Next Article in Journal
Duplex DNA Retains the Conformational Features of Single Strands: Perspectives from MD Simulations and Quantum Chemical Computations
Next Article in Special Issue
The Neuroprotective Potentiality of Flavonoids on Alzheimer’s Disease
Previous Article in Journal
N-Terminally Lipidated Sialorphin Analogs—Synthesis, Molecular Modeling, In Vitro Effect on Enkephalins Degradation by NEP and Treatment of Intestinal Inflammation in Mice
Previous Article in Special Issue
Flavonoids as Antidiabetic and Anti-Inflammatory Agents: A Review on Structural Activity Relationship-Based Studies and Meta-Analysis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 23
Issue 22
10.3390/ijms232214451
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Luteolin on Biofilm of Trueperella pyogenes and Its Therapeutic Effect on Rat Endometritis

by
Luyao Zhang
†,
Yitong Cai
†,
Lishuang Li
,
Chen Chen
,
Hanyu Zhao
,
Zehui Zhang
,
Yaochuan Liu
,
Yingyu Wang
,
Chunlian Tian
and
Mingchun Liu
*
Key Laboratory of Livestock Infectious Diseases in Northeast China, Ministry of Education, College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Dongling Road 120, Shenyang 110866, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2022, 23(22), 14451; https://doi.org/10.3390/ijms232214451
Submission received: 4 October 2022 / Revised: 7 November 2022 / Accepted: 11 November 2022 / Published: 21 November 2022
(This article belongs to the Special Issue Flavonoids and Their Impact on Human Health)
Browse Figures
Review Reports Versions Notes

Abstract

:
Trueperella pyogenes is an opportunistic pathogen that causes suppurative infections in animals. The development of new anti-biofilm drugs will improve the current treatment status for controlling T. pyogenes infections in the animal husbandry industry. Luteolin is a naturally derived flavonoid compound with antibacterial properties. In this study, the effects and the mechanism of luteolin on T. pyogenes biofilm were analyzed and explored. The MBIC and MBEC of luteolin on T. pyogenes were 156 μg/mL and 312 μg/mL, respectively. The anti-biofilm effects of luteolin were also observed by a confocal laser microscope and scanning electron microscope. The results indicated that 312 μg/mL of luteolin could disperse large pieces of biofilm into small clusters after 8 h of treatment. According to the real-time quantitative PCR detection results, luteolin could significantly inhibit the relative expression of the biofilm-associated genes luxS, plo, rbsB and lsrB. In addition, the in vivo anti-biofilm activity of luteolin against T. pyogenes was studied using a rat endometritis model established by glacial acetic acid stimulation and T. pyogenes intrauterine infusion. Our study showed that luteolin could significantly reduce the symptoms of rat endometritis. These data may provide new opinions on the clinical treatment of luteolin and other flavonoid compounds on T. pyogenes biofilm-associated infections.

1. Introduction

Trueperella pyogenes (T. pyogenes) is often found on the skin surface and mucous membranes of healthy animals’ upper respiratory and urogenital tract. However, it can also develop into pathogenic bacteria in a certain state and infect livestock, wild animals, companion animals and human beings, resulting in suppurative infection of tissue and organ mucosa [1]. As a pathogen, T. pyogenes often colonizes the skin, oropharynx, respiratory tract, urogenital tract, gastrointestinal tract and other tissues and organs of domestic animals such as cattle, sheep and pigs, leading to multiple organ inflammation in livestock [2,3].
For cattle, the infection with T. pyogenes can cause hysteritis, endometritis, mastitis, liver abscess, suppurative arthritis and pneumonia [4,5,6,7,8]. Endometritis in dairy cattle is a common disease in veterinary clinics, with symptoms such as increased foetal spacing, decreased pregnancy rate, repeat breeding and even being eliminated in severe cases [9]. During calving, the opening of the cattle uterus may cause pathogenic bacterium such as E. coli, S. aureus, S. pyogenes and T. pyogenes, etc. to enter the uterus through the birth canal and lead to endometritis. Among various types of those bacteria, T. pyogenes was found to have a strong positive correlation with endometritis in dairy cows [10]. By analyzing the dynamics of uterine microbiota in dairy cow uterus contents, T. pyogenes was identified as the main species causing clinical endometritis in dairy cows [11]. For example, through screening 1386 dairy cows for clinical endometritis in Switzerland, Ernstberger and colleagues found 28% of the cows had been diagnosed with endometritis, and in these, one of the most predominant microorganisms was the gram-negative bacterium T. pyogenes, found in 29.7% of the affected cows [12].
Several studies have shown that pathogens, including T. pyogenes, could invade host cells and become resistant to antibiotics by forming biofilms [13,14]. About 80% of chronic infections in animals are associated with biofilm bacteria [15]. Biofilm-residing bacteria can even avoid the attack from the host immune system and lead to chronic infection and recurrent infection [16]. The utilization of antibiotics to treat infections caused by biofilms is not an ideal therapeutic solution due to their limited ability to inhibit the formation of biofilm bacteria, remove the mature biofilm bacteria and combat the persister cells in biofilm [17,18,19,20].
Chinese herbal medicine was considered a promising drug resource to treat the infections caused by biofilm in recent years due to its special antibacterial mechanism and little drug resistance. Flavonoids that showed excellent antibacterial activity against various resistant strains were found in a wide variety of Chinese herbs such as Reseda odorata, Scutellaria baicalensis Georg, Dendranthema morifolium and Sophora moorcroftiana, etc. [21]. Among those compounds, luteolin could inhibit the growth of T. pyogenes by influencing the integrity of the cell wall and cell membrane as well as the synthesis of nucleic acid and protein [22]. Luteolin can also increase the susceptibility of antimicrobial-resistant bacteria to antibiotics [23,24]. Moreover, luteolin performs a potent anti-biofilm function. The biofilm formation ability of E. coli, C. albicans and E. faecalis was significantly reduced after being treated with luteolin [25,26]. Our recent research indicated that luteolin could inhibit the ability of TatD DNases which are involved in the biofilm formation of T. pyogenes [27].
Herein, we report that when the T. pyogenes biofilms were treated with luteolin, their structure was modified, which was investigated and observed by confocal laser microscope and scanning electron microscope, as well as by studying the real-time quantitative PCR detection monitoring the changes in the various biofilm-related coding gene expressions of luxS, plo, rbsB and lsrB. In addition, luteolin also showed a significant anti-inflammatory effect on the rat endometritis model established by T. pyogenes.

2. Results

2.1. Anti-Biofilm Activity of Luteolin on T. pyogenes Biofilm

Previous research has shown that the minimum inhibitory concentrations (MICs) of luteolin against T. pyogenes isolates were in the range of 39–78 μg/mL, indicating that luteolin has a potent antimicrobial activity on planktonic T. pyogenes [22,23]. In this research, we further investigated the anti-biofilm activity of luteolin by measuring its minimum biofilm inhibitory concentrations (MBICs) and minimum biofilm eradication concentration against T. pyogenes. Our results showed that luteolin could suppress the formation ability of T. pyogenes biofilm and eliminate the maturely formed biofilm, with MBICs in the range of 78–156 μg/mL and the MBECs in the range of 156–312 μg/mL (Table 1).
The confocal laser scanning microscopy (CLSM) and scanning microscopy (SEM) analyses confirmed that there were differences in the T. pyogenes BMH06-3 biofilm formation in the presence of 39, 78 and 156 μg/mL of luteolin, in comparison to 0.25 ng/mL ceftiofur. Luteolin was tested at 1/2×, 1×, and 2 × MIC, whereas ceftiofur was tested at 1/2 × MIC. There was no significant difference between the blank control and solvent control groups (Figure 1b and Figure 2b). In the ceftiofur group, the number of killed bacteria in the biofilm were increased, and the depth of the biofilm was reduced significantly (Figure 1c and Figure 2c). However, in the presence of ceftiofur, the biofilm was still formed with a dense structure, indicating that ceftiofur was highly active in inhibiting T. pyogenes growth in its planktonic form but was less active against T. pyogenes in the biofilm state. The CLSM images exhibited that 39 μg/mL of luteolin had no significant effect on the formation of biofilm, but the SEM images showed a slight influence on the bacterial quantity (Figure 1d and Figure 2d). In contrast, the treatment with 78 μg/mL of luteolin resulted in a moderate proportion of killed bacteria in the T. pyogenes biofilm (Figure 2e). After exposure to 156 μg/mL of luteolin, almost no T. pyogenes biofilm structure could be observed, cells became scattered and only a few living bacteria remained (Figure 2f and Figure 1f).
The CLSM and SEM analyses were carried out to visualize the elimination effect of 312 μg/mL (4 × MIC) luteolin on 72 h T. pyogenes BMH06-3 biofilms. As shown in Figure 3c and Figure 4c, after exposure to ceftiofur (0.25 ng/mL) for 24 h the depth of biofilms became thinner, and a significant portion of the cells within the biofilms had been killed. However, the remaining bacteria still could form biofilms, indicating that ceftiofur could not completely remove the mature biofilms. Luteolin treatment of 72 h T. pyogenes biofilms was found time-dependent where the biofilms were treated with 312 μg/mL luteolin for 2, 4, 6, 8, 10, 12, 16, 20 and 24 h (Figure 3d–l). The biofilm thickness decreased, but no significant change was observed in the bacterial number after the 4 h treatment with luteolin (Figure 3d,e). The extension of the luteolin exposure (8 h) resulted in the dispersion of T. pyogenes biofilms. In addition, the depth of the biofilms was reduced to 1/3 of that of the blank group, revealing that luteolin could disperse large pieces of biofilms into small clusters after 8 h treatment (Figure 3f). The exposure of the biofilms with 312 μg/mL luteolin for 12 h caused greater biofilm disruption and a larger proportion of bacterial cell death (Figure 3h and Figure 4d). Almost no biofilm structure could be observed after treatment for 24 h, indicating that 312 μg/mL luteolin could completely disrupt and eliminate the mature T. pyogenes biofilms with prolonged treatment (Figure 3l and Figure 4f).

2.2. Effect of Luteolin on Biofilm-Associated Gene Expression of T. pyogenes

In order to assess the effect of 1/2 × MBIC luteolin on the biofilm-associated genes of T. pyogenes isolates, quantitative real-time PCR (qPCR) analysis was performed. The results revealed different degrees of downregulation of the expression of luxS (coding S-ribosylhomocysteine, related to bacterial quorum sensing), plo (coding Pyolysin O, pore-forming toxin), rbsB (Ribose import binding protein RbsB) and lsrB (Autoinducer 2-binding protein LsrB) (Figure 5). Compared with the solvent control group, the expression of plo and lsrB were down-regulated significantly to ~0.02–0.6-fold when exposed to luteolin. The relative expression of the plo gene in HC-H01-4 and BMH05-5 even decreased below 5%. The expression of luxS and rbsB genes in RY11-3 and HC-H13-2, respectively, were the lowest when treated with luteolin.

2.3. In Vivo Treatment of Luteolin on Rat Infectious of T. pyogenes (BMH06-3) Biofilm-Associated Endometritis

The T. pyogenes cells were inoculated into the rat uterus and the biofilm was formed on the lens in this model. To assess the rat model, the clinical symptoms of the rats were first studied. The endometritis model rats which developed a huddled and hunched posture showed inactivity, appetite and weight loss, messy and dull hair, and inflamed and moist vulva. The body temperature was significantly increased after the bacterial inoculation. Compared with the endometritis group (0.6491 ± 0.12), the uterine indexes (weight of uterus/body weight of rat × 100) of the ceftiofur group (0.3665 ± 0.09 **), luteolin H (0.1491 ± 0.03 **) and M (0.1484 ± 0.03 **) groups were significantly decreased.
The bacteria of the intrauterine fluid were isolated and cultured. The plo gene screening results showed that no pathogen was contained in the blank control group. In contrast, a large number of T. pyogenes was found in the model group (Figure S1). The CLSM examination result illustrated that a dense biofilm was formed maturely on the silicone hydrogel lenses of the control group (Figure 6a). After the treatment with ceftiofur, the number of dead bacteria increased significantly but the biofilm still formed thickly (Figure 6b). After the in vivo treatment with luteolin, the biofilms of the M and H luteolin groups were found loose and porous, but could not be disrupted completely (Figure 6d,e).
The rats in the treatment groups (M and H groups) showed weight gain after the luteolin administration. Table 2 presents the data on leukocyte formation before and following treatment in various groups. The total leukocyte count and neutrophil count were increased while the lymphocyte count was decreased significantly in the endometritis group (E), which indicates that the bacterial infection was serious after the T. pyogenes perfusion. After the treatment with a high concentration of luteolin (150 mg/kg b.w), the leukocyte, lymphocyte, monocyte and neutrophil count were all within the reference range, indicating that the bacterial infections of the rats in the H group had moved to the decline stage.
The anatomical form of the rat uterus in the control group did not adhere to the surrounding-tissue and was uniform in texture (Figure 7a). In the endometritis group, organs in the pelvis were adhesive and congested, and the uterus volume was greatly increased with obvious swelling and convoluted shape. The uterine wall was thinning, and the uterine lumen was filled with yellow pus (Figure 7b). The swelling of the uterus, as well as endometrial hyperemia and edema, could also be observed after the treatment of the low concentration of luteolin (50 mg/kg b.w) (Figure 7d and Figure 8d). The histopathologic analysis shows that the uterus of rats in the ceftiofur group presents vascular dilation and congestion phenomenon with a little inflammatory cell infiltration (Figure 8c). However, the uteruses of rats in the luteolin H and M groups only showed slight hyperemia and inflammatory cell infiltration, but the morphology was normal without obvious lesions (Figure 7e,f and Figure 8e,f).

3. Discussion

Most clinical pathogenic bacteria biofilm can form on the surface of various systems such as internal environment systems, synthetic materials, contact lenses, etc. [28]. The formation of biofilms also increases virulence and drug resistance, resulting in chronic or persistent infections in animals, and thus increasing the difficulty of treatment [29]. Most antimicrobial agents preferentially interact with the substrate of biofilm bacteria, leading to a significant increase in drug resistance [30]. The development of naturally derived antimicrobial agents to inhibit the formation of bacterial biofilm is expected to improve the effectiveness of clinical treatments or bacterial infectious diseases.
Luteolin as the representative of a kind of flavonoids, has outstanding anti-inflammatory, antibacterial, anti-tumor, anti-allergic and other pharmacological activities [22,31]. The anti-biofilm results in this study showed that the MBIC and MBEC values of Luteolin against Trueperella pyogenes (T. pyogenes) isolates were 78 or 156 µg/mL (2 × MIC) and 156 or 312 µg/mL (4 × MIC), respectively. After treatment with 156 μg/mL luteolin for 72 h, T. pyogenes could scarcely form biofilm. An amount of 312 μg/mL of luteolin could even eradicate the mature biofilm. However, for general antibiotics, the resistance of biofilm is 10–1000 times that of planktonic bacteria [32]. Compared with antibiotics, the potent anti-biofilm performance of luteolin is probably due to its multi-target, anti-bacterial mechanism against T. pyogenes [22,23,24].
The transcriptional levels of biofilm formation-related genes (luxS, plo, rbsB and lsrB) of T. pyogenes, with or without the treatment of luteolin, were analyzed to study the anti-biofilm mechanism of luteolin. The biofilm formation of T. pyogenes is partly dominated by the PloS/PlosR two-component regulatory system [33]. The qPCR result in this study showed that the plo gene-relative transcript level decreased significantly after luteolin treatment. Pyolysin (PLO), which belongs to a cholesterol-dependent cytolysin family, is considered the major virulence factor and a host-protective antigen of T. pyogenes [8]. Therefore, luteolin probably could reduce the virulence and inhibit the biofilm formation of T. pyogenes simultaneously by influencing the expression of plo, thus exerting its antimicrobial therapeutic effect. Furthermore, the mRNA transcription level of the luxS, rbsB and lsrB genes, which are related to the quorum-sensing system luxS/AI-2, was decreased to a certain extent after luteolin treatment [34,35]. The biofilm formation capacity of the ΔluxS strain was significantly weakened and the virulence and pathogenicity of the strain were also affected [36]. It is speculated that luteolin may affect the normal function of the LuxS/AI-2 Quorum sensing system of T. pyogenes by inhibiting the expression of luxS, rbsB and lsrB genes and giving play to anti-biofilm effects.
Endometritis was reported to partly result from a T. pyogenes infection of the endometrium in dairy cows [37]. In this study, a T. pyogenes isolate (BMH06-3), which was isolated from a cow with endometritis, was used to establish the endometritis model [27]. The uterine perfusion of the bacterial suspension will probably cause metritis or vaginitis instead of endometritis in a rat model. Therefore, in order to establish the rat endometritis model, 3% acetic acid was injected into uterus horns for 3 days to impair the uterus chemically prior to the bacterial perfusion in this study [38]. The injection of estradiol benzoate into the irritable parous rat was aimed at improving their tractability, which is necessary for further operation procedures. The animal experiment results indicated that luteolin shows a good therapeutic effect on T. pyogenes biofilm-associated rat endometritis.
Comparing the endometritis groups, the total leukocyte counts of the luteolin high and medium groups were significantly decreased to the standard range, demonstrating that the endometritis of rats induced by T. pyogenes was lightened by luteolin. However, the leukocyte populations of rats in the ceftiofur group had not returned to the reference level. The uterus morphology and histopathologic examination results showed that although the rat uterus of ceftiofur groups returned to normal size, the extravasated blood was still present in the rat uterus horn, whereas rats had improved conditions after the treatment with luteolin. Compared with ceftiofur, luteolin had a better therapeutic effect on T. pyogenes biofilm-associated endometritis, and possibly not only due to its antimicrobial and anti-biofilm effects. Luteolin could decrease the expression level of proinflammatory cytokines (TNF-a, IL-1b, and IL-6) and increase the level of IL-38 in rat inflammation models [39,40]. Therefore, the significant effect of luteolin treatment in this study may also be related to its extraordinary anti-inflammation function.
In summary, these results indicate that Luteolin is a promising anti-biofilm agent against T. pyogenes. Luteolin could significantly inhibit the expression of the biofilm-related coding genes luxS, plo, rbsB and lsrB. Luteolin also showed a potent therapeutic effect on the T. pyogenes biofilm-associated rat endometritis model. This study has provided new insight into the possible clinical application of naturally derived flavonoid compounds as well as their roles as potential candidates for anti-biofilm drug development.

4. Materials and Methods

4.1. Drug and Bacterial Strain Information

Luteolin with 98% purity was purchased from PureOne Biotechnology (Shanghai, China) and dissolved in 1% dimethyl sulfoxide (DMSO, Sigma–Aldrich, Shanghai, China) to produce a stock solution. Ceftiofur with 92.1% purity was purchased from Ryon biological technology (Shanghai, China). T. pyogenes isolates (Table 3) were collected from dairy cows with endometritis in Inner Mongolia, China which was mentioned previously [41]. The T. pyogenes strain (ATCC 19411) was selected as the reference strain. T. pyogenes strains were inoculated on Mueller-Hinton agar (MHA, Solarbio, Beijing, China) containing 5% (v/v) defibrinated sheep blood (Hopebio, Qingdao, China) and cultured in brain–heart infusion (BHI) medium (Solarbio, Beijing, China) supplemented with 8% (v/v) fetal bovine serum (FBS, Gibco, Grand Island, NE, USA).

4.2. Biofilm Susceptibility Test

For measuring the minimum biofilm inhibitory concentration (MBIC), the luteolin solutions from 19 to 5000 µg/mL were two-fold diluted were incubated with 105 CFU/mL of bacterial culture and placed in the wells of a 96-well plate (200 μL per well). After 24 h of incubation (at 37 °C and 200 rpm), when the biofilm was formed, each well was rinsed twice with PBS (pH 7.4, Solarbio, Beijing, China) to remove the planktonic bacterium. The attached biofilm in each well was scrapped and suspended in 250 μL of PBS. From each well, 10 μL of a mixture was inoculated on MHA plates with 5% blood. After being cultured at 37 °C for 24 h, the colony-forming units (CFU) of the test groups were compared with the medium control group. The lowest corresponding luteolin concentration, in which the recorded CFU is less than or equal to the solvent control group (0.01% DMSO), was defined as the minimum biofilm inhibitory concentration (MBIC).
For measuring the minimum biofilm eradication concentration (MBEC), a similar procedure was followed except that 200 μL of each bacterial culture was first seeded in a 96-well plate and incubated for 24 h (at 37 °C and 200 rpm) to form the biofilm. After the planktonic phase was removed, luteolin solutions in the standard concentrations were added to the biofilms that had formed in each well. After 24 h incubation, the biofilms were suspended and the CFU was recorded as described above for MBIC.

4.3. Biofilm Imaging

The intervention effects of luteolin on biofilm were observed by confocal laser scanning microscopy (CLSM) and scanning electron microscopy (SEM). For CLSM examination, the bacterial suspension (105 CFU/mL) was incubated in glass-bottom cell culture dishes (NEST, Wuxi, China) for 24 h. After rinsing twice with PBS (pH 7.2) to remove the planktonic bacterium, Syto-9—which stains DNA in all cells—and propidium iodide (PI)—which stains DNA only in dead cells (Invitrogen, Camarillo, CA, USA)—were incubated with the samples for 15 min according to the LIVE/DEAD BacLight Bacterial Viability Kit protocol. Images were captured with a confocal microscope (Leica Camera AG, Solms, Germany).
For the SEM examination, the bacterial suspension (105 CFU/mL) was incubated on cell slides in the 24-well plate for 72 h to form the mature biofilms. The cell slides were rinsed three times with PBS (pH 7.2), and further fixation was performed with 2.5% glutaraldehyde (Sigma, Shanghai, China) overnight at 4 °C at room temperature and then rinsed three times with PBS. Then, the sample was dehydrated in an ethanol gradient (50%, 70% and 90%, each for 10 min) followed by 100% ethanol twice for 10 min each time and finally dried. After platinum coating, samples were imaged using an electron microscope (HITACHI, Tokyo, Japan).
For both two microscopic visualizations, to observe the influence of luteolin on the formation of biofilm, the drug solutions (with final concentration at 8MIC, 4MIC and 2MIC) were added to the culture dishes or well plates together with the bacterial suspension. To observe the elimination of luteolin on biofilm, the luteolin solutions were added to the biofilms that had formed, followed by incubating for 2, 4, 6, 12, 18 and 24 h to obtain samples at different time points. DMSO (0.01%) and ceftiofur (0.25 μg/mL) served as the solvent control and positive medicine control.

4.4. Biofilm-Associated Gene Expression Analysis

Bacteria collected from biofilm with/without luteolin treatment were centrifuged for 10 min at 5000× g. Total RNAs from the biofilm were extracted and purified using the Trizol reagent as described by the manufacturer (Invitrogen, Carlsbad, CA, USA). The quality and integrity of RNAs were checked as described previously [24]. The cDNA of the total RNA was synthesized by using TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (Transgen, Beijing, China). The RT-PCR was performed using a TB Green® Premix Ex Taq™ II Kit (TaKaRa, Dalian, China) on an Applied Biosystems® QuantStudio® 3 Real-Time PCR System (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s instructions. The gapA of T. pyogenes in biofilm was used as a reference gene for comparison in qRT–PCR. The primer sequences are shown in Table 4. The qRT–PCR cycling conditions were as follows: 95 °C for 30 s and 45 cycles of 5 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C. The relative expression of the biofilm-related genes luxS, plo, rbsB and lsrB were normalized against that of gapA and quantified using the 2−ΔΔCt method.

4.5. Animal Experiment

To establish the rat T. pyogenes biofilm-associated endometritis model, female parous Sprague-Dawley (SD) rats (16–22 weeks of age) were purchased from Changsheng Biological Technology Co., Ltd. (Shenyang, China, Permit No.: SCXK (Liao) 2020-0001) and maintained under specific pathogen-free conditions for experiments. Before the bacteria infusion, the rats were intramuscularly injected with estradiol benzoate (0.1 mg/kg/day) for 3 days to cause artificial estrus [38]. For stimulation, 3% acetic acid was injected into uterus horns for 3 days. On day three, after the acetic acid stimulation, the rat uterine was inoculated with 2 mL bacterial suspension containing 1.0 × 109 CFU/mL of T. pyogenes (BMH06-3) by uterine perfusion daily for 3 days [42] A silicone hydrogel lens (Hydron, Shanghai, China) was implanted into the rat uterus after the first time of bacterial inoculation to form the biofilm [43]. After the induction of the endometritis model, the biofilm formed on the silicon hydrogel lenses was observed by CLSM to show its existence in the rat uterus. Meanwhile, the clinical symptoms, the body temperature, the white blood cell classification alterations, the bacterial content inside the uterus model, and the morphology and pathological alterations of the rat were observed to determine whether the model was induced successfully or not.
For the drug treatment, animals were randomly divided into six groups (n = 7): the control group (C), endometritis group (E), ceftiofur group (CE) and three different luteolin treatment groups (L, M and H). The control and endometritis groups were intraperitoneally given NaCl 0.9%. The ceftiofur group was treated with ceftiofur (1.5 mg/kg b.w) in an attempt to treat the uterine infection. Luteolin treatment groups were treated with luteolin (L, 50 mg/kg b.w; M, 100 mg/kg b.w; and H, 150 mg/kg b.w, respectively). All administrations were performed continuously for 3 days. Seventy-two hours after the last treatment, rats were killed by cervical dislocation after chloral hydrate anesthesia. The uterine tissue was isolated and the uterine index (uterine mass/animal mass × 100%) was calculated. About 2 cm in the middle of the uterine horn was cut and preserved with 4% paraformaldehyde (Dingguo, Beijing, China) and made into pathological sections. The intrauterine implanted silicon hydrogel was removed, stained with SYTO9/PI and observed with CLSM (Leica Camera AG, Solms, Germany). Meanwhile, blood samples were collected from rat tail veins and the routine tests were performed by an automatic hematology analyzer (HF-3000, Hanfang, Jinan, China). All animal procedures performed in the present study were conducted according to the animal husbandry guidelines of Shenyang Agricultural University. The Ethics Committee of Shenyang Agricultural University approved the laboratory animal experiments [Permit No.: SYXK (Liao) 2021-0010].

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms232214451/s1.

Author Contributions

M.L. and L.Z. conceived, wrote, reviewed, edited the manuscript, and designed the experiments. Y.C., L.L. and C.C. performed the experiments. H.Z. and Z.Z. analyzed the data. Y.L., Y.W. and C.T. contributed reagents, materials, and analysis tools. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (No. 31972736 and 32002344) and the Science & Technology Program of Liaoning Province (No. JH2/101300171).

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee of Shenyang Agricultural University (Permit No.: SYXK (Liao) 2021-0010).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the article/Supplementary Material, further inquiries can be directed to the corresponding authors.

Acknowledgments

We would like to thank Ying Feng for the technical assistance in CLSM analysis.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zambrano-Nava, S.; Boscán-Ocando, J.; Nava, J. Normal bacterial flora from vaginas of Criollo Limonero cows. Trop. Anim. Health Prod. 2011, 43, 291–294. [Google Scholar] [CrossRef] [PubMed]
  2. Ribeiro, M.G.; Risseti, R.M.; Bolaños, C.A.; Caffaro, K.A.; de Morais, A.C.; Lara, G.H.; Zamprogna, T.O.; Paes, A.C.; Listoni, F.J.; Franco, M.M. Trueperella pyogenes multispecies infections in domestic animals: A retrospective study of 144 cases (2002 to 2012). Vet. Q 2015, 35, 82–87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Galán-Relaño, Á.; Gómez-Gascón, L.; Barrero-Domínguez, B.; Luque, I.; Jurado-Martos, F.; Vela, A.I.; Sanz-Tejero, C.; Tarradas, C. Antimicrobial susceptibility of Trueperella pyogenes isolated from food-producing ruminants. Vet. Microbiol. 2020, 242, 108593. [Google Scholar] [CrossRef]
  4. Liu, M.; Wang, B.; Liang, H.; Ma, B.; Wang, J.; Zhang, W. Determination of the expression of three fimbrial subunit proteins in cultured Trueperella pyogenes. Acta Vet. Scand. 2018, 60, 53. [Google Scholar] [CrossRef] [Green Version]
  5. Ishiyama, D.; Mizomoto, T.; Ueda, C.; Takagi, N.; Shimizu, N.; Matsuura, Y.; Makuuchi, Y.; Watanabe, A.; Shinozuka, Y.; Kawai, K. Factors affecting the incidence and outcome of Trueperella pyogenes mastitis in cows. J. Vet. Med. Sci. 2017, 79, 626–631. [Google Scholar] [CrossRef] [Green Version]
  6. Amachawadi, R.G.; Nagaraja, T.G. Liver abscesses in cattle: A review of incidence in Holsteins and of bacteriology and vaccine approaches to control in feedlot cattle. J. Anim. Sci. 2016, 94, 1620–1632. [Google Scholar] [CrossRef] [Green Version]
  7. Tamai, I.A.; Mohammadzadeh, A.; Salehi, T.Z.; Mahmoodi, P.; Pakbin, B. Expression of virulence factor genes in co-infections with Trueperella pyogenes isolates and other bacterial pathogens; an in vivo study. Microb. Pathog. 2022, 164, 105435. [Google Scholar] [CrossRef] [PubMed]
  8. Rzewuska, M.; Kwiecień, E.; Chrobak-Chmiel, D.; Kizerwetter-Świda, M.; Stefańska, I.; Gieryńska, M. Pathogenicity and Virulence of Trueperella pyogenes: A Review. Int. J. Mol. Sci. 2019, 20, 2737. [Google Scholar] [CrossRef] [Green Version]
  9. Sheldon, I.M.; Lewis, G.S.; LeBlanc, S.; Gilbert, R.O. Defining postpartum uterine disease in cattle. Theriogenology 2006, 65, 1516–1530. [Google Scholar] [CrossRef]
  10. Galvão, K.N.; Bicalho, R.C.; Jeon, S.J. Symposium review: The uterine microbiome associated with the development of uterine disease in dairy cows. J. Dairy Sci. 2019, 102, 11786–11797. [Google Scholar] [CrossRef]
  11. Pascottini, O.B.; Van Schyndel, S.J.; Spricigo, J.; Rousseau, J.; Weese, J.S.; LeBlanc, S.J. Dynamics of uterine microbiota in postpartum dairy cows with clinical or subclinical endometritis. Sci. Rep. 2020, 10, 12353. [Google Scholar] [CrossRef] [PubMed]
  12. Ernstberger, M.; Oehl, H.; Haessig, M.; Hartnack, S.; Bollwein, H. Predicting the probability of conception in dairy cows with clinical endometritis based on a combination of anamnestic information and examination results. Theriogenology 2019, 138, 127–136. [Google Scholar] [CrossRef] [PubMed]
  13. Zhang, Z.; Liang, Y.; Yu, L.; Chen, M.; Guo, Y.; Kang, Z.; Qu, C.; Tian, C.; Zhang, D.; Liu, M. TatD DNases Contribute to Biofilm Formation and Virulence in Trueperella pyogenes. Front. Microbiol. 2021, 12, 758465. [Google Scholar] [CrossRef] [PubMed]
  14. Wang, G.; Zhao, G.; Chao, X.; Xie, L.; Wang, H. The Characteristic of Virulence, Biofilm and Antibiotic Resistance of Klebsiella pneumoniae. Int. J. Environ. Res. Public Health 2020, 17, 6278. [Google Scholar] [CrossRef] [PubMed]
  15. Jamal, M.; Ahmad, W.; Andleeb, S.; Jalil, F.; Imran, M.; Nawaz, M.A.; Hussain, T.; Ali, M.; Rafiq, M.; Kamil, M.A. Bacterial biofilm and associated infections. J. Chin. Med. Assoc. 2018, 81, 7–11. [Google Scholar] [CrossRef] [PubMed]
  16. Otto, M. Staphylococcal Biofilms. Microbiol. Spectr. 2018, 6. [Google Scholar] [CrossRef]
  17. Ahire, J.J.; Dicks, L.M. Nisin Incorporated With 2,3-Dihydroxybenzoic Acid in Nanofibers Inhibits Biofilm Formation by a Methicillin-Resistant Strain of Staphylococcus aureus. Probiotics Antimicrob. Proteins 2015, 7, 52–59. [Google Scholar] [CrossRef]
  18. Carbone, A.; Parrino, B.; Cusimano, M.G.; Spanò, V.; Montalbano, A.; Barraja, P.; Schillaci, D.; Cirrincione, G.; Diana, P.; Cascioferro, S. New Thiazole Nortopsentin Analogues Inhibit Bacterial Biofilm Formation. Mar. Drugs 2018, 16, 274. [Google Scholar] [CrossRef] [Green Version]
  19. Kumar, P.; Lee, J.H.; Beyenal, H.; Lee, J. Fatty Acids as Antibiofilm and Antivirulence Agents. Trends Microbiol. 2020, 28, 753–768. [Google Scholar] [CrossRef]
  20. Wood, T.K. Strategies for combating persister cell and biofilm infections. Microb. Biotechnol. 2017, 10, 1054–1056. [Google Scholar] [CrossRef]
  21. Zhao, Y.; Li, H.; Wei, S.; Zhou, X.; Xiao, X. Antimicrobial Effects of Chemical Compounds Isolated from Traditional Chinese Herbal Medicine (TCHM) Against Drug-Resistant Bacteria: A Review Paper. Mini Rev. Med. Chem. 2019, 19, 125–137. [Google Scholar] [CrossRef] [PubMed]
  22. Guo, Y.; Liu, Y.; Zhang, Z.; Chen, M.; Zhang, D.; Tian, C.; Liu, M.; Jiang, G. The Antibacterial Activity and Mechanism of Action of Luteolin Against Trueperella pyogenes. Infect. Drug Resist. 2020, 13, 1697–1711. [Google Scholar] [CrossRef] [PubMed]
  23. Zhang, D.; Gao, X.; Song, X.; Zhou, W.; Hong, W.; Tian, C.; Liu, Y.; Liu, M. Luteolin Showed a Resistance Elimination Effect on Gentamicin by Decreasing MATE mRNA Expression in Trueperella pyogenes. Microb. Drug Resist. 2019, 25, 619–626. [Google Scholar] [CrossRef] [PubMed]
  24. Guo, Y.; Huang, C.; Su, H.; Zhang, Z.; Chen, M.; Wang, R.; Zhang, D.; Zhang, L.; Liu, M. Luteolin increases susceptibility to macrolides by inhibiting MsrA efflux pump in Trueperella pyogenes. Vet. Res. 2022, 53, 3. [Google Scholar] [CrossRef] [PubMed]
  25. Shen, X.F.; Ren, L.B.; Teng, Y.; Zheng, S.; Yang, X.L.; Guo, X.J.; Wang, X.Y.; Sha, K.H.; Li, N.; Xu, G.Y.; et al. Luteolin decreases the attachment, invasion and cytotoxicity of UPEC in bladder epithelial cells and inhibits UPEC biofilm formation. Food Chem. Toxicol. 2014, 72, 204–211. [Google Scholar] [CrossRef] [PubMed]
  26. Fu, Y.; Wang, W.; Zeng, Q.; Wang, T.; Qian, W. Antibiofilm Efficacy of Luteolin Against Single and Dual Species of Candida albicans and Enterococcus faecalis. Front. Microbiol. 2021, 12, 715156. [Google Scholar] [PubMed]
  27. Zhang, Z.; Guo, Y.; Guo, Y.; Zhang, L.; Niu, S.; Tian, C.; Han, L.; Zhang, D.; Liu, M. Molecular Basis for Luteolin as a Natural TatD DNase Inhibitor in Trueperella pyogenes. Int. J. Mol. Sci. 2022, 23, 8374. [Google Scholar] [CrossRef]
  28. Donlan, R.M. Biofilms: Microbial life on surfaces. Emerg. Infect. Dis. 2002, 8, 881–890. [Google Scholar] [CrossRef]
  29. Girard, G.; Bloemberg, G.V. Central role of quorum sensing in regulating the production of pathogenicity factors in Pseudomonas aeruginosa. Future Microbiol. 2008, 3, 97–106. [Google Scholar] [CrossRef]
  30. Hall, C.W.; Mah, T.F. Molecular mechanisms of biofilm-based antibiotic resistance and tolerance in pathogenic bacteria. FEMS Microbiol. Rev. 2017, 41, 276–301. [Google Scholar] [CrossRef] [Green Version]
  31. Xiong, J.; Wang, K.; Yuan, C.; Xing, R.; Ni, J.; Hu, G.; Chen, F.; Wang, X. Luteolin protects mice from severe acute pancreatitis by exerting HO-1-mediated anti-inflammatory and antioxidant effects. Int. J. Mol. Med. 2017, 39, 113–125. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Sharma, D.; Misba, L.; Khan, A.U. Antibiotics versus biofilm: An emerging battleground in microbial communities. Antimicrob. Resist. Infect. Control 2019, 8, 76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Zhao, K.; Li, W.; Huang, T.; Song, X.; Zhang, X.; Yue, B. Comparative transcriptome analysis of Trueperella pyogenes reveals a novel antimicrobial strategy. Arch. Microbiol. 2017, 199, 649–655. [Google Scholar] [CrossRef]
  34. Shao, H.; Lamont, R.J.; Demuth, D.R. Autoinducer 2 is required for biofilm growth of Aggregatibacter (Actinobacillus) actinomycetemcomitans. Infect. Immun. 2007, 75, 4211–4218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Sun, Y.; Li, Y.; Luo, Q.; Huang, J.; Chen, J.; Zhang, R.; Wang, X. LuxS/AI-2 Quorum Sensing System in Edwardsiella piscicida Promotes Biofilm Formation and Pathogenicity. Infect. Immun. 2020, 88, e00907-19. [Google Scholar] [CrossRef] [PubMed]
  36. Yadav, M.K.; Vidal, J.E.; Go, Y.Y.; Kim, S.H.; Chae, S.W.; Song, J.J. The LuxS/AI-2 Quorum-Sensing System of Streptococcus pneumoniae Is Required to Cause Disease, and to Regulate Virulence- and Metabolism-Related Genes in a Rat Model of Middle Ear Infection. Front. Cell. Infect. Microbiol. 2018, 8, 138. [Google Scholar] [CrossRef] [PubMed]
  37. Li, Y.; Ma, X.; Yang, J.; Wu, X.; Yan, Z.; He, B. Expression Pattern of Cathelicidins in Dairy Cows During Endometritis and Role of Bovine Endometrial Epithelial Cells in Production of Cathelicidins. Front. Vet. Sci. 2021, 8, 675669. [Google Scholar] [CrossRef]
  38. Zhang, Y.; Su, N.; Liu, W.; Wang, Q.; Sun, J.; Peng, Y. Metabolomics Study of Guizhi Fuling Capsules in Rats with Cold Coagulation Dysmenorrhea. Front. Pharmacol. 2021, 12, 764904. [Google Scholar] [CrossRef]
  39. Lodhi, S.; Vadnere, G.P.; Patil, K.D.; Patil, T.P. Protective effects of luteolin on injury induced inflammation through reduction of tissue uric acid and pro-inflammatory cytokines in rats. J. Tradit. Complement. Med. 2019, 10, 60–69. [Google Scholar] [CrossRef]
  40. Conti, P.; Caraffa, A.; Gallenga, C.E.; Ross, R.; Kritas, S.K.; Frydas, I.; Younes, A.; Di Emidio, P.; Ronconi, G.; Pandolfi, F. Powerful anti-inflammatory action of luteolin: Potential increase with IL-38. Biofactors 2021, 47, 165–169. [Google Scholar] [CrossRef]
  41. Zhang, D.; Zhao, J.; Wang, Q.; Liu, Y.; Tian, C.; Zhao, Y.; Yu, L.; Liu, M. Trueperella pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China: Tetracycline susceptibility and tetracycline-resistance gene distribution. Microb. Pathog. 2017, 105, 51–56. [Google Scholar] [CrossRef] [PubMed]
  42. Xu, D.; Xiong, H.; Xiao, Z.; He, J.; Liao, Q.; Xue, L.; Wang, N.; Yang, Q. Uterine cytokine profile in a rat model of endometritis. Am. J. Reprod. Immunol. 2015, 73, 214–220. [Google Scholar] [CrossRef] [PubMed]
  43. Willcox, M.D. Microbial adhesion to silicone hydrogel lenses: A review. Eye Contact Lens. 2013, 39, 61–66. [Google Scholar] [CrossRef] [PubMed]
Ijms 23 14451 g001 550
Figure 1. CLSM analysis of T. pyogenes isolate (BMH06-3) biofilm co-incubated with luteolin for 72 h (Green: live bacteria; red: killed bacteria; black: no bacteria). (a) Blank control biofilm. (b) Solvent control biofilm (1% DMSO). (c) Biofilm co-incubated with ceftiofur (0.25 ng/mL). (d–f) Biofilm co-incubated with luteolin (39, 78 and 156 μg/mL).
Figure 1. CLSM analysis of T. pyogenes isolate (BMH06-3) biofilm co-incubated with luteolin for 72 h (Green: live bacteria; red: killed bacteria; black: no bacteria). (a) Blank control biofilm. (b) Solvent control biofilm (1% DMSO). (c) Biofilm co-incubated with ceftiofur (0.25 ng/mL). (d–f) Biofilm co-incubated with luteolin (39, 78 and 156 μg/mL).
Ijms 23 14451 g001
Ijms 23 14451 g002 550
Figure 2. SEM analysis of T. pyogenes (BMH06-3) biofilm co-incubated with luteolin for 72 h. (a) Blank control biofilm. (b) Solvent control biofilm (1% DMSO). (c) Biofilm co-incubated with ceftiofur (0.25 ng/mL). (d–f) Biofilm co-incubated with luteolin (39, 78 and 156 μg/mL).
Figure 2. SEM analysis of T. pyogenes (BMH06-3) biofilm co-incubated with luteolin for 72 h. (a) Blank control biofilm. (b) Solvent control biofilm (1% DMSO). (c) Biofilm co-incubated with ceftiofur (0.25 ng/mL). (d–f) Biofilm co-incubated with luteolin (39, 78 and 156 μg/mL).
Ijms 23 14451 g002
Ijms 23 14451 g003 550
Figure 3. CLSM analysis of mature T. pyogenes (BMH06-3) biofilm disruption treated with 312 μg/mL luteolin (Green: live bacteria; red: killed bacteria; black: no bacteria). (a) Blank control biofilm. (b) Solvent control biofilm (1% DMSO). (c) Mature biofilm treated with ceftiofur (0.25 ng/mL) for 24 h. (d–l) Mature biofilm treated with 312 μg/mL luteolin for 2, 4, 6, 8, 10, 12, 16, 20 and 24 h.
Figure 3. CLSM analysis of mature T. pyogenes (BMH06-3) biofilm disruption treated with 312 μg/mL luteolin (Green: live bacteria; red: killed bacteria; black: no bacteria). (a) Blank control biofilm. (b) Solvent control biofilm (1% DMSO). (c) Mature biofilm treated with ceftiofur (0.25 ng/mL) for 24 h. (d–l) Mature biofilm treated with 312 μg/mL luteolin for 2, 4, 6, 8, 10, 12, 16, 20 and 24 h.
Ijms 23 14451 g003
Ijms 23 14451 g004 550
Figure 4. SEM analysis of mature T. pyogenes (BMH06-3) biofilm disruption treated with 312 μg/mL luteolin. (a) Blank control biofilm. (b) Solvent control biofilm (1% DMSO). (c) Mature biofilm treated with ceftiofur (0.25 ng/mL) for 24 h. (d–f) Mature biofilm treated with 312 μg/mL luteolin for 12, 18 and 24 h.
Figure 4. SEM analysis of mature T. pyogenes (BMH06-3) biofilm disruption treated with 312 μg/mL luteolin. (a) Blank control biofilm. (b) Solvent control biofilm (1% DMSO). (c) Mature biofilm treated with ceftiofur (0.25 ng/mL) for 24 h. (d–f) Mature biofilm treated with 312 μg/mL luteolin for 12, 18 and 24 h.
Ijms 23 14451 g004
Ijms 23 14451 g005 550
Figure 5. Quantitative real-time RT-PCR analysis of genes involved in biofilm formation of T. pyogenes isolates. Biofilms were formed in the presence of 1/2 MBIC luteolin. Housekeeping genes gapA were used for normalization. Error bars and asterisks indicate the SEM. statistical significance of difference was analysed by t-test (* p < 0.05; ** p <0.01; *** p < 0.001).
Figure 5. Quantitative real-time RT-PCR analysis of genes involved in biofilm formation of T. pyogenes isolates. Biofilms were formed in the presence of 1/2 MBIC luteolin. Housekeeping genes gapA were used for normalization. Error bars and asterisks indicate the SEM. statistical significance of difference was analysed by t-test (* p < 0.05; ** p <0.01; *** p < 0.001).
Ijms 23 14451 g005
Ijms 23 14451 g006 550
Figure 6. CLSM analysis of T. pyogenes (BMH06-3) biofilm on the silicon hydrogel lenses after the in vivo treatment of luteolin (Green: live bacteria; red: killed bacteria; black: no bacteria). (a) Blank control biofilm. (b) Ceftiofur group (1.5 mg/kg b.w). (c–e) Luteolin group (50 mg/kg b.w; 100 mg/kg b.w; 150 mg/kg b.w).
Figure 6. CLSM analysis of T. pyogenes (BMH06-3) biofilm on the silicon hydrogel lenses after the in vivo treatment of luteolin (Green: live bacteria; red: killed bacteria; black: no bacteria). (a) Blank control biofilm. (b) Ceftiofur group (1.5 mg/kg b.w). (c–e) Luteolin group (50 mg/kg b.w; 100 mg/kg b.w; 150 mg/kg b.w).
Ijms 23 14451 g006
Ijms 23 14451 g007 550
Figure 7. Macroscopic uterus morphology comparison of rats in various groups. (a) Control group. (b) Endometritis group. (c) Ceftiofur group. (d–f) Luteolin treatment groups (L, 50 mg/kg b.w; M, 100 mg/kg b.w; H, 150 mg/kg b.w, respectively).
Figure 7. Macroscopic uterus morphology comparison of rats in various groups. (a) Control group. (b) Endometritis group. (c) Ceftiofur group. (d–f) Luteolin treatment groups (L, 50 mg/kg b.w; M, 100 mg/kg b.w; H, 150 mg/kg b.w, respectively).
Ijms 23 14451 g007
Ijms 23 14451 g008 550
Figure 8. Histopathologic examinations of H & E stained uterine of rats in various groups (200×). (a) Control group. (b) Endometritis group. (c) Ceftiofur group. (d–f) Luteolin treatment groups (L, 50 mg/kg b.w; M, 100 mg/kg b.w; H, 150 mg/kg b.w, respectively).
Figure 8. Histopathologic examinations of H & E stained uterine of rats in various groups (200×). (a) Control group. (b) Endometritis group. (c) Ceftiofur group. (d–f) Luteolin treatment groups (L, 50 mg/kg b.w; M, 100 mg/kg b.w; H, 150 mg/kg b.w, respectively).
Ijms 23 14451 g008
Table
Table 1. Antimicrobial activity and anti-biofilm activity of luteolin against type stain and clinical isolates.
Table 1. Antimicrobial activity and anti-biofilm activity of luteolin against type stain and clinical isolates.
T. pyogenesMIC (μg/mL)MBIC (μg/mL)MBEC (μg/mL)
ATCC194117878156
HC03-17878156
HC-H01-478156312
HC-H08-178156312
HC-H03-378156312
HC-H13-278156312
BMH06-378156312
BMH05-539156312
RY11-378156156
Table
Table 2. Mean ± SEM values of leukocyte count in various experimental groups.
Table 2. Mean ± SEM values of leukocyte count in various experimental groups.
GroupsTotal Leukocyte (109/L)Lymphocyte (%)Monocyte (%)Neutrophil (%)
Reference range8.93–6.4263.16–38.362.55–0.0053.30–32.59
Control (C)7.35 ± 1.9756.24 ± 6.211.12 ± 0.0834.65 ± 1.57
Endometritis (E)11.52 ± 4.5435.67 ± 2.152.61 ± 0.9759.31 ± 9.46
Ceftiofur (CE)8.62 ± 2.7146.24 ± 2.181.91 ± 0.1541.26 ± 3.21
Luteolin (L)7.98 ± 2.1649.21 ± 6.212.01 ± 0.6143.26 ± 4.67
Luteolin (M)7.61 ± 4.5157.21 ± 4.791.32 ± 0.1231.58 ± 2.37
Luteolin (H)9.87 ± 3.1439.46 ± 4.121.16 ± 0.2453.18 ± 2.18
Table
Table 3. Source of T. pyogenes isolates.
Table 3. Source of T. pyogenes isolates.
T. pyogenes IsolatesSource
HC03-1Endometritis
HC-H01-4Endometritis
HC-H08-1Endometritis
HC-H03-3Endometritis
HC-H13-2Endometritis
BMH06-3Endometritis
BMH05-5Endometritis
RY11-3Endometritis
HC03-1Endometritis
Table
Table 4. Primers used for RT-PCR.
Table 4. Primers used for RT-PCR.
Gene Primer Sequence
luxSFACGCAACCACGCCGATAACG
RCGCAAGGTGACCTCGATCAGTTC
ploFTTGCCTCCAGTTGACGCTTTGAC
RGCCTTCTCGACGGTTGGATTCAG
rbsBFTCGTGTTTGCCGCTTTGGAC
RAACCGTGGTGACCGGAATGT
lsrBFGGTTCTCAACGCCAAATGCTATGAAG
RCGCCGACCTTGATAGATTTACCAGAG
gapAFCGGCGAAGAACGAGGACATCAC
RGTCGGCAGTGTAGGCGTGAAC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhang, L.; Cai, Y.; Li, L.; Chen, C.; Zhao, H.; Zhang, Z.; Liu, Y.; Wang, Y.; Tian, C.; Liu, M. Effects of Luteolin on Biofilm of Trueperella pyogenes and Its Therapeutic Effect on Rat Endometritis. Int. J. Mol. Sci. 2022, 23, 14451. https://doi.org/10.3390/ijms232214451

AMA Style

Zhang L, Cai Y, Li L, Chen C, Zhao H, Zhang Z, Liu Y, Wang Y, Tian C, Liu M. Effects of Luteolin on Biofilm of Trueperella pyogenes and Its Therapeutic Effect on Rat Endometritis. International Journal of Molecular Sciences. 2022; 23(22):14451. https://doi.org/10.3390/ijms232214451

Chicago/Turabian Style

Zhang, Luyao, Yitong Cai, Lishuang Li, Chen Chen, Hanyu Zhao, Zehui Zhang, Yaochuan Liu, Yingyu Wang, Chunlian Tian, and Mingchun Liu. 2022. "Effects of Luteolin on Biofilm of Trueperella pyogenes and Its Therapeutic Effect on Rat Endometritis" International Journal of Molecular Sciences 23, no. 22: 14451. https://doi.org/10.3390/ijms232214451

APA Style

Zhang, L., Cai, Y., Li, L., Chen, C., Zhao, H., Zhang, Z., Liu, Y., Wang, Y., Tian, C., & Liu, M. (2022). Effects of Luteolin on Biofilm of Trueperella pyogenes and Its Therapeutic Effect on Rat Endometritis. International Journal of Molecular Sciences, 23(22), 14451. https://doi.org/10.3390/ijms232214451

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop