targets without available degradome data support, and the majority of them were enriched in abiotic stress response, cell signaling, transcription regulation, as well as metal handling. These approaches and results not only enhanced our understanding of the Cd-responsive long-distance transported miRNAs from the view of xylem sap, but also provided novel insights for predicting the molecular genetic mechanisms mediated by miRNAs.

1. Introduction

Heavy metal accumulation in soils is of concern in agricultural production due to the adverse effects on food safety. Cadmium (Cd) is a non-essential element for plants, however it can be absorbed by the roots from the soil and transported to the aboveground parts; thus, it can not only affect the growth and the subsequent productivity of crops, but can also pose a great threat to human health because of its accumulation in the consumable parts of food crops [1,2,3,4]. MicroRNAs (miRNAs) are the most studied 20- to 22-nucleotide non-protein coding RNAs and are at the heart of regulating gene expression in multiple developmental and signaling pathways [5,6,7]. MiRNAs are hypersensitive to different heavy metals, such as Cd, aluminum, and lead in some crop plants (including rice, maize, oilseed rape, and radishes), and mounting evidence has revealed that miRNAs and their targets weaved networks play important regulatory roles in plant adaptation to different heavy metal stresses [4,8,9,10,11].
In plants, one of the most fascinating aspects of RNA silencing is its mobile nature, and the movement of small RNA (sRNA) molecules can “non-cell-autonomously” orchestrate developmental and stress responses [12,13]. Results obtained with grafting techniques and transient expression systems have shown that sequence-specific short interfering RNAs with a size of 21–24 nucleotides travel to distant organs [14,15]. Phloem exudates contain diverse miRNAs and at least two of them, miR395 and miR399, involved in responses to nutrient availability, are transmitted through grafts, indicating long-distance movement [12,16,17]. Similarly, siRNA signals produced in source or sink tissues move from cell-to-cell and travel long distances via the phloem to apical tissues [18]. Though the long-distance transport of sRNAs was intensively investigated in phloem, small RNAs have also been isolated from the developing xylem of Populus stems, and a majority of these miRNAs have been predicted to target developmental- and stress/defense-related genes, including those associated with the biosynthesis of cell wall metabolites [19]. Arabidopsis miR857, specifically expressed in the vascular tissues of seedlings, is involved in regulating lignin content and consequently morphogenesis of the secondary xylem in by regulating the expression of its target gene LACCASE7 [20].
MiRNAs negatively regulate their target gene expression at transcriptional and post-transcriptional levels by regulating both messenger RNA (mRNA) degradation and translational inhibition based on miRNA/target sequence complementarity [6]. High-throughput degradome sequencing has been successfully established and adapted to validate miRNA splicing targets in a variety of plant species, such as hyperaccumulator Sedum alfredii [21], Populus [22], rice [23,24], soybean [25], canola [5], and maize [26]. Recently, an integrated web-based tool, DPMIND (Degradome-based Plant MiRNA-Target Interaction and Network Database), was developed to scan sRNA targets in multiple plant species [27].
To thoroughly predict the roles of long-distance moving Cd-responsive maize miRNAs, three xylem sap sRNA libraries of Cd-stressed maize were constructed for high-throughput sequencing. Then, an integrative bioinformatic approach composed of psRNATarget and DPMIND was employed to predict potential targets of Cd-responsive xylem miRNAs. Intriguingly, 34 high-confidence cleavable targets for 27 xylem sap miRNAs were identified. Moreover, nearly 300 other genes were also the potential miRNAs cleavable targets, and the majority of them were enriched in abiotic stress response, cell signaling, transcription regulation, as well as metal handling, chelation, and storage. This investigation, therefore, would provide aid to elucidate the molecular genetic mechanisms underlying plant responses to Cd stress from the aspect of mobile miRNAs.

2. Results

2.1. High-Throughput Sequencing of sRNAs in Maize Xylem Sap

To investigate the differences in maize xylem sap sRNA profiles after Cd treatment, we collected xylem sap samples from Cd-treated seedlings, and three sRNA libraries (including two control samples) for sequencing were generated from the maize xylem sap.
We obtained about 2.7, 3.8, and 3.8 M total reads, represented by 0.96, 1.25, and 1.39 M unique sRNA reads, respectively, from the untreated 0 h (C0), untreated 1 h (C1), and Cd-treated 1 h (Cd1) libraries of xylem sap collected at the indicated time-point and treatment. The length distribution of reads showed that the majority of the reads were 20–24 nt in size, which was within the typical size range for Dicer-derived products [28].
To confirm the expression of sRNAs identified by deep sequencing, eight sRNAs (lengths of 19–25 nt) were randomly selected for quantitative real-time RT-PCR (qRT-PCR) analysis, and these contained three miRNAs (PC-3p-33282_23, zma-miR169l-5p, and zma-miR395a-5p_R-1) with lengths of 20–22 nt (Supplementary Table S1). The comparison indicated that the expression patterns of Cd-responsive sRNAs from high-throughput sequencing and qRT-qPCR exhibited a good concordance (Figure 1, Supplementary Table S1), implying the reliability of the sRNA-seq profiling data for the following analysis.
The expression levels of sRNAs were compared between 1 h of Cd treatment (Cd1) and the control C1 samples. Data of qRT-qPCR are means ± SD from three independent biological replicates.

2.2. Identification of Xylem Sap Cd-Responsive miRNAs

After length filtration of the sequenced sRNAs, about 199 miRNAs (20–22 nt) were identified in xylem sap from Cd-treated or -untreated maize, including 97 newly discovered and 102 known miRNAs, which were homologous to the sequences in miRBase (Supplementary Table S2). Based on the number of reads (>10 at least in one sample) and MFEI (≥0.85) [29,30], about 20 new high-confidence miRNAs with relatively high expression levels were identified in the three samples (Table 1).
MiRNAs detected in C1 and Cd1 libraries were used for differential expression analysis using the stringent criteria (|log2Ratio| ≥1, p ≤ 0.05). Finally, 10 miRNAs showed differential expression in xylem sap after 1 h of Cd treatment (Table 2). Among them, the expressions of three newly identified miRNAs (PC-3p-10246_108, PC-3p-33282_23, and PC-3p-65413_10) was significantly regulated by Cd exposure (p ≤ 0.01).
Regarding the 10 Cd-modulated miRNAs, two highly expressed miRNAs (zma-miR169l-5p, zma-miR398a-3p), and two new miRNAs (PC-3p-10246_108 and PC-3p-33282_23) were upregulated by Cd exposure; Cd significantly negatively regulated the remaining miRNAs (Table 2).

2.3. Target Predictions of Xylem Sap miRNAs

To better understand the biological functions of long-distance transported miRNAs, 199 significantly expressed miRNAs (p ≤ 0.05, in at least one dataset) from maize xylem sap were identified for target scanning (Supplementary File S1). The putative target sites in maize cDNAs were predicted using two plant sRNA target prediction tools (psRNAtarget and PsRobot).
With the application of psRNAtarget using the inhibition pattern of ‘Cleavage’, we identified a total of 2184 transcripts from 1436 maize genes, to be the targets of 196 xylem sap miRNAs (Supplementary Table S3). Using PsRobot, we obtained a total of 2514 transcripts from 1774 maize genes to be targets of 172 xylem sap miRNAs (Supplementary Table S4). Through the integration, we identified a total of 493 transcripts from 332 genes as the cleavable targets of 115 miRNAs in the intersection of results from psRNAtarget and PsRobot.

2.4. The Function Classification of the Predicted miRNAs Targets

To gain insights into the functionality of the miRNA targets, all of these 493 transcripts were functionally grouped by agriGO [31] and visualized in the candidate pathway networks with MapMan software [32].
Among the genes within the ‘TF’ group, 11 members of MYB family, two WRKYs, and one AP2-EREBP as well as one bHLH-transcription factor were all the targets of miR159 family members, whereas five NACs and six Homeobox-transcription factors were targeted by miR164s and miR166s, respectively (Table 3, Figure 2, Supplementary Table S3).
With regard to the targets mapped to “Secondary metabolism” category, nine laccases were exclusively coupled to MIR397 family members. With regard to ‘Abiotic stress’ response, five genes (including two DNAJ proteins and one ERD ortholog) were targeted by five miRNAs individually. Similarly, within the ‘metal handling, chelation, and storage’ group, two major facilitator proteins and one MATE efflux family protein were uniquely targeted by three miRNAs. However, ZM2G058032 (heavy-metal-associated domain protein) and ZM2G407032 (ABC transporter) were co-targeted by miR399s (Table 3, Figure 2).
The predicted cleavable targets inhibited by miRNAs were inputted into MapMan software (3.6.0RC1) for metabolic pathways analysis (using the framework of Arabidopsis seed-Molecular Networks). The colored boxes indicated the expectation score output by psRNAtarget, and the larger value was shown in deep red.
In addition, several genes located in the pathway network were the potential targets of novel miRNAs. Particularly in the ‘signaling’ category, three genes involved in Ca signaling (ZM2G107575, ZM2G312661, and ZM2G174315) and the protein kinase (ZM2G100454) were uniformly targeted by novel miRNAs (Table 3, Figure 2).

2.5. The miRNAs Cleavable Targets

The transcripts of 332 maize genes in the intersection of psRNAtarget and PsRobot output, which were the potential 115 miRNAs cleavable targets, were further evidenced by the maize degradome data. With the aid of the DPMIND webserver [27], which harbors the degradome sequencing data of maize anther and ears, we obtained 34 maize genes harbored target sites of 27 xylem sap miRNAs by combining the outputs of psRNAtarget, PsRobot, and DPMIND (Table 4, Supplementary Table S5).
Regarding these cleavable candidates, the majority of them were intensively studied, including 11 squamosa promoter binding proteins (SBPs), seven nuclear transcription factor Ys (NFY), and three auxin response transcription factors (ARF) [6]. After excluding these well-known targets of miRNAs, several genes were filtered out as fresh cleavable targets for these xylem sap miRNAs, including the common stress-responsive miRNAs and their targets [6].
Many miRNAs appear to function together via co-targeting to regulate functionally related genes or pathways, and vice versa [33]. For example, the myb74 transcription factor (ZM2G028054_T03) was co-modulated by zma-miR159a-3p_R-1 and zma-miR319a-3p_R+1, while myb138 (ZM2G139688_T01) was specifically targeted by zma-miR159a-3p_R-1 (Table 4). In contrast, two F-box proteins (ZM2G064954_T01 and ZM2G119650_T01) were both the targets of zma-miR394a-5p. Similarly, ZM2G155490_T01 and ZM2G304745_T01 (encoding LRR receptor-like kinase) were targeted by zma-miR390a-5p (Table 4).

3. Discussion

3.1. The Long-Distance Transport of miRNAs

Long-distance transport of signaling molecules, intensively investigated in phloem, is known to be a major component in plant growth regulation, as well as their adaptation to changing environmental conditions [34]. Although some studies have demonstrated the presence of numerous miRNAs in phloem tissues [35,36,37], so far, only three miRNAs (miR399, miR395, and miR172) have been shown to move long distances in plants [16,17,34,38].
However, xylem also plays an important role in the root-to-shoot signaling system [39]. Furthermore, the root-to-shoot Cd translocation process may be more complex than previously thought [40]. Regarding xylem, research on miRNAs is in its infancy. In this study, about 199 miRNAs were identified in Cd-treated or -untreated maize xylem sap, including 97 novel and 102 known maize miRNAs. Moreover, the three famous long-distance moving miRNAs (miR399, miR395, and miR172) were detected in maize xylem sap (Table 3, Supplementary Table S2). These findings suggested that these miRNAs are potential signal molecules that move systemically.
MATE transporters were involved in the cellular transport and detoxification of Cd [41]. Furthermore, the distribution of allocated transcripts (e.g., MATE) along the root-to-shoot axis was correlated with the siRNA signal spread in hetero-grafted Arabidopsis [42]. Here, we identified zma-miR528a-5p in xylem sap, and predicted ZM2G148937 (MATE family protein) as its potential cleavable target (Table 3).
Six highly conserved amg-miRNA families (amg-miR166, amg-miR172, amg-miR168, amg-miR159, amg-miR394, and amg-miR156) were viewed as potential regulatory sequences of secondary cell wall biosynthesis [43], and Populus Pto-MIR156c might play vital roles in the regulation of wood formation in trees [44]. Moreover, the knockdown of rice MicroRNA166 confers drought resistance by causing leaf rolling and altering stem xylem development [5], and rice miR166 also plays a critical role in Cd accumulation and tolerance [45]. In this study, the miRNAs variants of these six families and nine miR166 isoforms with more than 30 reads in each of the three samples were identified in maize xylem sap (Supplementary Table S2).

3.2. The Potential Cleavable Targets of miRNAs in Xylem Sap

In plants, miRNAs and their targets show a pattern of near complementarity, suggesting that plant miRNAs likely act through endonucleolytic cleavage of target mRNAs [46]. In this study, 34 targets were predicted to be inhibited by miRNAs through cleavage with degradome evidence, and most of them were intensively studied targets of common stress-responsive miRNAs, such as NFY, ARFs, SBPs, and GRAS family transcription factors [6]. Concerning the cleavable candidates of xylem sap miRNAs, they were concentrated on the NFY-, ARF-, SBP-, and GRAS-transcription factors, which was targeted by zma-miR169s, zma-miR160f-5p, zma-miR156s, and zma-miR171s, respectively (Table 4).
It is of particular interest to note that three homeobox-transcription factors were the cleavable targets of zma-miR166s, and two of them were annotated as rolled leaf genes (Table 4), which was reminiscent of their rice ortholog OsHB4. Moreover, miR166 plays a critical role in Cd tolerance as well as in drought resistance through regulation of its cleavable HD-Zip target gene OsHB4 in rice [5,45]. Altogether, these results of miR166-mediated regulatory cascade strengthened the pivotal role miR166-HB couple in abiotic stress acclimation. Moreover, among the miRNA targets within the ‘TF’ group, members of other TF families (e.g., MYBs, WRKYs, NACs) were the specific targets of certain miRNA family members (Table 3, Figure 2, Supplementary Table S3). These TF-type miRNA targets might contribute to elucidate the complicated mechanism of Cd stress from the aspect of transcriptional network through unveiling transcription factor-regulated downstream target genes which were involved in Cd stress response.
In addition to these well-known targets of miRNAs, several genes were filtered out as novel cleavable targets for these xylem sap miRNAs, including the common stress-responsive miRNAs and their targets [6] (Table 4).
Many miRNAs appear to function together via co-targeting to regulate functionally related genes, and vice versa [33]. For example, the myb74 was co-modulated by zma-miR159a-3p_R-1 and zma-miR319a-3p_R+1, whereas two F-box proteins were both the targets of zma-miR394a-5p (Table 4). These co-targeting paradigms indicated that individual miRNA variants have different functions according to their specific targets [33].
Besides the 34 maize genes as the cleavable candidates of miRNAs with degradome evidence from the limited degradome data (Table 4), nearly 300 other genes were also the potential miRNAs cleavable targets (Table 3, Supplementary Table S3). From a global view, many target genes were prone to be enriched in abiotic stress response, cell signaling, transcription regulation, as well as metal handling, chelation, and storage (Table 3, Figure 2). Using a degradome sequencing approach, leucine-rich repeat (LRR) protein, cation transporting ATPase, and Myb transcription factors, were found to be cleaved by miRNAs under heavy metal stress [25]. Furthermore, a few miRNA cleavable targets, including iron transporter and ABC transporter, were involved in plant responses to Cd stress [2,8]. MATE transporters were involved in the cellular transport and detoxification of Cd [41]. In this study, ZM2G148937 (MATE family protein) was predicted as the cleavable target of zma-miR528a-5p (Table 3). From another perspective, these targets in relation to the Cd stress acclimation highlighted the role of the corresponding miRNAs in regulating Cd stress response.
Intriguingly, these known cleavable targets of miRNAs were also identified in this investigation (Table 3), though we did not retrieve degradome evidence from the available public dataset.
miRNAs were regarded as a new target for genetically improving plant tolerance to certain stresses [6]. From the perspective of miRNA-target couple, the characterization of the miRNAs and the associated targets in responses to Cd exposure will provide a framework for understanding the molecular mechanism of heavy metal tolerance in plants. Thus, it would be interesting to determine the role of these long-transported miRNAs, and whether these xylem sap miRNAs are transported to leaves under heavy metal stress or other stresses. Future investigation on the final location of xylem sap miRNAs, which might be achieved through analyzing the difference between the exudates from the node incisions where ears or leaves separated and xylem sap below the node, together with the target identification through degradome and proteome or ribosome profiling of the detached ears or leaves, will aid to illustrate the effect of xylem sap miRNAs on their potential targets in their final destination.

4. Materials and Methods

4.1. Plant Materials and Cd Treatment

The seedlings of maize (Zea mays L. cv. Nongda 108; China) were cultivated in a hydroponic system in a growth chamber with a temperature of 22 °C (night) to 28 °C (day), photosynthetic active radiation of 200 μmol·m−2·s−1, and a 14/10-h day/night photoperiod. All hydroponic solutions were continuously aerated and renewed every three days. When the third leaves were fully expanded, the seedlings were transferred into fresh growing solutions containing 100 uM CdCl2, according to previous reports [2,3].

4.2. Sampling of Xylem Sap

The seedlings were separated into three groups—untreated 0 h (C0), untreated 1 h (C1), and Cd-treated 1 h (Cd1). For each group, 30 maize seedlings at the indicated timepoint/treatment were de-topped by cutting the stem with a razor blade just above the first internode, and the remaining parts without stem were used for xylem sap collection, according to previous reports with minor modifications [47,48,49,50,51]. Then, the cut surface was rinsed twice with distilled water and the liquid drawn in the first 5 min was discarded. Finally, the bleeding saps from 30 maize plants were harvested with 10 uL syringe for 1 h after cutting and mixed in a tube containing 1 mL Trizol as one sample replication, and single biological replication for each sample was used for sRNA sequencing.

4.3. Small RNA Library Preparation and Sequencing

Total RNA was extracted from C0, C1, and Cd1 xylem sap samples using Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s procedure. Approximately 1 µg of total RNA were used to prepare a small RNA library (single biological replication for each sample) according to protocol of TruSeq Small RNA Sample Prep Kits (Illumina, San Diego, CA, USA). Then, we performed the single-end sequencing (36 bp) on an Illumina Hiseq2500 at the LC-BIO (Hangzhou, China) following the vendor’s recommended protocol. The data was uploaded to NCBI/SRA with accession number SRP073229 (https://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP073229), and contained miRNAs reads of C0, C1, and Cd1 xylem sap samples (single biological replication for each sample).

4.4. Small RNA Analysis

Data processing followed the procedures as described previously [23,24]. The raw reads were subjected to the Illumina pipeline filter (Solexa 0.3), and then the dataset was further processed with an in-house program, ACGT101-V4.2 (LC Sciences, Houston, TX, USA) to remove adapter dimers, junk, low complexity, common RNA families (rRNA, tRNA, snRNA, snoRNA), and repeats.

4.5. Identification of Known and Novel miRNAs

Unique sequences with lengths of 20–22 nucleotide [52] were mapped to monocot plant precursors in miRBase Release 22.1 (October 2018, mirbase.org) by BLAST search to identify known miRNAs and novel 3p- and 5p-derived miRNAs.
The unique sequences mapping to maize mature miRNAs in hairpin arms were identified as known miRNAs. The unique sequences mapping to the other arm of known maize precursor hairpin opposite to the annotated mature miRNA-containing arm were considered to be novel 5p- or 3p-derived miRNA candidates. The remaining sequences were mapped to other monocot precursors (with the exclusion of maize) in miRBase 20.0 by BLAST search, and the mapped pre-miRNAs were further BLASTed against the maize genomes (ftp://ftp.maizesequence.org/pub/maize/release-5b/assembly/ZmB73_RefGen_v2.tar.gz with genome annotation file ZmB73_5b_FGS.gff.gz) to determine their genomic locations [53].
The sequences unmapped to maize mature miRNAs or other monocot miRNAs precursors were further BLASTed against the maize genomes, and the hairpin RNA structures containing mappable sequences were predicted from the flank 120 nt sequences using RNAfold software (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi).The criteria used to annotate potential miRNAs was as described previously [54,55,56,57]. Sequences that met the criteria for secondary structure prediction were then considered to be novel miRNA precursors [53,58,59]. Minimum free energy index (MFEI) was also taken into account for evaluating the confidence of novel miRNAs, with the expected value (≥0.85) [7,29,30]. Moreover, all of the aforementioned criteria must be fulfilled in at least two distinct sRNA-seq libraries [52].

4.6. Differential Expression Analysis of sRNAs Under Cd Stress

Data normalization followed the procedures as described in a previous study [60]. sRNA differential expression based on normalized deep-sequencing counts was analyzed by selectively using Fisher’s exact test and Chi-squared 2 × 2 test with the selection threshold of 0.05 [23,28,60].
To investigate the differentially expressed miRNAs between libraries, we compared the gene expression patterns of miRNAs in Cd1 and C1 library. Towards this purpose, we considered the following criteria: (1) p-value should be less than 0.05 (p ≤ 0.05) in at least one dataset; and (2) Log2 ratio of fold change between normalized counts of C1 and Cd1 libraries was greater than 1 or less than −1 [28,56,57,59,61].

4.7. The Prediction of miRNA Targets

After filtering, we get 199 significantly expressed miRNAs (p ≤ 0.05, in at least one of the three samples). Then, these xylem sap 199 miRNAs were used to interrogate maize annotated cDNAs sequences (Zea_mays.AGPv3.22, ftp://ftp.ensemblgenomes.org) preloaded in the psRNAtarget web server (plantgrn.noble.org/psRNATarget) [62] for predicting target sites as described previously [61], and the default criteria for target prediction in psRNAtarget website were used.
Prediction of miRNA target genes was also performed by the local version of psRobot_tar scripts in psRobot (omicslab.genetics.ac.cn/psRobot) [63] using the 199 miRNAs for scanning maize cDNAs sequences (http://ftp.maizesequence.org/release-5a/filtered-set/ZmB73_5b_FGS_cdna.fasta.gz) with default settings (moderate model of pre-set the target penalty score 2.5, thus alignments that meet the penalty score cutoff will be reported in the result).
To scan the cleavable targets of the identified known miRNAs and novel miRNAs, these miRNAs were uploaded to DPMIND (http://cbi.njau.edu.cn/DPMIND) [27] to locate the homologous miRNAs for the following degradome data query.

4.8. The Confirmation of sRNAs Expression by qRT-PCR

To confirm the expression of sRNAs identified by deep sequencing, eight sRNAs (lengths of 19–25 nt) were randomly selected for quantitative real-time RT-PCR (qRT-PCR) analysis (Supplementary Table S1), and these contained 3 identified miRNAs (with lengths of 20–22 nt) [7,57,61].
For determining the expression of sRNAs, about 2 μg RNAs were reverse-transcribed by miRcute miRNA First-Strand cDNA Synthesis kit (TIANGEN, Beijing, China). Transcript levels of mature sRNAs were measured by qRT-PCR using a DNA Engine Opticon 2 real-time PCR detection system (Bio-Rad, Hercules, CA, USA) with miRcute miRNA qPCR Detection kit (TIANGEN) according to the manufacturer’s instructions. Details of the primers used are listed in Supplementary Table S1. The maize 5S RNA was used as the internal control for RNA template normalization [64]. All reactions were run in triplicate. The relative expression levels of sRNAs were calculated by the comparative threshold cycle (Ct) method. At least three independent biological replicates were used for each small RNA.

Supplementary Materials

Supplementary materials can be found at https://www.mdpi.com/1422-0067/20/6/1474/s1.

Author Contributions

B.W., D.C., M.T., and M.J. planned and designed the research. Z.C., M.Z., and G.Z. performed the experiments and data collection, and D.C. did the bioinformatics analysis. B.W., M.J., and M.T. wrote the manuscript and coordinated its revision. All authors read and provided helpful discussions, and approved the final version.

Funding

The work was supported by research grants from the Science and Technology Support Program of Jiangsu Province, China (grant No. BE2017323) and the National Natural Science Foundation of China (grant No. 31271421).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Uraguchi, S.; Fujiwara, T. Cadmium transport and tolerance in rice: Perspectives for reducing grain cadmium accumulation. Rice 2012, 5, 5. [Google Scholar] [CrossRef] [PubMed]
  2. Kulik, A.; Anielska-Mazur, A.; Bucholc, M.; Koen, E.; Szymanska, K.; Zmienko, A.; Krzywinska, E.; Wawer, I.; McLoughlin, F.; Ruszkowski, D.; et al. SNF1-related protein kinases type 2 are involved in plant responses to cadmium stress. Plant Physiol. 2012, 160, 868–883. [Google Scholar] [CrossRef] [PubMed]
  3. He, F.; Liu, Q.; Zheng, L.; Cui, Y.; Shen, Z. RNA-seq analysis of rice roots reveals the involvement of post-transcriptional regulation in response to cadmium stress. Front. Plant Sci. 2015, 6, 1136. [Google Scholar] [CrossRef] [PubMed]
  4. Jian, H.; Yang, B.; Zhang, A.; Ma, J.; Ding, Y.; Chen, Z.; Li, J.; Xu, X.; Liu, L. Genome-wide identification of MicroRNAs in response to cadmium stress in oilseed rape (Brassica napus L.) using high-throughput sequencing. Int. J. Mol. Sci. 2018, 19, 1431. [Google Scholar] [CrossRef] [PubMed]
  5. Zhang, J.; Zhang, H.; Srivastava, A.K.; Pan, Y.; Bai, J.; Fang, J.; Shi, H.; Zhu, J.K. Knockdown of rice MicroRNA166 confers drought resistance by causing leaf rolling and altering stem xylem development. Plant Physiol. 2018, 176, 2082–2094. [Google Scholar] [CrossRef]
  6. Zhang, B. MicroRNA: A new target for improving plant tolerance to abiotic stress. J. Exp. Bot. 2015, 66, 1749–1761. [Google Scholar] [CrossRef]
  7. Zhao, P.; Ding, D.; Zhang, F.; Zhao, X.; Xue, Y.; Li, W.; Fu, Z.; Li, H.; Tang, J. Investigating the molecular genetic basis of heterosis for internode expansion in maize by microRNA transcriptomic deep sequencing. Funct. Integr. Genom. 2015, 15, 261–270. [Google Scholar] [CrossRef]
  8. Xu, L.; Wang, Y.; Zhai, L.; Xu, Y.; Wang, L.; Zhu, X.; Gong, Y.; Yu, R.; Limera, C.; Liu, L. Genome-wide identification and characterization of cadmium-responsive microRNAs and their target genes in radish (Raphanus sativus L.) roots. J. Exp. Bot. 2013, 64, 4271–4287. [Google Scholar] [CrossRef]
  9. Kong, X.; Zhang, M.; Xu, X.; Li, X.; Li, C.; Ding, Z. System analysis of microRNAs in the development and aluminium stress responses of the maize root system. Plant Biotechnol. J. 2014, 12, 1108–1121. [Google Scholar] [CrossRef] [Green Version]
  10. Tang, M.; Mao, D.; Xu, L.; Li, D.; Song, S.; Chen, C. Integrated analysis of miRNA and mRNA expression profiles in response to Cd exposure in rice seedlings. BMC Genom. 2014, 15, 835. [Google Scholar] [CrossRef]
  11. Ding, Y.; Ye, Y.; Jiang, Z.; Wang, Y.; Zhu, C. MicroRNA390 is involved in cadmium tolerance and accumulation in rice. Front. Plant Sci. 2016, 7, 235. [Google Scholar] [CrossRef]
  12. Marin-Gonzalez, E.; Suarez-Lopez, P. “And yet it moves”: Cell-to-cell and long-distance signaling by plant microRNAs. Plant Sci. 2012, 196, 18–30. [Google Scholar] [CrossRef] [PubMed]
  13. Himber, C.; Dunoyer, P. The tracking of intercellular small RNA movement. Methods Mol. Biol. 2015, 1217, 275–281. [Google Scholar]
  14. Zhang, W.; Kollwig, G.; Stecyk, E.; Apelt, F.; Dirks, R.; Kragler, F. Graft-transmissible movement of inverted-repeat-induced siRNA signals into flowers. Plant J. 2014, 80, 106–121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Khaldun, A.B.; Huang, W.; Lv, H.; Liao, S.; Zeng, S.; Wang, Y. Comparative profiling of miRNAs and target gene identification in distant-grafting between tomato and lycium (Goji berry). Front. Plant Sci. 2016, 7, 1475. [Google Scholar] [CrossRef] [PubMed]
  16. Pant, B.D.; Buhtz, A.; Kehr, J.; Scheible, W.R. MicroRNA399 is a long-distance signal for the regulation of plant phosphate homeostasis. Plant J. 2008, 53, 731–738. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Buhtz, A.; Pieritz, J.; Springer, F.; Kehr, J. Phloem small RNAs, nutrient stress responses, and systemic mobility. BMC Plant Biol. 2010, 10, 64. [Google Scholar] [CrossRef] [PubMed]
  18. McGarry, R.C.; Kragler, F. Phloem-mobile signals affecting flowers: Applications for crop breeding. Trends Plant Sci. 2013, 18, 198–206. [Google Scholar] [CrossRef]
  19. Puzey, J.R.; Karger, A.; Axtell, M.; Kramer, E.M. Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets. PLoS ONE 2012, 7, e33034. [Google Scholar] [CrossRef]
  20. Zhao, Y.; Lin, S.; Qiu, Z.; Cao, D.; Wen, J.; Deng, X.; Wang, X.; Lin, J.; Li, X. MicroRNA857 Is involved in the regulation of secondary growth of vascular tissues in Arabidopsis. Plant Physiol. 2015, 169, 2539–2552. [Google Scholar] [CrossRef] [PubMed]
  21. Han, X.; Yin, H.; Song, X.; Zhang, Y.; Liu, M.; Sang, J.; Jiang, J.; Li, J.; Zhuo, R. Integration of small RNAs, degradome and transcriptome sequencing in hyperaccumulator Sedum alfredii uncovers a complex regulatory network and provides insights into cadmium phytoremediation. Plant Biotechnol. J. 2016, 14, 1470–1483. [Google Scholar] [CrossRef] [PubMed]
  22. Lian, C.; Yao, K.; Duan, H.; Li, Q.; Liu, C.; Yin, W.; Xia, X. Exploration of ABA responsive miRNAs reveals a new hormone signaling crosstalk pathway regulating root growth of Populus euphratica. Int. J. Mol. Sci. 2018, 19, 1481. [Google Scholar] [CrossRef]
  23. Li, W.; Jia, Y.; Liu, F.; Wang, F.; Fan, F.; Wang, J.; Zhu, J.; Xu, Y.; Zhong, W.; Yang, J. Integration analysis of small RNA and degradome sequencing reveals MicroRNAs responsive to Dickeya zeae in resistant rice. Int. J. Mol. Sci. 2019, 20, 222. [Google Scholar] [CrossRef] [PubMed]
  24. Li, Y.F.; Zheng, Y.; Addo-Quaye, C.; Zhang, L.; Saini, A.; Jagadeeswaran, G.; Axtell, M.J.; Zhang, W.; Sunkar, R. Transcriptome-wide identification of microRNA targets in rice. Plant J. 2010, 62, 742–759. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Zeng, Q.Y.; Yang, C.Y.; Ma, Q.B.; Li, X.P.; Dong, W.W.; Nian, H. Identification of wild soybean miRNAs and their target genes responsive to aluminum stress. BMC Plant Biol. 2012, 12, 182. [Google Scholar] [CrossRef] [PubMed]
  26. Liu, H.; Qin, C.; Chen, Z.; Zuo, T.; Yang, X.; Zhou, H.; Xu, M.; Cao, S.; Shen, Y.; Lin, H.; et al. Identification of miRNAs and their target genes in developing maize ears by combined small RNA and degradome sequencing. BMC Genom. 2014, 15, 25. [Google Scholar] [CrossRef]
  27. Fei, Y.; Wang, R.; Li, H.; Liu, S.; Zhang, H.; Huang, J. DPMIND: Degradome-based plant miRNA-target interaction and network database. Bioinformatics 2018, 34, 1618–1620. [Google Scholar] [CrossRef] [PubMed]
  28. Yang, J.; Liu, X.; Xu, B.; Zhao, N.; Yang, X.; Zhang, M. Identification of miRNAs and their targets using high-throughput sequencing and degradome analysis in cytoplasmic male-sterile and its maintainer fertile lines of Brassica juncea. BMC Genom. 2013, 14, 9. [Google Scholar] [CrossRef] [PubMed]
  29. Zhang, B.H.; Pan, X.P.; Cox, S.B.; Cobb, G.P.; Anderson, T.A. Evidence that miRNAs are different from other RNAs. Cell. Mol. Life Sci. 2006, 63, 246–254. [Google Scholar] [CrossRef] [PubMed]
  30. Guzman, F.; Almerao, M.P.; Korbes, A.P.; Christoff, A.P.; Zanella, C.M.; Bered, F.; Margis, R. Identification of potential miRNAs and their targets in Vriesea carinata (Poales, Bromeliaceae). Plant Sci. 2013, 210, 214–223. [Google Scholar] [CrossRef] [PubMed]
  31. Tian, T.; Liu, Y.; Yan, H.; You, Q.; Yi, X.; Du, Z.; Xu, W.; Su, Z. agriGO v2.0: A GO analysis toolkit for the agricultural community, 2017 update. Nucleic Acids Res. 2017, 45, W122–W129. [Google Scholar] [CrossRef]
  32. Usadel, B.; Poree, F.; Nagel, A.; Lohse, M.; Czedik-Eysenberg, A.; Stitt, M. A guide to using MapMan to visualize and compare Omics data in plants: A case study in the crop species, Maize. Plant Cell Environ. 2009, 32, 1211–1229. [Google Scholar] [CrossRef]
  33. Huang, D.; Koh, C.; Feurtado, J.A.; Tsang, E.W.; Cutler, A.J. MicroRNAs and their putative targets in Brassica napus seed maturation. BMC Genom. 2013, 14, 140. [Google Scholar] [CrossRef]
  34. Bhogale, S.; Mahajan, A.S.; Natarajan, B.; Rajabhoj, M.; Thulasiram, H.V.; Banerjee, A.K. MicroRNA156: A potential graft-transmissible microRNA that modulates plant architecture and tuberization in Solanum tuberosum ssp. andigena. Plant Physiol. 2014, 164, 1011–1027. [Google Scholar] [CrossRef]
  35. Yoo, B.C.; Kragler, F.; Varkonyi-Gasic, E.; Haywood, V.; Archer-Evans, S.; Lee, Y.M.; Lough, T.J.; Lucas, W.J. A systemic small RNA signaling system in plants. Plant Cell 2004, 16, 1979–2000. [Google Scholar] [CrossRef]
  36. Buhtz, A.; Springer, F.; Chappell, L.; Baulcombe, D.C.; Kehr, J. Identification and characterization of small RNAs from the phloem of Brassica napus. Plant J. 2008, 53, 739–749. [Google Scholar] [CrossRef]
  37. Varkonyi-Gasic, E.; Gould, N.; Sandanayaka, M.; Sutherland, P.; MacDiarmid, R.M. Characterisation of microRNAs from apple (Malus domestica ‘Royal Gala’) vascular tissue and phloem sap. BMC Plant Biol. 2010, 10, 159. [Google Scholar] [CrossRef]
  38. Martin, A.; Adam, H.; Diaz-Mendoza, M.; Zurczak, M.; Gonzalez-Schain, N.D.; Suarez-Lopez, P. Graft-transmissible induction of potato tuberization by the microRNA miR172. Development 2009, 136, 2873–2881. [Google Scholar] [CrossRef]
  39. Rodriguez-Celma, J.; Ceballos-Laita, L.; Grusak, M.A.; Abadia, J.; Lopez-Millan, A.F. Plant fluid proteomics: Delving into the xylem sap, phloem sap and apoplastic fluid proteomes. Biochim. Biophys. Acta 2016, 1864, 991–1002. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Fontanili, L.; Lancilli, C.; Suzui, N.; Dendena, B.; Yin, Y.G.; Ferri, A.; Ishii, S.; Kawachi, N.; Lucchini, G.; Fujimaki, S.; et al. Kinetic analysis of zinc/cadmium reciprocal competitions suggests a possible zn-insensitive pathway for root-to-shoot cadmium translocation in rice. Rice 2016, 9, 16. [Google Scholar] [CrossRef]
  41. Li, L.; He, Z.; Pandey, G.K.; Tsuchiya, T.; Luan, S. Functional cloning and characterization of a plant efflux carrier for multidrug and heavy metal detoxification. J. Biol. Chem. 2002, 277, 5360–5368. [Google Scholar] [CrossRef]
  42. Thieme, C.J.; Rojas-Triana, M.; Stecyk, E.; Schudoma, C.; Zhang, W.; Yang, L.; Minambres, M.; Walther, D.; Schulze, W.X.; Paz-Ares, J.; et al. Endogenous Arabidopsis messenger RNAs transported to distant tissues. Nat. Plants 2015, 1, 15025. [Google Scholar] [CrossRef]
  43. Ong, S.S.; Wickneswari, R. Characterization of microRNAs expressed during secondary wall biosynthesis in Acacia mangium. PLoS ONE 2012, 7, e49662. [Google Scholar] [CrossRef]
  44. Quan, M.; Wang, Q.; Phangthavong, S.; Yang, X.; Song, Y.; Du, Q.; Zhang, D. Association studies in Populus tomentosa reveal the genetic interactions of Pto-MIR156c and its targets in wood formation. Front. Plant Sci. 2016, 7, 1159. [Google Scholar] [CrossRef]
  45. Ding, Y.; Gong, S.; Wang, Y.; Wang, F.; Bao, H.; Sun, J.; Cai, C.; Yi, K.; Chen, Z.; Zhu, C. MicroRNA166 modulates cadmium tolerance and accumulation in rice. Plant Physiol. 2018, 177, 1691–1703. [Google Scholar] [CrossRef]
  46. Rogers, K.; Chen, X. Biogenesis, turnover, and mode of action of plant microRNAs. Plant Cell 2013, 25, 2383–2399. [Google Scholar] [CrossRef]
  47. Shao, J.F.; Xia, J.; Yamaji, N.; Shen, R.F.; Ma, J.F. Effective reduction of cadmium accumulation in rice grain by expressing OsHMA3 under the control of the OsHMA2 promoter. J. Exp. Bot. 2018, 69, 2743–2752. [Google Scholar] [CrossRef]
  48. Wu, T.Y.; Gruissem, W.; Bhullar, N.K. Facilitated citrate-dependent iron translocation increases rice endosperm iron and zinc concentrations. Plant Sci. 2018, 270, 13–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Cornu, J.Y.; Deinlein, U.; Horeth, S.; Braun, M.; Schmidt, H.; Weber, M.; Persson, D.P.; Husted, S.; Schjoerring, J.K.; Clemens, S. Contrasting effects of nicotianamine synthase knockdown on zinc and nickel tolerance and accumulation in the zinc/cadmium hyperaccumulator Arabidopsis halleri. New Phytol. 2015, 206, 738–750. [Google Scholar] [CrossRef]
  50. Bailey, K.J.; Leegood, R.C. Nitrogen recycling from the xylem in rice leaves: Dependence upon metabolism and associated changes in xylem hydraulics. J. Exp. Bot. 2016, 67, 2901–2911. [Google Scholar] [CrossRef]
  51. Nguyen, C.; Soulier, A.J.; Masson, P.; Bussiere, S.; Cornu, J.Y. Accumulation of Cd, Cu and Zn in shoots of maize (Zea mays L.) exposed to 0.8 or 20 nM Cd during vegetative growth and the relation with xylem sap composition. Environ. Sci. Pollut. Res. Int. 2016, 23, 3152–3164. [Google Scholar] [CrossRef] [PubMed]
  52. Axtell, M.J.; Meyers, B.C. Revisiting criteria for plant MicroRNA annotation in the era of big data. Plant Cell 2018, 30, 272–284. [Google Scholar] [CrossRef] [PubMed]
  53. Zhang, Q.; Zhao, C.; Li, M.; Sun, W.; Liu, Y.; Xia, H.; Sun, M.; Li, A.; Li, C.; Zhao, S.; et al. Genome-wide identification of Thellungiella salsuginea microRNAs with putative roles in the salt stress response. BMC Plant Biol. 2013, 13, 180. [Google Scholar] [CrossRef] [PubMed]
  54. Meyers, B.C.; Axtell, M.J.; Bartel, B.; Bartel, D.P.; Baulcombe, D.; Bowman, J.L.; Cao, X.; Carrington, J.C.; Chen, X.; Green, P.J.; et al. Criteria for annotation of plant MicroRNAs. Plant Cell 2008, 20, 3186–3190. [Google Scholar] [CrossRef]
  55. Wang, Z.; Huang, J.; Sun, Z.; Zheng, B. Identification of microRNAs differentially expressed involved in male flower development. Funct. Integr. Genom. 2015, 15, 225–232. [Google Scholar] [CrossRef] [PubMed]
  56. Wang, Z.; Huang, R.; Sun, Z.; Zhang, T.; Huang, J. Identification and profiling of conserved and novel microRNAs involved in oil and oleic acid production during embryogenesis in Carya cathayensis Sarg. Funct. Integr. Genom. 2017, 17, 365–373. [Google Scholar] [CrossRef] [PubMed]
  57. Yin, F.; Gao, J.; Liu, M.; Qin, C.; Zhang, W.; Yang, A.; Xia, M.; Zhang, Z.; Shen, Y.; Lin, H.; et al. Genome-wide analysis of water-stress-responsive microRNA expression profile in tobacco roots. Funct. Integr. Genom. 2014, 14, 319–332. [Google Scholar] [CrossRef] [PubMed]
  58. Liu, W.; Xu, L.; Wang, Y.; Shen, H.; Zhu, X.; Zhang, K.; Chen, Y.; Yu, R.; Limera, C.; Liu, L. Transcriptome-wide analysis of chromium-stress responsive microRNAs to explore miRNA-mediated regulatory networks in radish (Raphanus sativus L.). Sci. Rep. 2015, 5, 14024. [Google Scholar] [CrossRef]
  59. Jin, Q.; Xue, Z.; Dong, C.; Wang, Y.; Chu, L.; Xu, Y. Identification and characterization of microRNAs from tree peony (Paeonia ostii) and their response to copper stress. PLoS ONE 2015, 10, e0117584. [Google Scholar] [CrossRef] [PubMed]
  60. Li, X.; Shahid, M.Q.; Wu, J.; Wang, L.; Liu, X.; Lu, Y. Comparative small RNA analysis of pollen development in autotetraploid and diploid rice. Int. J. Mol. Sci. 2016, 17, 499. [Google Scholar] [CrossRef] [PubMed]
  61. Kumar, R.R.; Pathak, H.; Sharma, S.K.; Kala, Y.K.; Nirjal, M.K.; Singh, G.P.; Goswami, S.; Rai, R.D. Novel and conserved heat-responsive microRNAs in wheat (Triticum aestivum L.). Funct. Integr. Genom. 2015, 15, 323–348. [Google Scholar] [CrossRef] [PubMed]
  62. Dai, X.; Zhuang, Z.; Zhao, P.X. psRNATarget: A plant small RNA target analysis server (2017 release). Nucleic Acids Res. 2018, 46, W49–W54. [Google Scholar] [CrossRef] [PubMed]
  63. Wu, H.J.; Ma, Y.K.; Chen, T.; Wang, M.; Wang, X.J. PsRobot: A web-based plant small RNA meta-analysis toolbox. Nucleic Acids Res. 2012, 40, W22–W28. [Google Scholar] [CrossRef] [PubMed]
  64. Li, Z.; Zhang, X.; Liu, X.; Zhao, Y.; Wang, B.; Zhang, J. miRNA alterations are important mechanism in maize adaptations to low-phosphate environments. Plant Sci. 2016, 252, 103–117. [Google Scholar] [CrossRef] [PubMed]
Ijms 20 01474 g001 550
Figure 1. Validation and comparison of the relative expression pattern of the selected eight small RNAs (sRNAs) between qRT–PCR and high-throughput small RNA sequencing.
Figure 1. Validation and comparison of the relative expression pattern of the selected eight small RNAs (sRNAs) between qRT–PCR and high-throughput small RNA sequencing.
Ijms 20 01474 g001
Ijms 20 01474 g002 550
Figure 2. Global view of metabolic pathway-embedded targets the predicted cleavable targets of maize xylem miRNAs.
Figure 2. Global view of metabolic pathway-embedded targets the predicted cleavable targets of maize xylem miRNAs.
Ijms 20 01474 g002
Table
Table 1. Novel MicroRNAs (miRNAs) with high-confidence in maize xylem sap.
Table 1. Novel MicroRNAs (miRNAs) with high-confidence in maize xylem sap.
miRNAc0C1Cd1Sequence (5′-3′)SizeMFEI
cme-MIR156j-p3272252GCTCACTTCTCTTTCTGTCAGT220.90
sof-MIR156-p3324470780GCTCACTTCTCTCTCTGTCAGC221.00
zma-MIR166n-p31179856835GCTGTCGTCGACCGGAGATC201.00
zma-MIR169g-p38610GGCGGTCTCCTTGGCTAGCC201.00
zma-MIR171f-p3304941TGATTGAGCCGTGCCAATATC210.90
sbi-MIR171h-p3181910TTGAGCCGCGTCAATATCTC201.10
zma-MIR397b-p5105185190TTGAGCGCAGCGTTGATGAGC210.90
PC-5p-37430_20141616TCTCTTAAGGCTTGTTCGGA200.90
PC-5p-27068_30231217ACCGGAGGAGGTTAGAGGAGC211.30
PC-5p-14301_71417665GGTTTTAGCTTCAAGCCATCT210.90
PC-5p-10912_100305252CCGGAAATACCCAATATCTTG211.00
PC-3p-7571_1595010360GGTGGCTTGTGGCTAAAACCA210.90
PC-3p-65413_104101GCTTTAAGGGATCTGTTGGAGA221.00
PC-3p-52974_1312813AATGGTGCATTGACTTGGTC201.10
PC-3p-49169_146816TTTGTCAATTTAAGAACTAAAA221.80
PC-3p-37537_20886277AATACTGAGCCGAATTGAAAT211.10
PC-3p-33282_2311117GCATCCATTCTTGGCTAAGTG211.20
PC-3p-18761_49214643GCCTGTATGCACTCTCGGTG200.90
PC-3p-18578_50172220TTTATGATATGTTACTCTACT211.50
PC-3p-10246_10865744CAGGCCTTCTTGGCTAAGCG200.90
PC-3p-100706_68815GGAGCTGCAAACACTCTGGT201.50
osa-MIR1430-p5583463CTTAGCCAAGAATGGCTTGCCT221.00
The numbers under c0, C1, and Cd1 represent the number of normalized miRNA reads. Novel miRNAs with high-confidence, meaning that the number of reads (>10 at least in one sample) and Minimum free energy index (MFEI ≥0.85), in xylem sap are listed here. c0 represents 0 h of untreated sample, C1 represents 1 h of untreated sample, and Cd1 represents 1 h of Cd-treated sample. Size indicated the length (nt) of miRNAs.
Table
Table 2. Cadmium (Cd)-responsive 10 miRNAs in maize xylem sap.
Table 2. Cadmium (Cd)-responsive 10 miRNAs in maize xylem sap.
miRNAC1Cd1log2FCchrStrandStartEndhairpinLen
Cd Upregulated
PC-3p-10246_1087442.73chr3+229987606229987776167
PC-3p-33282_231174.20chr3−9670453196704709176
zma-miR169l-5p311071.77chr1+29827701929827710787
zma-miR398a-3p31731.23chr7+3854017138540278106
zma-miR398a-3p31731.23chr2+169527758169527897138
Cd downregulated
zma-miR164d-3p_R+161−2.47chr7−172723300172723515214
PC-3p-74571_894−1.21chr2+2250375722503904142
PC-5p-167816_451−2.21chr8−103189069103189246135
PC-5p-395659_251−2.21chr1+296265246296265464216
PC-5p-76360_851−2.21chr1−5246427052464417103
PC-3p-65413_10101−3.34chr6+161474760161474953129
C1 and Cd1 mean the 1 h of Cd-untreated and -treated samples, respectively. The numbers under C1 and Cd1 represent the number of normalized miRNA reads (norm reads). Novel miRNAs are listed in italic font and Cd significantly regulated miRNAs are in bold font.
Table
Table 3. The function classification of the predicted cleavable targets of maize xylem miRNAs.
Table 3. The function classification of the predicted cleavable targets of maize xylem miRNAs.
Gene IDsFunctionmiRNA(s) $
Abiotic Stress
ZM2g053531 Wound-responsive proteinmiR164s
ZM2G129218 DNAJ heat family proteinmiR1432s
ZM2G134917 DNAJ homolog1 chaperonemiR395s
ZM2G456000 ERD, early-responsive to dehydrationmiR396s
ZM2g042295 SAM-dependent methyltransferasePC-5p-87289_7
Phytohormone
ZM2G159399ZM2G081406AC207656.3_FG002auxin response factormiR160s
ZM2G078274 auxin response factormiR6253s
ZM2g137451ZM5g848945ZM2G135978auxin signaling F-boxmiR393s
ZM2g095786 F-box protein FBX14MIR159s
ZM2G019799 aldehyde oxidase3PC-3p-172602_4
Secondary Metabolism
ZM2G336337ZM2G388587ZM2G164467laccaseMIR397s
ZM2G094375ZM2G305526ZM2G400390
ZM2G072780ZM2G072808ZM2G447271
ZM2G145029 isopentenyl pyrophosphate isomerase2PC-3p-158678_4
Metal Handling, Chelation, and Storage
ZM2G085301 Major facilitator superfamily proteinmiR166s
ZM2G166976 Major facilitator superfamily proteinmiR827s
ZM2G148937 MATE efflux family proteinmiR528s
ZM2G058032 Heavy-metal-associated domainmiR399s
ZM2G407032 ABC transporter I family member 1
ZM2G000039 SIT4 phosphatase-associated proteinmiR171s
Transcription Factors
ZM2G033356 bHLH-transcription factor, bHLH130PC-3p-151371_4
AC193786.3_FG005 bHLH-transcription factor, Bhlh154MIR159s
ZM2G027960 Zinc finger protein WIP6
ZM2G399098 AP2-EREBP-transcription factor 124
ZM2G048450ZM2G111711 WRKY-transcription factor
ZM2G093789ZM2G416652ZM2G167088MYB transcription factor
ZM2G423833ZM2G075064ZM2G376684
ZM2G046443ZM2G070523ZM2G139688
ZM2G004090ZM2G028054 MYB transcription factormiR159s, miR319s
ZM2G127490ZM2G171781 MYB transcription factorPC-5p-76360_8
ZM2G305856ZM2G096358 MYB transcription factormiR164s
ZM2G139700ZM2G393433ZM2G114850NAC-transcription factor
ZM2G063522ZM2G146380
ZM2G003509ZM2G042250ZM2G178102Homeobox-transcription factormiR166s
ZM2G469551ZM2G109987AC187157.4_FG005Homeobox-transcription factor
Signaling
ZM2g012584 IQ-domainmiR164s
ZM2G104730 Calcium-transporting ATPase 9miR169s
ZM2G107575 calcineurin B-like1PC-3p-89447_7
ZM2G312661 Calcium-binding protein CML42PC-3p-327923_2, PC-3p-100706_6
ZM2G174315 CaM-binding heat-shock proteinPC-3p-513669_2
ZM2G100454 Protein kinasePC-5p-442461_2
ZM2G391794ZM2G061447ZM2G146346LRR receptor-like kinaseMIR159s
ZM2G304745 LRR receptor-like kinasemiR390s
ZM2G145756ZM2G082522 Protein kinasemiR167s
$ label means miRNA family members, designated as miRs.
Table
Table 4. The cleavable targets of maize xylem miRNAs.
Table 4. The cleavable targets of maize xylem miRNAs.
miRNATargetpsRNAtargetDPMINDAnnotation (maizeGDB)
Exp *UPEmiRDeg $
zma-miR394a-5pZM2G064954_T01023.11zma-miR394a-5p2LOC103636344 F-box only protein
ZM2G119650_T01022.971LOC100193727, F-box domain
zma-miR393b-5p_R-1ZM2G135978_T01118.85zma-miR393b-5p1transport inhibitor response 1-like
zma-miR390a-5pZM2G155490_T0129.90zma-miR390a-5p1GRMZM2G155490
ZM2G304745_T01121.541LOC103648480 LRR receptor-like kinase
zma-miR827-5p_L+1ZM2G044788_T012.520.66zma-miR827-5p1LOC100274914
zma-miR160f-5p_1ss21GAAC207656.3_FGT002024.06zma-miR160f-5p1arftf19, ARF-transcription factor
ZM2G081406_T01122.151arftf15
ZM2G159399_T01021.942arftf17
zma-miR159a-3p_R-1ZM2G028054_T031.516.12zma-miR159a-3p1myb74 transcription factor
zma-miR319a-3p_R+1116.03zma-miR319a-3p2
zma-miR159a-3p_R-1ZM2G139688_T01217.18zma-miR159a-3p3myb138
gma-miR171m_1ss21ACZM2G098800_T010.523.32zma-miR171m-3p1gras80 transcription factor
sbi-MIR171h-p30.523.321
osa-MIR171a-p3023.32zma-miR171n-3p1
zma-MIR171f-p30.523.52zma-miR171f-3p3
zma-miR166a-3pZM2G109987_T04124.23zma-miR166a-3p2rld1, rolled leaf, Homeobox
osa-miR166a-3p_1ss21CTZM2G042250_T0423.53zma-miR166c-3prld2
zma-miR166l-3pZM2G469551_T0219.01zma-miR166l-3phb69, Homeobox-transcription factor
lus-miR169a_R-1ZM2G000686_T06218.96zma-miR169h6nfya1 nuclear transcription factor Y
zma-miR169a-5p_R-1ZM2G040349_T01218.79zma-miR169a-5p2ca2p4, NFY/CCAAT-HAP2-transcription factor
zma-miR169f-5p_R-1_1ss1TGZM2G091964_T022.520.96zma-miR169f-5p7ca2p16
zma-miR169i-5p_R-1ZM2G038303_T01216.87zma-miR169i-5p6ca2p15
zma-miR169l-5pZM5G857944_T032.517.47zma-miR169l-5p6ca2p13
zma-miR169o-5p_R-1ZM5G853836_T012.520.94zma-miR169o-5p4ca2p5
osa-miR169b_R+1ZM5G857944_T03217.47zma-miR169c-5p6ca2p13
ZM2G067624_T02116.26 7sbp29, squamosa promoter binding protein
bdi-miR156b-5p_R+2ZM2G097275_T0421.87zma-miR156i-5p1sbp27
osa-miR156a_R+1ZM2G113779_T0114.23zma-miR156a-5p5sbp13
zma-miR156a-5pZM2G126018_T0118.45zma-miR156a-5p1sbp23
zma-miR156j-5p_R-1ZM2G126827_T0122.70zma-miR156j-5p1sbp12
zma-miR156k-5pZM2G156621_T0122.70zma-miR156k-5p1sbp31
zma-miR529-5pZM2G307588_T0116.69zma-miR529-5p1tsh4, tassel sheath4, SBP
ZM2G371033_T0118.52 3sbp18
ZM5G878561_T0119.13 3sbp22
ZM2G460544_T0120.77 1ub3, unbranched3, SBP
zma-miR529-5pZM2G160917_T010.522.12zma-miR529-5p1ub2, unbranched2
The miRNAs in italic and those maize transcripts between parallel lines mean each of the miRNAs can target each transcript successively. psRNAtarget output: Exp for Maximum expectation and the star (*) indicating the largest score of the corresponding miRNA-target combinations, unpaired energy (UPE) for maximum energy to unpaired target site; For DPMIND, miR represents the homolog of the queried miRNA by BLAST, and the dollar label ($) means the least number of the degradome datasets for the miR-target associations.

Share and Cite

MDPI and ACS Style

Wang, B.; Cheng, D.; Chen, Z.; Zhang, M.; Zhang, G.; Jiang, M.; Tan, M. Bioinformatic Exploration of the Targets of Xylem Sap miRNAs in Maize under Cadmium Stress. Int. J. Mol. Sci. 2019, 20, 1474. https://doi.org/10.3390/ijms20061474

AMA Style

Wang B, Cheng D, Chen Z, Zhang M, Zhang G, Jiang M, Tan M. Bioinformatic Exploration of the Targets of Xylem Sap miRNAs in Maize under Cadmium Stress. International Journal of Molecular Sciences. 2019; 20(6):1474. https://doi.org/10.3390/ijms20061474

Chicago/Turabian Style

Wang, Baoxiang, Dan Cheng, Ziyan Chen, Manman Zhang, Guoqiang Zhang, Mingyi Jiang, and Mingpu Tan. 2019. "Bioinformatic Exploration of the Targets of Xylem Sap miRNAs in Maize under Cadmium Stress" International Journal of Molecular Sciences 20, no. 6: 1474. https://doi.org/10.3390/ijms20061474

APA Style

Wang, B., Cheng, D., Chen, Z., Zhang, M., Zhang, G., Jiang, M., & Tan, M. (2019). Bioinformatic Exploration of the Targets of Xylem Sap miRNAs in Maize under Cadmium Stress. International Journal of Molecular Sciences, 20(6), 1474. https://doi.org/10.3390/ijms20061474

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop