Next Article in Journal
Microbe-Host Communication by Small RNAs in Extracellular Vesicles: Vehicles for Transkingdom RNA Transportation
Previous Article in Journal
Trypanosoma brucei Interaction with Host: Mechanism of VSG Release as Target for Drug Discovery for African Trypanosomiasis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 20
Issue 6
10.3390/ijms20061485
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Comparative Study of Biological Characteristics and Transcriptome Profiles of Mesenchymal Stem Cells from Different Canine Tissues

by
Xiao-Shu Zhan
1,
Saeed El-Ashram
1,2,
Dong-Zhang Luo
1,
Hui-Na Luo
1,
Bing-Yun Wang
1,*,
Sheng-Feng Chen
1,*,
Yin-Shan Bai
1,
Zhi-Sheng Chen
1,
Can-Ying Liu
1 and
Hui-Qin Ji
1
1
School of Life Science and Engineering, Foshan University, Foshan 528231, China
2
Faculty of Science, Kafrelsheikh University, Kafr el-Sheikh 33516, Egypt
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2019, 20(6), 1485; https://doi.org/10.3390/ijms20061485
Submission received: 23 February 2019 / Revised: 18 March 2019 / Accepted: 21 March 2019 / Published: 25 March 2019
(This article belongs to the Section Molecular Biology)
Browse Figures
Versions Notes

Abstract

:
Mesenchymal stem cells (MSCs) are the most promising seed cells for cell therapy. Comparing the biological and transcriptome gene characteristics of MSCs from different sources provides an important basis for the screening of clinically used cells. The main purpose of this experiment was to establish methods for the isolation and culture of MSCs from five different canine sources, including adipose tissue, bone marrow, umbilical cord, amniotic membrane, and placenta, and compare biological and transcriptome characteristics of MSCs, in order to provide a basis for the clinical application of canine MSCs. MSCs were isolated from Chinese pastoral dogs, and the following experiments were performed: (1) the third, sixth, and ninth generations of cells were counted, respectively, and a growth curve was plotted to calculate the MSC population doubling time; (2) the expression of CD34 and CD44 surface markers was studied by immunofluorescence; (3) the third generation of cells were used for osteogenetic and adipogenic differentiation experiments; and (4) MSC transcriptome profiles were performed using RNA sequencing. All of the five types of MSCs showed fibroblast-like adherent growth. The cell surface expressed CD44 instead of CD34; the third-generation MSCs had the highest proliferative activity. The average population doubling time of adipose mesenchymal stem cells (AD-MSCs), placenta mesenchymal stem cells (P-MSCs), bone marrow mesenchymal stem cells (BM-MSCs), umbilical cord mesenchymal stem cells (UC-MSCs), and amniotic mesenchymal stem cells (AM-MSCs) were 15.8 h, 21.2 h, 26.2 h, 35 h, and 41.9 h, respectively. All five types of MSCs could be induced to differentiate into adipocytes and osteoblasts in vitro, with lipid droplets appearing after 8 days and bone formation occurring 5 days after AD-MSC induction. However, the multilineage differentiation for the remaining of MSCs was longer compared to that of the AD-MSCs. The MSC transcriptome profiles showed that AD-MSC and BM-MSCs had the highest homology, while P-MSCs were significantly different compared to the other four types of MSCs. All the isolated MSCs had the main biological characteristics of MSCs. AD-MSCs had the shortest time for proliferation, adipogenesis, and osteogenic differentiation.

Graphical Abstract

1. Introduction

Mesenchymal stem cells (MSCs) are a type of adult stem cells derived from the mesoderm. MSCs were first discovered by Friedenstein and his colleagues in mouse bone marrow cultures half a century ago [1]. Later, the cells were isolated from a number of adult tissues, including adipose tissue [2], pulp [3], and postpartum discarded tissue, such as umbilical cord [4,5,6], placenta [7], amniotic membrane [8], and cord blood [9]. MSCs lack unique cell membrane surface markers, and can be identified by three biological characteristics: adherent properties, a series of cell-specific expression of cell surface markers, and multilineage differentiation potential [10]. The rise in high-throughput sequencing technologies in the past few years has made it possible to understand MSCs at the molecular level, and further tap the potentials of MSCs.
Humans have owned dogs as companions for thousands of years. With improving living standards worldwide, dog health has improved, and the life span of dogs has increased. Improved dog health and longevity can be ascribed to advanced diagnostic and veterinary treatment procedures [11,12,13]. In addition, dogs have become an ideal animal experimental model, because they have developed nervous and digestive systems [14,15,16], as well as a number of physiological characteristics that are similar to humans [17]. As a result, dogs are often used in drug development clinical trials [18,19]. Current traditional medical treatments have a poor effect in curing numerous dog diseases and injuries, including nerve damage, kidney damage, hepatitis, and diabetes. Therefore, the scientists are constantly exploring new medical tools [14,20,21,22,23]. The emergence of stem cell therapy brings new hope for the treatment of these diseases [24,25]. The homing and low immunogenicity of MSC make them ideal seed cells for stem cell therapy [26]. However, MSC application-based research has been mostly from human and murine sources, and there has been less research on dog MSCs. What remains unclear is whether dog MSCs have the same biological characteristics as other sources. In addition, previous studies have addressed two or three different sources of MSCs; however, this study was conducted to systematically compare the most common five different sources of MSCs. Therefore, accelerating the study of the biological characteristics of canine MSCs will provide a theoretical basis for the clinical selection and use of MSCs, and bring new hope for the veterinary field and translational medicine. MSCs not only have repair and therapeutic effects in viral and injurious diseases, but also have diagnostic and therapeutic effects in metabolic diseases, such as obesity and pregnancy-related diseases [27,28,29]. The overall aim of this study was to investigate growth characteristics and the proliferative capacity of MSCs derived from adipose, bone marrow, umbilical cord, placenta, and amnion. Furthermore, adipogenic and osteogenic differentiation, as well as the transcriptome profile of MSCs was studied to provide baseline data on canine MSCs, which may be used in follow-up clinical cell therapies.

2. Results

2.1. Isolation and Primary Culture of Mesenchymal Stem Cells

After 48 h of primary culture, a small number of adhered cells could be observed in all of the five types of cells. Initially, the cell morphologies were uneven, showing short spindles or polygons (Figure 1A–E). The cell-forming clones were scattered in the bottom of the dish. Adipose mesenchymal stem cells (AD-MSCs) reached 90% confluence on the fifth day, while the other cells reached confluence around the tenth day (Figure 1F–J).
The cell morphologies were subsequently fibrous or fusiform. After the passaging of the cells, the proliferation rate of the cells increased exponentially, and the cell morphologies were relatively uniform (i.e., they could be considered pure MSCs). Therefore, P3 cells were used in the subsequent experiments.

2.2. Growth Curve and Population Doubling Time of Mesenchymal Stem Cells

As can be seen from Figure 2, the proliferation of MSCs was not significant at 1 to 2 days after passage. However, MSCs entered the logarithmic growth phase from the third to the sixth day and entered the plateau phase at the seventh day. According to the growth curve of P3 cells, the mean population doubling times of AD-MSCs, placenta mesenchymal stem cells (P-MSCs), bone marrow mesenchymal stem cells (BM-MSCs), umbilical cord mesenchymal stem cells (UC-MSCs), and amniotic mesenchymal stem cells (AM-MSCs) were 15.8 ± 0.318 h, 21.2 ± 0.629 h, 26.2 ± 0.242 h, 35 ± 0.588 h, and 41.9 ± 0.954 h, respectively. There were significant differences among the groups (p < 0.01). The population doubling time (PDT) of AD-MSC was significantly lower than that of the other four types of MSCs, indicating that AD-MSC has the fastest cell growth rate and the strongest cell proliferative ability when cultivated in vitro.

2.3. Mesenchymal Stem Cell Immunofluorescence Results

The immunofluorescence identification revealed that all five MSC types expressed CD44 (Figure 3A–E), but not CD34 (Figure 3F–J).

2.4. Adipogenic and Osteogenic Differentiation Results

After three days of osteogenic induction, the shapes of the cells changed from fibers to polygons and scales. Calcium nodules appeared in the AD-MSCs, P-MSCs, UC-MSCs, AM-MSCs, and B-MSCs after 5, 7, 8, and 9 days of induction, respectively. All five types of MSCs were stained with alizarin red on the tenth day of induction. All MSCs showed red mineralized deposits (Figure 4A–E).
After adipogenic differentiation, the changes in the five types of MSCs were similar, and the cells had gradually shortened and rounded from their original typical fibrous shape. Initially, there were more dead cells in the induced differentiation. However, after a later stage of cell differentiation they became stable.
Lipid droplets were observed in AD-MSCs and BM-MSCs after 8 and 12 days of induced differentiation, respectively After two weeks of induced differentiation, small scattered droplets were observed in UC-MSCs, AM-MSCs, and B-MSCs. After one more week of induction, the lipid droplets became larger and their number increased. Oil red O staining showed that the lipid droplets were stained red (Figure 4F–J). The above results indicate that AD-MSCs have the fastest growth rate of the tested cells in osteogenic and adipogenic differentiation.

2.5. Expression of Surface Marker Genes on Five Types of Mesenchymal Stem Cells in Dogs

In this research, the fragments per kilobase of exon model per million reads mapped (FPKM) values of the five types of MSCs (under the same experimental conditions) were considered as the final reference values. The results, as shown in Table 1, indicate that canine MSCs not only express three surface markers—CD73, CD90, and CD105—as defined by the International Society for Cell Therapy (ISCT), but also express CD13, CD44, CD49a, CD54, CD140a, CD140b, and MHC I (FPKM > 1), but not CD11a, CD11b, CD14, CD19, CD33,CD34, CD45, CD86, CD 146, CD 271, or MHC (FPKM < 1). However, due to the lack of suitable antibodies, some of these genes have not been detected at the protein level.

2.6. Cluster Analysis of Differentially Expressed Genes

This study investigated the changes in gene expression of the gene expression profile of five types of MSCs. The unsupervised hierarchical clustering of our complete RNA-Seq transcriptome data was performed to compare the expression pattern of differential expression genes in the five groups. The clustering heat map reveals that UC-MSC and AM-MSC, as well as BM-MSC and AD-MSC gene expression levels were similar, while P-MSC gene expression levels were significantly different from those the other four types (UC-MSC, AM-MSC, BM-MSC, and AD-MSC) (Figure 5).

2.7. Transcriptome Sequencing Analysis

The transcriptome sequencing results (see Supplementary Material) showed that perinatal-derived MSCs (AM-MSCs, UC-MSCs, and P-MSCs) and body-derived MSCs (BM-MSCs and AD-MSCs) shared 94 up-regulated and 150 down-regulated genes, respectively. Typical differentially expressed genes are listed in Table 2.

2.8. Validation of Transcriptome Results by Quantitative Reverse Transcriptase-PCR

Differential and non-differentiated genes in each group were selected for qRT-PCR analysis to validate transcriptome data, and the results showed a consistent trend with Illumina sequencing data, indicating the reliability of comparative analysis of our transcriptome (Figure 6).

3. Discussion

Basic research on stem cells has made the development of novel biopharmaceuticals, cell therapy, regenerative medicine, and tissue engineering possible [5]. Although pluripotent embryonic stem cells isolated from early embryos have the greatest potential, they face enormous technical challenges and ethical dilemmas [30,31]. To circumvent technical and ethical challenges that are associated with embryonic stem cells, adult MSCs have become an attractive alternative in stem cell research, because of their ability for self-renewal and multi-differentiation. Compared with embryonic stem cells, MSCs have multiple sources and lower immunogenicity, and avoid ethical and moral controversy.
In recent years, it has been found that adipose-derived MSCs have outstanding growth performance and differentiation potential [32], while MSCs derived from postpartum discarded tissues, such as the umbilical cord [4], placenta, and amniotic membrane are readily accessible with low cellular immunogenicity, and can be acquired from multiple sources. Therefore, MSCs have become a hot area of research [5,33]. Although a number of published reports on the biological characteristics of adipose-derived, umbilical cord, placenta, and amniotic membrane MSCs are available, the publications are mostly about human-derived MSCs [7,34]. The fact is that these cells were derived from different individuals and cultured in the different growth conditions, which have different influences on the characteristics of MSCs. To avoid problems associated with MSCs from different individuals that are cultivated in different conditions, in this study we successfully isolated MSCs from five types of canine tissues, including fat (adipose tissue), bone marrow, umbilical cord, amniotic membrane, and placenta (AD-MSC, BM-MSC, UC-MSC, AM-MSC, and P-MSC, respectively) from the same dog. The biological characteristics and gene expression of the five types of MSCs were compared.
All the five types of MSCs in this study were fibrous adherent cells. Since there is controversy regarding the identification of MSCs in the international community, this study used a series of criteria developed by the International Society for Cell Therapy (ISCT) to identify the isolated cells [35]. According to the immunofluorescence staining results, all the five types of MSCs expressed the hyaluronate receptor CD44, but did not express the hematopoietic stem cell marker CD34; in addition, all of MSCs were induced into adipocytes and osteoblasts. Therefore, cells isolated from these five types of tissues were identified as MSCs. A transcriptome profile has found that canine MSCs not only express CD73, CD90, and CD105, which is consistent with the internationally recognized characteristics of MSC surface protein expression [36], but they also express CD13, CD44, CD49a, CD73, CD140a, and CD140b, which is in accordance with the surface markers of human-derived mesenchymal stem cells [10,37,38]. In addition, our study found that canine MSCs express CD54 and MHCI surface markers, but do not express CD8, CD33, CD29 and MHCII surface markers, which is consistent with previous studies on canine MSC results [39,40,41]. Interestingly, our study showed that canine MSCs did not express CD146 and CD271, in contrast to a report by Boxall et al. [42], which showed that CD146 and CD271 could be produced by human bone marrow mesenchymal stem cells. BM-MSCs were used as the gold standard for the comparison of the biological characteristics of other MSCs [32]. These controversial results may be ascribed to differences in the expression of MSC surface markers in different species. This study has shown that to a certain extent, there are differences in the growth performance and differentiation potential of MSCs from different tissue sources in vitro. According to the growth curve analysis, as the number of passages increased, both the growth rate and the number of MSC cells decreased, which is in line with those of previous reports [32,43].
We compared MSCs from the same generation, but from five different sources, and found that AD-MSC cells had the highest proliferation activity in vitro. On average, the number doubled every day. Additionally, MSCs still sustained good activity after 15 passages. Our results are similar to those obtained by Keith A et al. [32,44]. Our results showed that AD-MSC cells were the smallest volume among the five types of MSCs, implying that relatively more cells are needed by AD-MSCs to achieve saturation density in the proliferation process. Furthermore, the growth curve showed that AD-MSC cell density exceeded other MSCs, and was mainly associated with the high expression of AD-MSC in cell division-associated protein 8 (CDCA8) and cyclin B2 (CCNB2) [9]. Additionally, the expression of CDCA8 and CCNB2 in AD-MSC was higher than that of MSCs from other sources, but whether this may be the reason for the rapid proliferation of AD-MSC remains to be further explored. In addition to the ability of proliferation, differentiation is another important feature of MSCs. Differentiation is characterized by dramatic changes in the size, morphology, membrane potential, and the metabolic activity of cells [45].The results of this experiment showed that the five types of MSCs can be differentiated into adipocytes, with AD-MSC having a significant advantage for lipid droplets to form and increase in numbers. The results of osteogenic differentiation showed that AD-MSC, followed by P-MSC, needed the shortest amount of time to form calcium nodules. Moreover, all the five types of MSCs had a high rate calcium nodule formation.
Based on the results of transcriptome sequencing, the five types of MSCs were divided into two groups: body-derived MSCs (bone marrow and fat MSCs) and perinatal-derived MSCs (placenta, amnion, and umbilical cord MSCs). Analysis and comparison of differential gene expression between the two groups of MSCs indicated that different genes may be involved in different biological processes and signaling pathways. Differential gene analysis showed that 94 genes and 150 genes in body-derived MSCs were up-regulated and down-regulated, respectively, in comparison between the two groups. Typical genes with down-regulated expression were APOE, CDKN1A, and THBS1, and those with up-regulated expression included TFPI2, DPT, and FBN1. Liu et al. have demonstrated that apolipoprotein APOE can process and transport fatty acids to nerve cells to protect neurons [46]. Overexpression of the cyclin-dependent kinase inhibitor 1A (CDKN1A) causes cell cycle arrest, thus inhibiting cell proliferation [47].It has been proven that THBS1 plays a role in platelet aggregation and angiogenesis, while PHLDA1 has been shown to be involved in the anti-apoptotic process of IGF1 [48]. DIO3 regulates the circulating fetal thyroid hormone concentration during pregnancy, and thus prevents the premature exposure of fetal tissue to high levels of thyroid hormone [49]. Due to the special function of the perinatal tissue to breed the fetus, DIO3 is highly expressed in the perinatal-source MSCs. The product of the H19 gene is a long non-coding RNA that acts as a tumor suppressor. The TGFBI protein is induced by transforming growth factor-β, and can inhibit cell adhesion [50]. Mutation of this gene is associated with various types of corneal dystrophy. We observed that perinatal-derived MSCs, compared with body-derived MSCs, had lower proliferation activity and lower viscosity, which means they are more suitable for the treatment of nerve injury, thyroid hormone abnormalities, and so on. They also promote the speed of coagulation and angiogenesis, and are anti-apoptotic.
Among the up-regulated gene expression in body-derived MSCs, the TFPI2 gene has been identified as a tumor suppressor gene in several types of cancers [51]; DPT is a kind of extracellular matrix protein, which is considered to be the communication link between the surface and extracellular matrix environment of dermal fibroblasts. The control of TGF-beta bioavailability and the calibration of TGF-beta and BMP levels can adjust osteoblast maturation [52], which suggests that the high osteogenic differentiation efficiency of body-derived MSCs in previous studies may be connected with their own high expression. S100A16 is a kind of calcium-binding protein that binds one calcium ion per monomer [53]. It can promote the differentiation of adipocytes (in vitro). The overexpression in preadipocytes increases their proliferation, enhances adipogenesis, and reduces insulin-stimulated glucose uptake [54]. This result is also consistent with previous adipogenic differentiation experiments. Intriguingly, body-derived MSCs have a remarkable ability for proliferation and adipogenic differentiation in vitro. These differences may provide a basis for the selection of MSCs in later clinical treatment, and make accurate treatment possible.
Although dogs are important animal models and domestic companion pets, only a few studies have documented the comparison of the biological criteria and transcriptome profile of canine MSCs. Comparative experiments showed that AD-MSC, P-MSC, AM-MSC, and UC-MSCs have similar biological properties with BM-MSCs, such as fibrous adherent growth, expression of cell surface marker CD44, non-expression of CD34, and osteogenesis and adipogenic differentiation. Therefore, we suggested that in follow-up clinical trials, postpartum tissue-derived MSCs offers a better choice than BM-MSCs. The transcriptome sequencing results showed that the gene expression pattern of P-MSCs is significantly different from that of the other four types of MSCs, which may be connected to their biological functions used to nourish the fetus. Furthermore, body-derived MSCs and perinatal-derived MCSs had their own particular characteristics, to achieve accuracy in the treatment in which stem cell therapy is applied.

4. Materials and Methods

4.1. Animals

Dog adipose tissue, bone marrow, umbilical cord, placenta, and amniotic membrane were used in this experiment. All tissues were collected from the same adult Chinese rural dogs. All studies were approved by the Animal Ethics Committee of Foshan University, and were conducted in accordance with the ethical standards of the university. The project identification code is FSUeae2018006, and the approval date is 10 March, 2018.

4.2. Primary Culture of the Mesenchymal Stem Cell

For adipose mesenchymal stem cells (AD-MSCs), about 1 cm3; of adipose tissue was removed from the canine abdomen and washed with Phosphate Buffered Saline (PBS, Hyclon, Logan City, UT, USA) containing 5% Penicillin Streptomycin (Pen-Strep, Hyclon, America). The tissue was then minced and digested with 1 mg/mL of collagenase type I (Sigma, St.,Louis, MO, USA) at 37 °C for 1 h. After filtration through a 100-mesh cell strain, the filtrate was centrifuged for 5 min to collect AD-MSCs. The pellet was re-suspended into Dulbecco’s Modified Eagle Media (DMEM, Hyclon, Logan City, UT, USA) complete medium (DMEM basic medium with 10% fetal bovine serum, 1% Pen-Strep, and 1% L-glutamine) and transferred into cell culture dishes (Corning, New York, NY, USA).
For the bone marrow mesenchymal stem cells (BM-MSC), the canine bone marrow fluid was extracted aseptically into an anticoagulant tube and diluted with PBS. The dilution was loaded onto Ficoll solution in a centrifugation tube. After 20 min of centrifugation, the white cloudy layer formed by the nucleated cells was carefully sucked out, washed with DMEM, and centrifuged for 5 min. At last, the cell pellet was resuspended in complete medium, and transferred into cell culture dishes.
For the umbilical cord mesenchymal stem cells (UC-MSC), umbilical cord tissue was carefully isolated from postpartum discarded tissue of a female canine. Then, the UC-MSCs were obtained as AD-MSCs, with a prolonged digestion time of collagenase up to 6 h.
To obtain amniotic mesenchymal stem cells (AM-MSCs) and placenta mesenchymal stem cells (P-MSCs), amniotic membrane and placental tissue were carefully isolated from postpartum discarded tissue and minced into small pieces. Then, the tissues were incubated in 0.25% trypsin for 30 min in a 37 °C water bath before FBS was applied to stop the digestion. Again, the primary AM-MSCs and P-MSCs were isolated as described above.
All five MSCs were cultivated in DMEM complete medium containing 10% fetal bovine serum (FBS, BI, Kibbutz Beit-Haemek, Israel), 1% L-glutamine (Hyclon, Logan City, UT, USA), and Pen-Strep. The medium was changed after 48 h of primary culture, and then non-adherent cells were washed away with PBS. The medium was changed every 3 days, until the cells were overgrown for passage. The growth of the cells was observed daily.

4.3. Cell Growth Curve Production

P2, P5, and P8 of MSCs from 5 different sources were digested with trypsin and inoculated into 24-well plates at a concentration of 1 × 104 cells/mL, and cultured at 37 °C in a 5% CO2 incubator. Three wells were randomly selected and counted after digestion “at the same time” each day for 8 days. The solution of the undigested wells was changed every 3 days. To create a growth curve, the number of days was plotted along on the abscissa and the number of cells on the ordinate.

4.4. Calculating Population Doubling Time

To compare the MSC proliferation rates, the following formula was used to calculate the cell population doubling time (PDT).
PDT = t × [lg2/(lgNt − lgN0)]
where t is the time for cell culture (unit: h), Nt is the number of cells after the culture (t), and N0 is the number of cells initially inoculated [55].

4.5. Cellular Immunofluorescence Assay

The third-generation cells were inoculated on gelatin-coated 24-well culture plates. After adherence of the cells, the medium was discarded. Then the cells were washed twice with PBS containing 5% FBS, and fixed with 4% paraformaldehyde (Regal, Shanghai, China) at room temperature for 30 min. At last, immunofluorescence was performed to identify the expression of cell surface markers CD34 and CD44 (abcam, Cambridge, UK) [56].

4.6. Adipogenic and Osteogenic Differentiation

4.6.1. Induction of Adipogenesis

P3 cells were seeded into 24-well plates at a density of 104 cells/mL. The original medium was discarded when the cells reached 70% of confluence. DMEM adipogenic medium containing 10% fetal bovine serum, 1 μmol/L of dexamethasone, 10 μg/mL of insulin, and 200 μmol/mL of indomethacin (All from Cyagen, Suzhou, Jiangsu, China) was added into the cells. The fluid was replaced every 3 days. When the formation of lipid droplets in the cytoplasm was observed, the medium was carefully discarded. The cells were washed gently with PBS twice, fixed in 4% paraformaldehyde for 20 min, stained with oil red O (Solarbio, Beijing, China) for 30 min, and observed and photographed under a microscope. The time needed by each MSC to form a lipid droplet was recorded.

4.6.2. Induction of Osteogenesis

P3 cells were seeded into 24-well plates at a density of 104 cells/mL. The original culture medium was discarded the second day, and the DMEM osteoblast induction culture medium containing 10% fetal bovine serum, 0.1 μmol/L of dexamethasone, 10 mmol/L of sodium glycerophosphate, and 50 μmol/L of ascorbic acid (All from Cyagen, Suzhou, Jiangsu, China) was added for culture induction. The fluid was changed every 3 days. When bone calcification nodules were observed, they were identified with alizarin red (Solarbio, Beijing, China) staining. The time for each type of MSC to form calcium nodules was recorded.

4.7. Transcriptome Sequencing of Mesenchymal Stem Cells

The third generation of MSC cells, which were isolated from the umbilical cord, amniotic membrane, placenta, adipose tissue, and bone marrow-derived MSCs, were cultivated under the same conditions. When they reached 80% of confluence, Trizol lysis was used to lyse the cells.
The total cellular RNA was extracted by the Universal RNA Extraction kit (TaKaRa, Japan) and done according to the procedure of El-Ashram et al. [57]. After RNA quantization and purification evaluation [58], the following procedures were performed:
(1)
The cDNA library for tanscriptome sequencing was prepared by the PCR method;
(2)
The TruSeq PE Clustering Kit of v3-c Bot-HS (Illumia) was used to cluster the index coded samples on the c-bot clustering generation system;
(3)
Purification of the raw data (raw readings) in FASTQ format was performed by an internal perl script, to obtain purified data of high quality for downstream analyses;
(4)
Reference genome and gene model annotation files were downloaded directly from the genome website (https://www.ncbi.nlm.nih.gov/genome/85?genome_assembly_id=313739, accessed on: 9 August 2016). The index of the reference genome was constructed by Hisat2 v2.0.4, which was also used to compare the paired-end purified reads and the reference genome;
(5)
For quantification of the expression level of genes, HTSeq v0.9.1 (Fabio Zanini, Stanford University, USA) was used to calculate the readings mapped to each gene. The FPKM of each gene was then calculated based on the length of the gene, and the readings localized to that gene were calculated too;
(6)
The DEGSeq R software package (1.20.0) (Bioconductor, Stanford University, USA) was used for differential expression analysis, and the Benjamini and Hochberg method was used for the adjustment of the p value. A corrected p value of 0.005 and log2 (fold change) was set to 1, as a threshold for a significant difference expression.

4.8. Quantitative Reverse Transcriptase-PCR Analysis

By random selection, eight genes that were overexpressed or repressed from each group, and without differential expression, were chosen for verification by quantitative RT-PCR, which was performed as follows: the total RNA was extracted using a MiniBEST Universal RNA Extraction kit (TaKaRa, Japan, Code No:9767), and reverse-transcribed employing a PrimeScript RT reagent kit (TaKaRa, Japan, Code No:RR047A); an SYBR green-based RT-PCR was conducted by using TB Green Premix Ex Taq II (TaKaRa, Japan, Code No:RR820A), according to the instructions made by the manufacturer. The primers were synthesized by Invitrogen, Shanghai, China. The qRT-PCR primer sequences are described in Table 3. The results were expressed as fold changes [59]. A correlation analysis was performed between the RNA-Seq and RT-PCR fold change results of the same RNA samples before pooling, using Graphpad Software (San Diego, CA, United States). Additionally, experiments were conducted in triplicate, and data are displayed as mean ± SD [60].

5. Conclusions

We successfully isolated canine umbilical cord- adipose tissue-, amniotic membrane-, placenta-, and bone marrow-derived mesenchymal stem cells. All five cells showed fibrous adherent status, and expressed CD44 surface marker but not CD34. Five types of MSCs could differentiate into osteoblast and adipocyte. Among the five different sources of MSCs, AD-MSC had higher adipogenic differentiation efficiency than the other four types. Furthermore, AD-MSC had the best proliferative activity and the shortest population doubling time.

Supplementary Materials

Supplementary materials can be found at https://www.mdpi.com/1422-0067/20/6/1485/s1.

Author Contributions

Conceptualization, B.-Y.W. and Z.-S.C.; Formal analysis, X.-S.Z. and H.-N.L.; Funding acquisition, B.-Y.W. and S.-F.C.; Investigation, X.-S.Z., D.-Z.L. and H.-N.L.; Methodology, X.-S.Z., S.E.-A., and Y.-S.B.; Project administration, B.-Y.W., Y.-S.B. and H.-Q.J.; Resources, B.-Y.W.; Software, S.-F.C. and C.-Y.L.; Writing—original draft, X.-S.Z. and D.-Z.L.; Writing—review and editing, S.E.-A.

Funding

This study is supported by Natural Science Foundation of Guangdong (Grant NO: 2017A030313171).

Acknowledgements

We are grateful to Xu Zhang, who help typed the manuscript and give the useful discussion.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

MSCsMesenchymal stem cells
AD-MSCsAdipose Mesenchymal Stem Cells
AM-MSCsAmniotic Mesenchymal Stem Cells
BM-MSCsBone Marrow Mesenchymal Stem Cells
P-MSCsPlacenta Mesenchymal Stem Cells
UC-MSCsUmbilical Cord Mesenchymal Stem Cells
PDTpopulation doubling time
APOEApolipoprotein E
HSP90AA1heat shock protein 90 alpha family class A member 1
IGFBP4insulin like growth factor binding protein 4
THBS1thrombospondin 1
PDGFRAplatelet derived growth factor receptor alpha

References

  1. Friedenstein, A.J.; Gorskaja, J.F.; Kulagina, N.N. Fibroblast precursors in normal and irradiated mouse hematopoietic organs. Exp. Hematol. 1946, 4, 267–274. [Google Scholar]
  2. Liu, Y.; Goldberg, A.J.; Dennis, J.E.; Gronowicz, G.A.; Kuhn, L.T. One-step derivation of mesenchymal stem cell (MSC)-like cells from human pluripotent stem cells on a fibrillar collagen coating. PLoS ONE 2012, 7, e33225. [Google Scholar] [CrossRef] [PubMed]
  3. Asutay, F.; Acar, H.A.; Yolcu, U.; Kirtay, M.; Alan, H. Dental stem cell sources and their potentials for bone tissue engineering. J. Istanb. Univ. Fac. Dent. 2015, 49, 51–56. [Google Scholar] [CrossRef]
  4. Dong, H.; Li, G.; Shang, C.; Yin, H.; Luo, Y.; Meng, H.; Li, X.; Wang, Y.; Lin, L.; Zhao, M. Umbilical cord mesenchymal stem cell (UC-MSC) transplantations for cerebral palsy. Am. J. Transl. Res. 2018, 10, 901–906. [Google Scholar]
  5. Beeravolu, N.; McKee, C.; Alamri, A.; Mikhael, S.; Brown, C.; Perez-Cruet, M.; Chaudhry, G.R. Isolation and characterization of mesenchymal stromal cells from human umbilical cord and fetal placenta. J. Vis. Exp. 2017. [Google Scholar] [CrossRef]
  6. Han, Z.C. Umbilical cord mesenchymal stem cells (UC-MSC: Biology, banking and clinical applications). Bull. Acad. Natl. Med. 2009, 193, 545–547. [Google Scholar]
  7. Heo, J.S.; Choi, Y.; Kim, H.S.; Kim, H.O. Comparison of molecular profiles of human mesenchymal stem cells derived from bone marrow, umbilical cord blood, placenta and adipose tissue. Int. J. Mol. Med. 2016, 37, 115–125. [Google Scholar] [CrossRef]
  8. Ling, L.; Feng, X.; Wei, T.; Wang, Y.; Wang, Y.; Zhang, W.; He, L.; Wang, Z.; Zeng, Q.; Xiong, Z. Effects of low-intensity pulsed ultrasound (LIPUS)-pretreated human amnion-derived mesenchymal stem cell (hAD-MSC) transplantation on primary ovarian insufficiency in rats. Stem Cell Res. Ther. 2017, 8, 283. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Wagner, W.; Wein, F.; Seckinger, A.; Frankhauser, M.; Wirkner, U.; Krause, U.; Blake, J.; Schwager, C.; Eckstein, V.; Ansorge, W.; et al. Comparative characteristics of mesenchymal stem cells from human bone marrow, adipose tissue, and umbilical cord blood. Exp. Hematol. 2005, 33, 1402–1416. [Google Scholar] [CrossRef]
  10. Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.; Krause, D.; Deans, R.; Keating, A.; Prockop, D.; Horwitz, E. Minimal criteria for defining multipotent mesenchymal stromal cells. The international society for cellular therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef] [PubMed]
  11. Putterman, A.B.; Trumpatori, B.; Mathews, K.G. Successful vascularized jejunal patch graft to treat severe orad duodenal injury secondary to foreign body obstruction in a dog. Vet. Surg. 2019. [Google Scholar] [CrossRef] [PubMed]
  12. Costa, D.; Leiva, M.; Sanz, F.; Espejo, V.; Esteban, J.; Vergara, J.; Diaz, C.; Huguet, E.; Cairo, M.; Rios, J.; et al. A multicenter retrospective study on cryopreserved amniotic membrane transplantation for the treatment of complicated corneal ulcers in the dog. Vet. Ophthalmol. 2019. [Google Scholar] [CrossRef] [PubMed]
  13. Ciccarelli, S.; Di Bello, A.; Valastro, C.; Leo, C.; Lenoci, D.; Rana, E.; Franchini, D. Unilateral renal cystadenocarcinoma and nodular dermatofibrosis in a mixed-breed dog carrying a FLCN gene mutation. Vet. Dermatol. 2019. [Google Scholar] [CrossRef]
  14. Shionoya, Y.; Sunada, K.; Tsujimoto, G.; Shigeno, K.; Nakamura, T. Ethanol-induced cervical sympathetic ganglion block applications for promoting canine inferior alveolar nerve regeneration using an artificial nerve. J. Vis. Exp. 2018, 141, e58039. [Google Scholar] [CrossRef]
  15. Marolf, V.; Rohrbach, H.; Bolen, G.; Van Wijnsberghe, A.S.; Sandersen, C. Sciatic nerve block in dogs: Description and evaluation of a modified ultrasound-guided parasacral approach. Vet. Anaesth. Analg. 2019, 46, 106–115. [Google Scholar] [CrossRef] [PubMed]
  16. Cui, X.; Lei, P.; Liu, S.; Liu, X.; Wu, Z.; Lv, Y. A sutureless method for digestive tract reconstruction during pancreaticoduodenectomy in a dog model. Int. J. Clin. Exp. Med. 2015, 8, 289–296. [Google Scholar] [PubMed]
  17. Regan, D.; Garcia, K.; Thamm, D. Clinical, pathological, and ethical considerations for the conduct of clinical trials in dogs with naturally occurring cancer: A comparative approach to accelerate translational drug development. ILAR J. 2019. [Google Scholar] [CrossRef]
  18. Goto, A.; Hagiwara-Nagasawa, M.; Kambayashi, R.; Chiba, K.; Izumi-Nakaseko, H.; Naito, A.T.; Kanda, Y.; Sugiyama, A. Measurement of J-tpeakc along with QT-interval prolongation may increase the assay sensitivity and specificity for predicting the onset of drug-induced torsade de pointes: Experimental evidences based on proarrhythmia model animals. Cardiovasc. Toxicol. 2019. [Google Scholar] [CrossRef] [PubMed]
  19. Rosenthal, M.G.; Labato, M.A. Use of therapeutic plasma exchange to treat nonsteroidal anti-inflammatory drug overdose in dogs. J. Vet. Intern. Med. 2019. [Google Scholar] [CrossRef] [PubMed]
  20. Scholz, D.; Schuldt, H.H.; Althaus, P.; Schroder, K.; Mebel, M. Clinical and experimental results on the significance of kidney damage for long-term prognosis after kidney transplantation. Zeitschrift Urol. Nephrol. 1979, 72, 875–883. [Google Scholar]
  21. Kortum, A.J.; Cloup, E.A.; Williams, T.L.; Constantino-Casas, F.; Watson, P.J. Hepatocyte expression and prognostic importance of senescence marker p21 in liver histopathology samples from dogs with chronic hepatitis. J. Vet. Intern. Med. 2018, 32, 1629–1636. [Google Scholar] [CrossRef]
  22. Lawrence, Y.A.; Dangott, L.J.; Rodrigues-Hoffmann, A.; Steiner, J.M.; Suchodolski, J.S.; Lidbury, J.A. Proteomic analysis of liver tissue from dogs with chronic hepatitis. PLoS ONE 2018, 13, e208394. [Google Scholar] [CrossRef] [PubMed]
  23. Moshref, M.; Tangey, B.; Gilor, C.; Papas, K.K.; Williamson, P.; Loomba-Albrecht, L.; Sheehy, P.; Kol, A. Concise review: Canine diabetes mellitus as a translational model for innovative regenerative medicine approaches. Stem Cells Transl. Med. 2019. [Google Scholar] [CrossRef] [PubMed]
  24. Lee, S.H.; Setyawan, E.; Choi, Y.B.; Ra, J.C.; Kang, S.K.; Lee, B.C.; Kim, G.A. Clinical assessment after human adipose stem cell transplantation into dogs. J. Vet. Sci. 2018, 19, 452–461. [Google Scholar] [CrossRef] [PubMed]
  25. Yang, Y.; Lin, S.; Wang, B.; Gu, W.; Li, G. Stem cell therapy for enhancement of bone consolidation in distraction osteogenesis: A contemporary review of experimental studies. Bone Joint Res. 2017, 6, 385–390. [Google Scholar] [CrossRef] [PubMed]
  26. Corradetti, B.; Taraballi, F.; Martinez, J.O.; Minardi, S.; Basu, N.; Bauza, G.; Evangelopoulos, M.; Powell, S.; Corbo, C.; Tasciotti, E. Hyaluronic acid coatings as a simple and efficient approach to improve MSC homing toward the site of inflammation. Sci. Rep. 2017, 7, 7991. [Google Scholar] [CrossRef]
  27. Iaffaldano, L.; Nardelli, C.; D’Alessio, F.; D’Argenio, V.; Nunziato, M.; Mauriello, L.; Procaccini, C.; Maruotti, G.M.; Martinelli, P.; Matarese, G.; et al. Altered bioenergetic profile in umbilical cord and amniotic mesenchymal stem cells from newborns of obese women. Stem Cells Dev. 2018, 27, 199–206. [Google Scholar] [CrossRef] [PubMed]
  28. Capobianco, V.; Caterino, M.; Iaffaldano, L.; Nardelli, C.; Sirico, A.; Del, V.L.; Martinelli, P.; Pastore, L.; Pucci, P.; Sacchetti, L. Proteome analysis of human amniotic mesenchymal stem cells (hA-MSCs) reveals impaired antioxidant ability, cytoskeleton and metabolic functionality in maternal obesity. Sci. Rep. 2016, 6, 25270. [Google Scholar] [CrossRef] [Green Version]
  29. Fuchi, N.; Miura, K.; Doi, H.; Li, T.S.; Masuzaki, H. Feasibility of placenta-derived mesenchymal stem cells as a tool for studying pregnancy-related disorders. Sci. Rep. 2017, 7, 46220. [Google Scholar] [CrossRef]
  30. Pera, M.F. Scientific considerations relating to the ethics of the use of human embryonic stem cells in research and medicine. Reprod. Fertil. Dev. 2001, 13, 23–29. [Google Scholar] [CrossRef]
  31. Espinoza, N.; Peterson, M. How to depolarise the ethical debate over human embryonic stem cell research (and other ethical debates too!). J. Med. Ethics 2012, 38, 496–500. [Google Scholar] [CrossRef] [PubMed]
  32. Aliborzi, G.; Vahdati, A.; Mehrabani, D.; Hosseini, S.E.; Tamadon, A. Isolation, characterization and growth kinetic comparison of bone marrow and adipose tissue mesenchymal stem cells of Guinea pig. Int. J. Stem Cells 2016, 9, 115–123. [Google Scholar] [CrossRef] [PubMed]
  33. Prakoeswa, C.; Pratiwi, F.D.; Herwanto, N.; Citrashanty, I.; Indramaya, D.M.; Murtiastutik, D.; Sukanto, H.; Rantam, F.A. The effects of amniotic membrane stem cell-conditioned medium on photoaging. J. Dermatolog. Treat. 2018. [Google Scholar] [CrossRef] [PubMed]
  34. Hakki, S.S.; Turac, G.; Bozkurt, S.B.; Kayis, S.A.; Hakki, E.E.; Sahin, E.; Subasi, C.; Karaoz, E. Comparison of different sources of mesenchymal stem cells: Palatal versus lipoaspirated adipose tissue. Cells Tissues Organs 2017, 204, 228–240. [Google Scholar] [CrossRef]
  35. Baghaei, K.; Hashemi, S.M.; Tokhanbigli, S.; Asadi, R.A.; Assadzadeh-Aghdaei, H.; Sharifian, A.; Zali, M.R. Isolation, differentiation, and characterization of mesenchymal stem cells from human bone marrow. Gastroenterol. Hepatol. Bed Bench 2017, 10, 208–213. [Google Scholar]
  36. Samsonraj, R.M.; Raghunath, M.; Nurcombe, V.; Hui, J.H.; van Wijnen, A.J.; Cool, S.M. Concise review: Multifaceted characterization of human mesenchymal stem cells for use in regenerative medicine. Stem Cells Transl. Med. 2017, 6, 2173–2185. [Google Scholar] [CrossRef]
  37. Rider, D.A.; Nalathamby, T.; Nurcombe, V.; Cool, S.M. Selection using the alpha-1 integrin (CD49a) enhances the multipotentiality of the mesenchymal stem cell population from heterogeneous bone marrow stromal cells. J. Mol. Histol. 2007, 38, 449–458. [Google Scholar] [CrossRef] [PubMed]
  38. Andersen, D.C.; Kortesidis, A.; Zannettino, A.C.; Kratchmarova, I.; Chen, L.; Jensen, O.N.; Teisner, B.; Gronthos, S.; Jensen, C.H.; Kassem, M. Development of novel monoclonal antibodies that define differentiation stages of human stromal (mesenchymal) stem cells. Mol. Cells 2011, 32, 133–142. [Google Scholar] [CrossRef] [PubMed]
  39. Lee, K.S.; Nah, J.J.; Lee, B.C.; Lee, H.T.; Lee, H.S.; So, B.J.; Cha, S.H. Maintenance and characterization of multipotent mesenchymal stem cells isolated from canine umbilical cord matrix by collagenase digestion. Res. Vet. Sci. 2013, 94, 144–151. [Google Scholar] [CrossRef]
  40. Martinello, T.; Bronzini, I.; Maccatrozzo, L.; Mollo, A.; Sampaolesi, M.; Mascarello, F.; Decaminada, M.; Patruno, M. Canine adipose-derived-mesenchymal stem cells do not lose stem features after a long-term cryopreservation. Res. Vet. Sci. 2011, 91, 18–24. [Google Scholar] [CrossRef]
  41. Screven, R.; Kenyon, E.; Myers, M.J.; Yancy, H.F.; Skasko, M.; Boxer, L.; Bigley, E.R.; Borjesson, D.L.; Zhu, M. Immunophenotype and gene expression profile of mesenchymal stem cells derived from canine adipose tissue and bone marrow. Vet. Immunol. Immunopathol. 2014, 161, 21–31. [Google Scholar] [CrossRef]
  42. Boxall, S.A.; Jones, E. Markers for characterization of bone marrow multipotential stromal cells. Stem Cells Int. 2012, 2012, 975871. [Google Scholar] [CrossRef] [PubMed]
  43. Kang, T.J.; Yeom, J.E.; Lee, H.J.; Rho, S.H.; Han, H.; Chae, G.T. Growth kinetics of human mesenchymal stem cells from bone marrow and umbilical cord blood. Acta Haematol. 2004, 112, 230–233. [Google Scholar] [CrossRef] [PubMed]
  44. Russell, K.A.; Chow, N.H.; Dukoff, D.; Gibson, T.W.; LaMarre, J.; Betts, D.H.; Koch, T.G. Characterization and immunomodulatory effects of canine adipose tissue- and bone marrow-derived mesenchymal stromal cells. PLoS ONE 2016, 11, e167442. [Google Scholar] [CrossRef]
  45. Bojnordi, M.N.; Azizi, H.; Skutella, T.; Movahedin, M.; Pourabdolhossein, F.; Shojaei, A.; Hamidabadi, H.G. Differentiation of spermatogonia stem cells into functional mature neurons characterized with differential gene expression. Mol. Neurobiol. 2017, 54, 5676–5682. [Google Scholar] [CrossRef]
  46. Liu, L.; Li, X.; Li, Y.; Guan, Y.; Song, Y.; Yin, L.; Chen, H.; Lei, L.; Liu, J.; Li, X.; et al. Effects of nonesterified fatty acids on the synthesis and assembly of very low density lipoprotein in bovine hepatocytes in vitro. J. Dairy Sci. 2014, 97, 1328–1335. [Google Scholar] [CrossRef] [PubMed]
  47. Zheng, B.; Liu, F.; Zeng, L.; Geng, L.; Ouyang, X.; Wang, K.; Huang, Q. Overexpression of pyruvate kinase type M2 (PKM2) promotes ovarian cancer cell growth and survival via regulation of cell cycle progression related with upregulated CCND1 and downregulated CDKN1A expression. Med. Sci. Monit. 2018, 24, 3103–3112. [Google Scholar] [CrossRef]
  48. Moncada, D.L.R.C.; Radziwon-Balicka, A.; El-Sikhry, H.; Seubert, J.; Ruvolo, P.P.; Radomski, M.W.; Jurasz, P. Pharmacologic protein kinase Calpha inhibition uncouples human platelet-stimulated angiogenesis from collagen-induced aggregation. J. Pharmacol. Exp. Ther. 2013, 345, 15–24. [Google Scholar] [CrossRef]
  49. Hernandez, A.; Stohn, J.P. The type 3 deiodinase: Epigenetic control of brain thyroid hormone action and neurological function. Int. J. Mol. Sci. 2018, 19, 1804. [Google Scholar] [CrossRef]
  50. Irigoyen, M.; Anso, E.; Salvo, E.; Dotor, D.L.H.J.; Martinez-Irujo, J.J.; Rouzaut, A. TGFbeta-induced protein mediates lymphatic endothelial cell adhesion to the extracellular matrix under low oxygen conditions. Cell. Mol. Life Sci. 2008, 65, 2244–2255. [Google Scholar] [CrossRef]
  51. Cao, Y.; Guo, C.; Yin, Y.; Li, X.; Zhou, L. Lysinespecific demethylase 2 contributes to the proliferation of small cell lung cancer by regulating the expression of TFPI2. Mol. Med. Rep. 2018, 18, 733–740. [Google Scholar]
  52. Zhang, Y.D.; Zhao, S.C.; Zhu, Z.S.; Wang, Y.F.; Liu, J.X.; Zhang, Z.C.; Xue, F. Cx43- and smad-mediated TGF-beta/ BMP signaling pathway promotes cartilage differentiation of bone marrow mesenchymal stem cells and inhibits osteoblast differentiation. Cell. Physiol. Biochem. 2017, 42, 1277–1293. [Google Scholar] [CrossRef] [PubMed]
  53. Sturchler, E.; Cox, J.A.; Durussel, I.; Weibel, M.; Heizmann, C.W. S100A16, a novel calcium-binding protein of the EF-hand superfamily. J. Biol. Chem. 2006, 281, 38905–38917. [Google Scholar] [CrossRef] [PubMed]
  54. Liu, Y.; Zhang, R.; Xin, J.; Sun, Y.; Li, J.; Wei, D.; Zhao, A.Z. Identification of S100A16 as a novel adipogenesis promoting factor in 3T3-L1 cells. Endocrinology 2011, 152, 903–911. [Google Scholar] [CrossRef]
  55. Ofner, D.; Hittmair, A.; Marth, C.; Ofner, C.; Totsch, M.; Daxenbichler, G.; Mikuz, G.; Margreiter, R.; Schmid, K.W. Relationship between quantity of silver stained nucleolar organizer regions associated proteins (Ag-NORs) and population doubling time in ten breast cancer cell lines. Pathol. Res. Pract. 1992, 188, 742–746. [Google Scholar] [CrossRef]
  56. Zhang, B.Y.; Wang, B.Y.; Li, S.C.; Luo, D.Z.; Zhan, X.; Chen, S.F.; Chen, Z.S.; Liu, C.Y.; Ji, H.Q.; Bai, Y.S.; et al. Evaluation of the curative effect of umbilical cord mesenchymal stem cell therapy for knee arthritis in dogs using imaging technology. Stem Cells Int. 2018, 2018, 1983025. [Google Scholar] [CrossRef]
  57. El-Ashram, S.; Al, N.I.; Suo, X. Nucleic acid protocols: Extraction and optimization. Biotechnol. Rep. 2016, 12, 33–39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. El-Ashram, S.; Li, C.; Abouhajer, F.; Mehmood, R.; Al, N.I.; Zhang, Y.; Lu, T.; Yili, D.; Suo, X.; Haoji, Z.; et al. An ex vivo abomasal ovine model to study the immediate immune response in the context of Haemonchus contortus larval-stage. Vet. Parasitol. 2018, 254, 105–113. [Google Scholar] [CrossRef]
  59. Mata-Perez, C.; Sanchez-Calvo, B.; Begara-Morales, J.C.; Luque, F.; Jimenez-Ruiz, J.; Padilla, M.N.; Fierro-Risco, J.; Valderrama, R.; Fernandez-Ocana, A.; Corpas, F.J.; et al. Transcriptomic profiling of linolenic acid-responsive genes in ROS signaling from RNA-seq data in Arabidopsis. Front. Plant. Sci. 2015, 6, 122. [Google Scholar] [CrossRef]
  60. El-Ashram, S.; Al, N.I.; El-Kemary, M.; Mehmood, R.; Hu, M.; Suo, X. Early and late gene expression profiles of the ovine mucosa in response to Haemonchus contortus infection employing Illumina RNA-seq technology. Parasitol. Int. 2017, 66, 681–692. [Google Scholar] [CrossRef]
Ijms 20 01485 g001 550
Figure 1. Adherence and primary growth of five types of mesenchymal stem cells (MSCs) from different sources (100×): adipose mesenchymal stem cells (AD-MSCs), placenta mesenchymal stem cells (P-MSCs), bone marrow mesenchymal stem cells (BM-MSCs), umbilical cord mesenchymal stem cells (UC-MSCs), and amniotic mesenchymal stem cells (AM-MSCs). Morphology of mesenchymal stem cells in primary culture for 48 h (A–E). Status of mesenchymal stem cells in primary culture to obtain full adherent (F–J).
Figure 1. Adherence and primary growth of five types of mesenchymal stem cells (MSCs) from different sources (100×): adipose mesenchymal stem cells (AD-MSCs), placenta mesenchymal stem cells (P-MSCs), bone marrow mesenchymal stem cells (BM-MSCs), umbilical cord mesenchymal stem cells (UC-MSCs), and amniotic mesenchymal stem cells (AM-MSCs). Morphology of mesenchymal stem cells in primary culture for 48 h (A–E). Status of mesenchymal stem cells in primary culture to obtain full adherent (F–J).
Ijms 20 01485 g001
Ijms 20 01485 g002 550
Figure 2. The growth curves of MSCs: (A) third generation, (B) sixth generation, and (C) ninth generation.
Figure 2. The growth curves of MSCs: (A) third generation, (B) sixth generation, and (C) ninth generation.
Ijms 20 01485 g002
Ijms 20 01485 g003 550
Figure 3. Immunofluorescent identification of five MSC types (100×). All five types of MSCs positively express CD44 surface markers (A–E) and negatively express CD34 surface markers (F–J).
Figure 3. Immunofluorescent identification of five MSC types (100×). All five types of MSCs positively express CD44 surface markers (A–E) and negatively express CD34 surface markers (F–J).
Ijms 20 01485 g003
Ijms 20 01485 g004 550
Figure 4. Results of osteogenic and adipogenic differentiation of the five types of MSCs. (A–E) Alizarin Red staining, 100×; (F–J): Oil Red O staining, 200×.
Figure 4. Results of osteogenic and adipogenic differentiation of the five types of MSCs. (A–E) Alizarin Red staining, 100×; (F–J): Oil Red O staining, 200×.
Ijms 20 01485 g004
Ijms 20 01485 g005 550
Figure 5. Dendrogram and unsupervised hierarchical clustering heat map (using Euclidean distance) of gene expression, based on the log ratio fragments per kilobase of exon model per million reads mapped (FPKM) data. Each column represents an experimental condition; each row represents a gene. For differentially expression genes, their log2 (RPKM) will be clustered. Red indicates up-regulation, and blue indicates down-regulation. The vertical distances on each branch of the dendrogram represent the degree of similarity between gene expression profiles of the five MSC groups.
Figure 5. Dendrogram and unsupervised hierarchical clustering heat map (using Euclidean distance) of gene expression, based on the log ratio fragments per kilobase of exon model per million reads mapped (FPKM) data. Each column represents an experimental condition; each row represents a gene. For differentially expression genes, their log2 (RPKM) will be clustered. Red indicates up-regulation, and blue indicates down-regulation. The vertical distances on each branch of the dendrogram represent the degree of similarity between gene expression profiles of the five MSC groups.
Ijms 20 01485 g005
Ijms 20 01485 g006 550
Figure 6. Validation of RNA-Seq data by employing qRT-PCR for the expression of Apolipoprotein E (APOE); heat shock protein 90, alpha family class A member 1 (HSP90AA1); insulin-like growth factor binding protein 4 (IGFBP4); thrombospondin 1(THBS1); and platelet-derived growth factor receptor alpha (PDGFRA). X-axis: gene name; Y-axis: log2 fold change in gene expression in each group (A–K).
Figure 6. Validation of RNA-Seq data by employing qRT-PCR for the expression of Apolipoprotein E (APOE); heat shock protein 90, alpha family class A member 1 (HSP90AA1); insulin-like growth factor binding protein 4 (IGFBP4); thrombospondin 1(THBS1); and platelet-derived growth factor receptor alpha (PDGFRA). X-axis: gene name; Y-axis: log2 fold change in gene expression in each group (A–K).
Ijms 20 01485 g006
Table
Table 1. Test results of the expression of canine MSC surface marker genes.
Table 1. Test results of the expression of canine MSC surface marker genes.
Surface MarkerGene SymbolGene NameGene IDExpression in MSC
CD11aITGALintegrin subunit alpha L489905-
CD11bITGAMintegrin subunit alpha M489928-
CD13ANPEPalanyl aminopeptidase, membrane403913+
CD14CD14CD14 molecule607076-
CD19CD19CD19 molecule607898-
CD33CD33myeloid cell surface antigen CD33100686511-
CD34CD34CD34 molecule415130-
CD44CD44CD44 molecule403939+
CD45PTPRCprotein tyrosine phosphatase, receptor type C490255-
CD49aITGA1integrin subunit alpha 1489210+
CD54ICAM1intercellular adhesion molecule 1403975+
CD73NT5ENT5E 5′-nucleotidase ecto474984+
CD86CD86CD86 molecule403764-
CD90THY-1Thy-1 cell surface antigen489365+
CD105ENGendoglin609166+
CD140aPDGFRAplatelet derived growth factor receptor alpha442860+
CD140bPDGFRBplatelet derived growth factor receptor beta442985+
CD146MCAMmelanoma cell adhesion molecule489368-
CD271NGFRnerve growth factor receptor491071-
MHC IDLA88MHC class I DLA-88474836+
MHC IIDLA-DQA1major histocompatibility complex, class II, DQ alpha 1474861-
Note: “+”indicates that gene has expression level(FPKM ≥ 1); “-”indicates that gene has no expression level (FPKM < 1).
Table
Table 2. Differences in differentially expressed genes (FPKM) between body-derived MSCs and perinatal-derived MSCs.
Table 2. Differences in differentially expressed genes (FPKM) between body-derived MSCs and perinatal-derived MSCs.
Gene IDSymbolGene NameGene Expression in Body-Derived MSCs (FPKM)Gene Expression in Perinatal-Derived MSCs (FPKM)
BM-MSCsAD-MSCsUC-MSCsAM-MSCsP-MSCs
down-regulated genes
476438APOEapolipoprotein E19.48230703173.66543751567.5066327989.110095546.5077788
474890CDKN1Acyclin dependent kinase inhibitor 1A61.9542303343.52563608236.4243181121.066431218.6291872
487486THBS1thrombospondin 1119.3758949125.01782981524.233918888.00580281051.135618
480221RPL17ribosomal protein L1775.7185871582.25616537721.1519554826.9961484638.3271764
475792ACTG2actin, gamma 2, smooth muscle, enteric6.3999185240.414750909351.1864758766.518074137.3140666
100856417RASL11ARAS like family 11 member A0.8762011271.40855383680.0949342629.3313239673.6109411
611312PHLDA1pleckstrin homology like domain family A member 123.2842161112.87378946310.0875622595.7103922192.2748208
612596DIO3iodothyronine deiodinase 34.0549521040136.8582098427.3538336243.7423875
100271858H19H19, imprinted maternally expressed transcript (non-protein coding)0.1616684920.681456125881.4958725379.238254887.40665754
100855619IGFBP3insulin like growth factor binding protein 30.4269668270.014979892439.8998024353.5566142162.0637504
478256FSIP1fibrous sheath interacting protein 141.9567680639.66236813507.9665302240.06563353.193685
481519TGFBItransforming growth factor beta induced22.965171335.26254056200.9835386178.8766204205.2200716
up-regulated genes
475230TFPI2tissue factor pathway inhibitor 21898.736999266.73457814.76556902432.9619181844.31133656
490355DPTdermatopontin309.4514262236.979741527.2098899421.2301975857.24591462
478293FBN1fibrillin 1289.0483951397.515858187.9711521847.341957654.44982126
609105PRRX1paired related homeobox 1277.7767982277.845883562.837257235.1788424352.27789448
490458S100A16S100 calcium binding protein A16134.3591612141.55461251.85323628628.0676991211.59700716
Table
Table 3. Primer sequences used for qRT-PCR.
Table 3. Primer sequences used for qRT-PCR.
Gene SymbolProduct LengthTemperaturePrimer Sequence
APOE16359.49 °CF: GGTGAAGATGGAGGAGCAGG
R: CTTAGAGGTGGGGATGGTGG
COX119858.93 °CF: GGTCAGCCCGGTACTTTACT
R: TGGAGGAAGGAGTCAGAAGC
HSP90B116458.58 °CF: GCAGTTTGGTGTCGGTTTCT
R: TAATTGTTGTTCCCCGTCCG
HSP90A19458.95 °CF: GTTCGGATGAGGAGGAGGAG
R: TGCCAAGTGATCTTCCCAGT
IGFBP419259.11 °CF: CCGGAAAACAGGAGTGAAGC
R: CCAGAGACAGAGCCAGGAC
PGS119058.64 °CF: CAGCCAGCAACCAATCACTA
R: CCTTTCCCCAGCATTCACAC
PDGFRA18759.03 °CF: ATCGAAGGCAGGCACATCTA
R: TGTACCACCCCATCATTGCT
THBS116059.09 °CF: GCGCTCCTGTGATAGTCTCA
R: GATCACACCATCACCACACG

Share and Cite

MDPI and ACS Style

Zhan, X.-S.; El-Ashram, S.; Luo, D.-Z.; Luo, H.-N.; Wang, B.-Y.; Chen, S.-F.; Bai, Y.-S.; Chen, Z.-S.; Liu, C.-Y.; Ji, H.-Q. A Comparative Study of Biological Characteristics and Transcriptome Profiles of Mesenchymal Stem Cells from Different Canine Tissues. Int. J. Mol. Sci. 2019, 20, 1485. https://doi.org/10.3390/ijms20061485

AMA Style

Zhan X-S, El-Ashram S, Luo D-Z, Luo H-N, Wang B-Y, Chen S-F, Bai Y-S, Chen Z-S, Liu C-Y, Ji H-Q. A Comparative Study of Biological Characteristics and Transcriptome Profiles of Mesenchymal Stem Cells from Different Canine Tissues. International Journal of Molecular Sciences. 2019; 20(6):1485. https://doi.org/10.3390/ijms20061485

Chicago/Turabian Style

Zhan, Xiao-Shu, Saeed El-Ashram, Dong-Zhang Luo, Hui-Na Luo, Bing-Yun Wang, Sheng-Feng Chen, Yin-Shan Bai, Zhi-Sheng Chen, Can-Ying Liu, and Hui-Qin Ji. 2019. "A Comparative Study of Biological Characteristics and Transcriptome Profiles of Mesenchymal Stem Cells from Different Canine Tissues" International Journal of Molecular Sciences 20, no. 6: 1485. https://doi.org/10.3390/ijms20061485

APA Style

Zhan, X. -S., El-Ashram, S., Luo, D. -Z., Luo, H. -N., Wang, B. -Y., Chen, S. -F., Bai, Y. -S., Chen, Z. -S., Liu, C. -Y., & Ji, H. -Q. (2019). A Comparative Study of Biological Characteristics and Transcriptome Profiles of Mesenchymal Stem Cells from Different Canine Tissues. International Journal of Molecular Sciences, 20(6), 1485. https://doi.org/10.3390/ijms20061485

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop