Next Article in Journal
A Case–Control Study by ddPCR of ALU 260/111 and LINE-1 266/97 Copy Number Ratio in Circulating Cell-Free DNA in Plasma Revealed LINE-1 266/97 as a Potential Biomarker for Early Breast Cancer Detection
Previous Article in Journal
Less Severe Sepsis in Cecal Ligation and Puncture Models with and without Lipopolysaccharide in Mice with Conditional Ezh2-Deleted Macrophages (LysM-Cre System)
Previous Article in Special Issue
Distinct Signaling Pathways for Autophagy-Driven Cell Death and Survival in Adult Hippocampal Neural Stem Cells
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 10
10.3390/ijms24108518
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Anti-Inflammatory and Antioxidant Properties of Squalene in Copper Sulfate-Induced Inflammation in Zebrafish (Danio rerio)

by
Peng Zhang
1,2,3,†,
Naicheng Liu
1,2,3,†,
Mingyang Xue
1,
Mengjie Zhang
1,2,3,
Zidong Xiao
1,
Chen Xu
1,
Yuding Fan
1,
Wei Liu
1,
Junqiang Qiu
2,3,
Qinghua Zhang
2,3,* and
Yong Zhou
1,*
1
Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China
2
Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, Shanghai 201306, China
3
National Pathogen Collection Center for Aquatic Animals, Shanghai Ocean University, Shanghai 201306, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2023, 24(10), 8518; https://doi.org/10.3390/ijms24108518
Submission received: 4 March 2023 / Revised: 28 March 2023 / Accepted: 8 May 2023 / Published: 10 May 2023
(This article belongs to the Special Issue Stress Signaling and Programmed Cell Death)
Browse Figures
Versions Notes

Abstract

:
Long-term or excessive oxidative stress can cause serious damage to fish. Squalene can be added to feed as an antioxidant to improve the body constitution of fish. In this study, the antioxidant activity was detected by 2,2-diphenyl-1-acrylhydrazyl (DPPH) test and fluorescent probe (dichloro-dihydro-fluorescein diacetate). Transgenic Tg (lyz: DsRed2) zebrafish were used to evaluate the effect of squalene on CuSO4-induced inflammatory response. Quantitative real-time reverse transcription polymerase chain reaction was used to examine the expression of immune-related genes. The DPPH assay demonstrated that the highest free radical scavenging exerted by squalene was 32%. The fluorescence intensity of reactive oxygen species (ROS) decreased significantly after 0.7% or 1% squalene treatment, and squalene could exert an antioxidative effect in vivo. The number of migratory neutrophils in vivo was significantly reduced after treatment with different doses of squalene. Moreover, compared with CuSO4 treatment alone, treatment with 1% squalene upregulated the expression of sod by 2.5-foldand gpx4b by 1.3-fold to protect zebrafish larvae against CuSO4-induced oxidative damage. Moreover, treatment with 1% squalene significantly downregulated the expression of tnfa and cox2. This study showed that squalene has potential as an aquafeed additive to provide both anti-inflammatory and antioxidative properties.

Graphical Abstract

1. Introduction

Reactive oxygen species (ROS) and free radicals are involved in several diseases, including metabolic, and infectious diseases [1,2]. ROS can affect apoptosis and the immune system, and enhance the inflammatory response. Therefore, ROS are believed to cause many diseases and are a major factor in aging [3]. An imbalance between ROS production and the counteracting antioxidant system allows ROS to interact with and cause damage to proteins, lipids, and DNA. This imbalance is referred to as oxidative stress [2]. Inflammation and oxidative stress are interdependent mechanisms [4]. Moreover, oxidative stress might provoke inflammatory responses that can further enhance oxidative stress [5].
Zebrafish is a widely used animal model and has a variety of transgenic or mutant fish lines that can study human and aquatic animal diseases [6]. At the same time, zebrafish has a variety of inflammatory models [6]. When fish are stressed, the production of oxygen free radicals in tissues or cells increases [7,8]. This leads to a large amount of ROS in tissues or cells, causing oxidative damage [9]. Long-term or excessive oxidative stress can cause damage to fish, such as slow growth and development, decreased immune function, and increased disease incidence [8]. Oxidative stress damage to fish can reduce the quality of aquatic products and the feed conversion rate, causing serious economic losses to the aquaculture industry [10]. Therefore, it is of great significance to find natural products with antioxidant function in the study of inflammation and oxidation in fish. The zebrafish immune system is very similar, at the molecular and cellular levels, to that in humans [11]. In addition, the adaptive immune system in zebrafish is morphologically and functionally mature only at 4 to 6 weeks post-fertilization, and only innate immunity exists in embryos [12]. Oxidative and inflammatory responses can be induced and visualized easily in the early stages of zebrafish development, for example by transection of the tail fin, copper sulfate (CuSO4), and lipopolysaccharide (LPS) immersion [13]. Excessive inorganic copper in the environment destroys the copper balance in zebrafish, raising serum copper levels, and triggering the oxidative stress response, leading to an oxidative stress damage-mediated inflammatory response [14]. At the same time, oxidative stress induces the death of hair cells in the lateral line neuromasts of zebrafish larvae, causing the migration of immune cells [14].
Squalene is an unsaturated hydrocarbon containing six isoprene double bonds [15], belonging to the terpenoids [16]. Squalene, originally isolated from sharks, is a natural product that is widely distributed in nature [17]. Subsequently, it was found that squalene occurred in high concentrations in shark liver, vegetable oils, and in the stomach oil of birds [17]. Squalene is synthesized in the human liver and skin and plays an important role in cholesterol synthesis [18]. Later studies found that squalene had potent cytoprotective and antitumor activities [19,20,21]. Over recent decades, squalene had been used in the field of human cosmetic and medicine because of its antioxidant and anticancer activities, because tested compound treatment relieved oxidative stress in epithelial cells and reduced oxidative damage in rat models [22,23]. Squalene can improve dextran sulfate sodium (DSS)-induced acute colitis in mice [24]. It can confer survival advantage to treated animals and reduce the content of Malonaldehyde (MDA) in models of endotoxemia [25]. In human mammary epithelial cells (MCF10A), squalene reduced intracellular ROS levels, prevented H2O2-induced oxidative damage, and prevented oxidative DNA damage [26]. The generation of ROS can be avoided by the chelating of metal ions. Previous studies have shown that olive oil (rich in squalene) with a concentration of less than 100 μg/mL has a low chelating ability to Fe2+ [27]. Squalene has also been found to augment the secretion of interleukin 1 beta (IL-1β) by macrophages, thus suggesting a role for sebaceous glands in modulating innate immune responses via their secreted lipids, thus contributing to the development of inflammatory acne [28]. The anticancer, antioxidant, drug carrier, and other characteristics of squalene have resulted in its wide use to control and treat diseases [23]. In addition, squalene’s role in the field of functional food applications is also expanding [29,30], but there have been few studies on the effect of squalene application in fish. Therefore, in the present study, zebrafish were used as an experimental model to study the effects of squalene on anti-inflammation and antioxidant, with the aim of providing a theoretical basis for the preparation of fish food additives.

2. Results

2.1. Copper Chelating Activity (CCA) of Squalene

The metal chelating ability of squalene toward Cu2+ was verified by using pyrocatechol violet (PV) as a chromogenic agent. At the range of concentrations used in the experiment, the metal chelating ability of squalene increased in a concentration-dependent manner (Figure 1). There was no significant difference between the 0.05% and 0.2% squalene groups and the 0% group. Compared with the 0% group, the 0.5%, 0.7%, and 1% squalene group results were significantly different. In addition, 1% squalene had the highest CCA, which was only 13.3%. This result confirmed that the CCA of squalene was weak.

2.2. 2,2-Diphenyl-1-Picrylhydrazyl (DPPH) Radical Scavenging Activity of Squalene

The in vitro antioxidant activity of squalene was determined by measuring its DPPH radical scavenging activity. Compared with that of the 0% group, the results of each experimental group were significantly different (Figure 2). At the range of concentrations used in the experiment, the scavenging activity of squalene increased in a dose-dependent manner. DPPH radical scavenging activity of 1% squalene was the highest (32%). The results showed that squalene had certain DPPH free radical scavenging ability.

2.3. In Vivo Antioxidant Effect of Squalene

The fluorescent probe dichloro-dihydro-fluorescein diacetate (H2DCFDA) was used as a ROS indicator to evaluate the effect of squalene on ROS production in zebrafish (Figure 3A). Compared with that in the control group, the fluorescence intensity (FI) of the CuSO4 treatment group increased (Figure 3B,C). This indicated that CuSO4 induced more ROS in zebrafish, and the experimental model was established. The FI of the 100 µM quercetin group was significantly decreased compared with that in the CuSO4 group (Figure 3B,C). Similar to quercetin, the mean FI of ROS was decreased in the 0.2%, 0.5%, 0.7%, and 1% squalene-treated groups (Figure 3B,C). No significant difference was found between the 0.7% and 1% squalene-treated groups. After treatment with squalene, the FI decreased with the increase in squalene concentration. However, the effect of 0.05% squalene treatment on the production of reactive oxygen was not significant. In summary, squalene inhibited ROS generation in a dose dependent manner. At the lowest concentration (0.05% squalene), the effect of treatment was not significant.

2.4. Effect of Squalene on the Expression of Antioxidant Genes sod and gpx4b

The expression levels of sod (encoding superoxide dismutase) and gpx4b (encoding glutathione peroxidase 4b) were assessed using RT-qPCR. Compared with those in the control group, the expression levels of sod and gpx4b in the CuSO4 alone treatment group were significantly reduced (Figure 4A,B). After combined treatment with squalene for 24 h, the expression of sod in the 1% squalene treatment group was upregulated by 5-fold. The sod expression levels in the remaining experimental groups were increased by 2-fold (Figure 4A). The difference between all the experimental groups and the CuSO4 alone treatment group was statistically significant. The effect of squalene on the expression of gpx4b was dose-dependent (Figure 4B).

2.5. In Vivo Neutrophil Recruitment Assay

The CuSO4 inflammation model was constructed using transgenic zebrafish Tg (lyz: DsRED2) to verify the effect of squalene on neutrophil migration after the zebrafish were stimulated by Cu2+ (Figure 5A). In the control group, neutrophils were localized to the caudal hematopoietic tissue in the ventral trunk and tail (Figure 5B(I)). In contrast, in fish treated with CuSO4, neutrophils migrated to the horizontal midline and formed clusters near the lateral line neuromasts (Figure 5B(II)). However, pretreatment with squalene solution (0.05%, 0.2%, 0.5%, 0.7%, and 1%) significantly inhibited neutrophil migration to inflammatory sites (Figure 5C). The results for all squalene pretreatment groups were significantly different when compared with the CuSO4 alone treatment group (Figure 5C). There was no significant difference between 0.2%, 0.5%, 0.7%, and 1% groups.

2.6. Effect of Squalene on Expression of tnfa and cox-2

The expression levels of tnfa (encoding tumor necrosis factor alpha) and cox-2 (encoding cyclooxygenase 2) were significantly upregulated in zebrafish after CuSO4 only stimulation, by more than 2.5 times (Figure 6A,B). Compared with the CuSO4 alone treatment group, the expression levels of tnfa and cox-2 were downregulated after treatment with squalene for 24 h, in a dose-dependent manner (Figure 6A,B). The most marked inhibition was achieved using 1% squalene.

3. Discussion

The CuSO4-induced inflammation model can be established by simply adding the compound CuSO4 into the zebrafish larvae culture medium. The accumulation of neutrophils in the neuromasts is one of the most frequently used indicators for the level of inflammation in CuSO4-induced inflammation model and has been applied to assess the effect of known anti-inflammatory drugs [6]. Neutrophils migrate to inflammatory foci and can be observed in zebrafish [31,32]. Therefore, in this study, CuSO4 was selected to stimulate oxidative stress and induce inflammation. The established zebrafish inflammation model was used to verify the anti-inflammatory and antioxidant effects of squalene on zebrafish. This study has shown that inflammation occurs after zebrafish are stimulated, including increased ROS content and neutrophil migration to the neuromast. In this study, the use of squalene reduced inflammation and enhanced the anti-inflammatory and antioxidant capacities of zebrafish.

3.1. Antioxidant Effect of Squalene on Zebrafish

To assess the antioxidant activity of squalene, we first used an in vitro DPPH assay. The DPPH radical scavenging assay is widely used to determine the antioxidant activity of natural compounds because of its simplicity, sensitivity, comparable nature, and reproducibility [33,34,35]. The extract of Prunus mume (squalene-rich) had a good DPPH free radical scavenging ability, and its ethanol extract had the highest antioxidant activity (96.08–97.71%), whereas its water extract had the lowest antioxidant activity (76.09%) [36]. In our study, the free radical scavenging rate of the 1% squalene treatment group was 32% (Figure 2). With the increase in squalene concentration, the scavenging rate of DPPH free radical increased. This indicated that squalene can scavenge DPPH free radicals and squalene has certain antioxidant activity.
Although the determination of the antioxidant capacity by the DPPH method in vitro is simple and convenient, it cannot replace animal experiments in vivo [37,38]. Therefore, this study used zebrafish to establish an inflammatory model to test the antioxidant and anti-inflammatory effects of squalene. CuSO4 stimulated the generation of ROS, and ROS production could induce an inflammatory reaction [39,40,41]. In addition, CuSO4 could interfere with the expression of antioxidant genes, such as sod and gpx [42,43]. Therefore, this study mainly studied the effects of squalene treatment on ROS production and antioxidant gene expression in vivo. To eliminate the factors affecting the experimental results due to the complexation of Cu2+ with squalene during incubation, first, we tested the CCA of squalene, which showed that the complexation rate of 1% squalene to Cu2+ was 13.3% (Figure 1). The CCA of squalene is very low and would not affect the subsequent experimental results. Squalene can reduce AAPH (2,2′-azobis-2-methyl-propanimidamide, dihydrochloride) and H2O2-induced oxidative stress in Vero cells and reduce UV-induced intracellular ROS levels [44]. Squalene-based PLGA NPs (ploy lactic-co-glycolic acid nanoparticles) effectively reduced ROS levels in normal mouse hepatocytes [45]. Then, an in vivo experimental model was established by soaking zebrafish in CuSO4 to produce oxidative stress, permitting the verification of the antioxidant effect of squalene on zebrafish. ROS generation was then evaluated using the dye H2DCFDA [46,47,48]. The results showed that squalene treatment could effectively reduce ROS produced in zebrafish in a dose-dependent manner (Figure 3A,B). The 0.7% and 1% squalene treatment groups showed the best effect, with no significant differences between these two groups (Figure 3B). This demonstrated that squalene had a significant antioxidant effect, which could reduce the production of ROS in zebrafish larvae and protect zebrafish from stress.
Antioxidant enzymes include glutathione peroxidase (GPX, GSH-Px) and superoxide dismutase (SOD) [49,50]. GSH-Px plays a crucial role against oxidative stress, turning toxic substances into innocuous products by scavenging their free radicals [51,52]. GPx converts H2O2 and lipid peroxides into water and lipid alcohols to exert similar antioxidant effects [53]. Therefore, SOD and GSH-Px can reflect the body’s ability to resist oxidative damage [54]. In the oxidative damage model of zebrafish embryos induced by cadmium (Cd), a tree peony seed protein hydrolysate could inhibit Cd-induced oxidation by upregulating the expression of sod and gpx mRNA [55]. Rats fed with 2% squalene showed a significant decrease in lipid peroxidation and a significant increase in SOD and CAT activity, indicating the antioxidant properties of squalene in experimental induction [56]. Administration of squalene in rats improved GPx activity and the GSH level in heart tissue and protected the heart from cyclophosphamide-induced oxidative stress [57]. In this study, we found that squalene could effectively upregulate the expression of sod (by 2.5-fold) and gpx4b (by 1.3-fold) in the CuSO4-induced inflammation model (Figure 4A,B). Compared with the CuSO4 treatment alone group, 1% squalene treatment significantly upregulated the expression of sod (Figure 4A). Both 0.7% and 1% squalene significantly upregulated the expression of gpx4b (Figure 4B). In summary, squalene can significantly upregulate the expression of antioxidant genes sod and gpx4b, and can effectively reduce the ROS produced in zebrafish. This reduced CuSO4-induced oxidative stress, indicating that squalene had an antioxidant effect on zebrafish.

3.2. The Anti-Inflammatory Effect of Squalene in the Zebrafish Model

Exposure to copper causes hair cell necrosis in zebrafish lateral line. In addition, it can promote neutrophil migration and accumulation in the inflammatory area, followed by an acute inflammatory response [43,58]. Treatment with Bacillus coagulans XY2 before CuSO4 exposure significantly reduced neutrophil mobilization, thereby alleviating the acute inflammation induced by CuSO4 [59]. Therefore, this study used transgenic Tg (lyz: DsRED2) zebrafish to establish an inflammatory model to study the effect of squalene on neutrophil migration. The results showed that squalene treatment could reduce the number of migratory neutrophils (Figure 5A,B). Among the squalene concentrations, the 0.7% and 1% squalene treatment groups showed the best effects, with no significant difference between them (Figure 5B). In the zebrafish inflammation model, squalene could effectively inhibit neutrophil migration and the inflammatory response, demonstrating a good anti-inflammatory effect. It reduced the number of neutrophils in the inflammatory foci and alleviated the inflammatory symptoms to a certain extent.
Squalene has been shown to inhibit intracellular oxidative stress in LPS-stimulated mouse macrophages by inhibiting TNFα, inducible nitric oxide synthase (iNOS), COX-2, and NFE2 like BZIP transcription factor 2 (Nrf2) signaling pathways [44,60]. Similarly, squalene downregulated COX-2 and iNOS expression in a mouse acute colitis model [24,28]. There is abundant evidence that certain pro-inflammatory cytokines, such as IL-1β and TNFα, are involved in the process of pathological inflammation. In addition, COX-2 could be induced during tissue damage or inflammation in response to cytokines [61]. Pinostrobin, as a potential anti-inflammatory drug, could down-regulate Tnfa and Cox-2 expression in LPS-stimulated RAW 264.7 macrophages and zebrafish larvae by inhibiting gene expression [62]. Squalene dose-dependently reduced the increased levels of TNF-α and COX-2 in LPS-induced RAW cells [44]. Moreover, addition of squalene to human monocytes and neutrophils activated by incubation with lipopolysaccharide was found to suppress COX-2, IL1β, and TNF mRNA expression [60]. Therefore, in this study, the expression of tnfa and cox-2 was tested in 3 dpf zebrafish treated with 10 μM CuSO4 for 24 h to verify the anti-inflammatory effect of squalene. Compared with the control, the expression of tnfa and cox-2 in zebrafish was significantly increased after stimulation with CuSO4 (Figure 6A,B). This indicated the regulation of cells after an inflammatory response. However, the expression of tnfa and cox-2 was significantly downregulated after treatment with squalene in a dose-dependent manner. In addition, squalene had beneficial regulatory effect on the post-inflammatory response. In summary, squalene could inhibit the migration of neutrophils to the inflammatory site and inhibit the inflammatory response by downregulating the expression of tnfa and cox-2, which had an anti-inflammatory effect. These results provide the evidence that squalene exerts its anti-inflammatory activities via mechanisms targeting pro-inflammatory mediators (tnfα, cox-2) mediators and pathways in closely related phagocytic cells that cooperate during the onset, progression, and resolution of inflammation.

4. Materials and Methods

4.1. Fish Husbandry

Transgenic Tg (lyz: DsRED2) and wild-type (AB strain) zebrafish (Danio rerio) were purchased from the Institute of Hydrobiology of the Chinese Academy of Sciences, China Zebrafish Resource Center (CZRC, Wuhan, China). Zebrafish were maintained and handled according to the Zebrafish Book (zfin.org, 1 June 2022). The zebrafish were fed twice a day. The night before spawning, male and female fish in a 1:1 ratio were transferred to a darkened mating cage. Mating and spawning occurred within 1 h after turning on the lights in the morning. Selected healthy embryos were washed and examined under a microscope. Embryos were housed at 28 °C in embryo-rearing media (E3, see Supplementary Material) (Nanjing EzeRinka Biotechnology Co., Ltd., Nanjing, China). At 3 days post-fertilization (dpf), the larvae were used for the experiments. The components of E3 were NaCl (29.4 g/100 mL), KCl (1.27 g/100 mL), CaCl2·2H2O (4.85 g/100 mL), and MgSO4·7H2O (8.13 g/100 mL) [63,64].

4.2. Preparation of Test Samples

Squalene (Shanghai yuanye Bio-Technology Co., Ltd., Shanghai, China) exists as an oily liquid at room temperature [17]; therefore, the concentration of squalene is expressed by the volume fraction. Dimethyl sulfoxide (DMSO) (Sangon Biotech Co., Ltd., Shanghai, China) was used as the solvent. The squalene samples were dissolved in 6% DMSO and 90% E3 to form a 4% stock solution. The stock solution was diluted to different concentrations with E3 before use, such that the concentrations of the test sample were 0, 0.05%, 0.2%, 0.5%, 0.7%, and 1%. H2DCFDA (Merck Co., Ltd., Shanghai, China) was prepared as a stock of 20 µg/mL in DMSO and frozen at −20 °C. Its working solution was prepared on the day of the experiment.

4.3. The Metal Chelating Ability

The CCA was determined using PV (Merck Co., Ltd.) [65]. A total of 30 μL of different concentrations of squalene solution (0.05%, 0.2%, 0.5%, 0.7%, and 1%) or water (control) were mixed with 200 μL 50 mmol/L sodium acetate buffer. Each group had 3 repetitions. Thereafter, 30 μL of 100 mg/L CuSO4·5H2O solution was added to each group and oscillated for 2 min. After 2 min, 8.5 μL of 2 mmol/L catechol violet solution was added to start the reaction. All the reaction mixtures were shaken at 25 °C for 10 min, and then the absorbance was measured at 632 nm using an ultraviolet-visible (UV-Vis) spectrophotometer [37]. The CCA of squalene was calculated as
Cu2+ chelating ability of squalene (%) = (Abs control − Abs sample) × 100/Abs control
where Abs control is the absorbance of the control and Abs sample is the absorbance of the sample.

4.4. Antioxidant Capacity In Vitro

DPPH (Sangon Biotech Co., Ltd.) antioxidant capacity was determined according to a previously published protocol [34,37]. A total of 20 μL of squalene solution at different concentrations (0.05%, 0.2%, 0.5%, 0.7%, and 1%) was added to 180 μL of a methanol solution of 0.1 mM DPPH (the ratio was 1:9). Each group had 3 repetitions. Methanol, E3, and DMSO were used as controls, with quercetin as the positive control. After mixing, the reactions were placed in dark at room temperature for 15 min. Then, the absorbance was measured at 517 nm using an UV-Vis spectrophotometer. The calculation formula was
Scavenging Activity (%) = (Abs control − Abs sample) × 100/(Abs control)

4.5. Antioxidant Capacity In Vivo

Before the formal experiment, no death or deformity was found in zebrafish soaked with CuSO4 or squalene in the experimental concentration range. Quantification of ROS in zebrafish larvae was determined using the cell-permeable fluorescent probe H2DCFDA [37]. Zebrafish larvae of at 3 dpf were transferred to a 6-well plate, 10 larvae per well. The zebrafish larvae were treated with 2 mL squalene (0, 0.05%, 0.2%, 0.5%, 0.7%, or 1%) or 100 μM quercetin (positive control) for 1 h. Each group had 4 repetitions. Then, oxidative stress was induced in the zebrafish using CuSO4 at a final concentration of 10 µM. After 20 min of exposure, the larvae were washed three times with fresh E3 medium. The larvae were then incubated with H2DCFDA solution (20 µg/mL) for 1 h in the dark at 28 °C. The larvae were then washed three times with fresh E3 medium. Zebrafish larvae were immobilized in 3% methylcellulose (Merck Co., Ltd.). The larvae were observed under a fluorescence microscope (Olympus, Tokyo, Japan) and photographed. FI quantification was performed in individual confocal slices using ImageJ software (version 1.6, NIH, Bethesda, MD, USA). Larvae treated with CuSO4 alone were used as the negative control, and larvae treated with quercetin were used as positive controls.

4.6. In Vivo Neutrophil Recruitment Assay

The Tg (lyz: DsRED2) zebrafish transgenic line was used for the neutrophil recruitment assay in vivo [66]. The 3 dpf zebrafish larvae were treated with 2 mL squalene (0, 0.05%, 0.2%, 0.5%, 0.7%, or 1%) for 1 h (10 larvae per well, and each group had 4 repetitions.). Next, the larvae were treated with 20 µM CuSO4 for 1 h. Neutrophil migration was monitored using images taken using a fluorescence microscope (Olympus). Neutrophil migration was quantified by calculating the number of labeled cells detected in the lateral line region. Larvae treated with DMSO alone were used as a control, and larvae treated with CuSO4 alone were used as a negative control.

4.7. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) Analysis

The expression of selected genes (sod (encoding superoxide dismutase), gpx4b (encoding glutathione peroxidase 4b), tnfa (encoding tumor necrosis factor alpha), and cox2 (encoding cyclooxygenase 2) was analyzed using RT-qPCR (the primers are shown in Table 1, see Supplementary Material) [37]. The 3 dpf zebrafish larvae were transplanted into a 6-well plate, at 30 larvae per well. The 30 hatched larvae in each group were treated with different doses of 2 mL squalene (0, 0.05%, 0.2%, 0.5%, 0.7%, or 1%) for 1 h. Each group had 3 repetitions. The larvae were then treated with 10 μM CuSO4 (a concentration that induced oxidative stress and inflammation in zebrafish without resulting in fish death up to 24 h [14]) for 24 h. The larvae were collected after 24 h and stored at −80 °C for RNA extraction. The total RNA extraction was carried out using the Trizol reagent (Invitrogen, Carlsbad, CA, USA) [67]. RNA integrity was determined by electrophoresis through 1% agarose gels [68]. The RNA was reverse transcribed into cDNA using a cDNA reverse transcription kit (Trans Gen Biotech, Shanghai, China). The cDNA was then used as the template for a real-time quantitative polymerase chain reaction using the following cycling conditions: 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, and 60 °C for 30 s. The results were calculated using the 2−ΔΔct method [69] with the actb gene (encoding beta-actin) as the control.

4.8. Statistical Analyses

Normality of the data and homogeneity of the variances were confirmed using Shapiro–Wilk and Levene tests. The data were subjected to two-way analysis of variance (ANOVA) with squalene and copper exposure as the factors. A probability level of 5% (p < 0.05) was considered as significant. Kruskal–Wallis non-parametric one-way ANOVA was used when the normality test failed and differences between groups were determined by the Mann–Whitney test. When non-parametric statistics were used, the data are presented using Tukey’s boxplot (the bottom and top of the box are the minimum and maximum numbers, respectively, for each boxplot).

5. Conclusions

This study found that squalene could reduce the production of ROS in a CuSO4-induced zebrafish inflammation model, and upregulated the expression of sod and gpx4b to inhibit oxidative stress. Squalene could also inhibit the migration of neutrophils to inflammatory sites and downregulated the expression of pro-inflammatory cytokine genes tnfa and cox2 to inhibit inflammation. The anti-inflammatory and antioxidant effects of squalene on fish were studied from the aspects of aquatic animal models and gene expression changes. The results provide scientific support for squalene as a feed additive to improve the anti-inflammatory and antioxidant capacity of aquatic products.

Supplementary Materials

The supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24108518/s1.

Author Contributions

Conceptualization, funding acquisition, writing review & editing, Q.Z. and Y.Z.; conceptualization, methodology, formal analysis, data curation, writing original draft, visualization, P.Z. and N.L.; methodology, formal analysis, M.X. and M.Z.; investigation, Z.X. and C.X.; investigation, resources, Y.F. and W.L.; funding acquisition, J.Q. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Earmarked Fund for CARS (CARS-45), the China-US Ocean Research Center Fund (A1-3201-19-3013), the Central Public-interest Scientific Institution Basal Research Fund (2020TD44, YFI202207), National Key R&D Program of China (2019YFD0900102) and the National Freshwater Aquatic Germplasm Resource Center (FGRC18537).

Institutional Review Board Statement

All animal experiments were approved by the Animal Experimental Ethical Inspection of Laboratory Animal Centre, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences (Approval ID Number: YFI 2022–zhouyong–1321, 1 June 2022).

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Acknowledgments

We thank Wuhan Dynamic Life Science Co., Ltd. for supporting the reagents related to this project.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Yuqiang, S.; Subo, Y.; Jun, T.S. Reactive Oxygen Species (ROS) are Critical for Morphine Exacerbation of HIV-1 gp120-Induced Pain. J. Neuroimmune Pharmacol. 2020, 16, 581–591. [Google Scholar] [CrossRef]
  2. Baskaran, S.; Finelli, R.; Agarwal, A.; Henkel, R. Reactive oxygen species in male reproduction: A boon or a bane? Andrologia 2021, 53, e13577. [Google Scholar] [CrossRef] [PubMed]
  3. Ramani, S.; Pathak, A.; Dalal, V.; Paul, A.; Biswas, S. Oxidative Stress in Autoimmune Diseases: An Under Dealt Malice. Curr. Protein Pept. Sci. 2020, 21, 611–621. [Google Scholar] [CrossRef]
  4. Onodera, Y.; Teramura, T.; Takehara, T.; Obora, K.; Mori, T.; Fukuda, K. miR-155 induces ROS generation through downregulation of antioxidation-related genes in mesenchymal stem cells. Aging Cell 2017, 16, 1369–1380. [Google Scholar] [CrossRef]
  5. Minju, S.; Chong-Su, K.; Woo-Jeong, S.; Young-Kwan, L.; Young, C.E.; Dong-Mi, S. Hydrogen-rich water reduces inflammatory responses and prevents apoptosis of peripheral blood cells in healthy adults: A randomized, double-blind, controlled trial. Sci. Rep. 2020, 10, 12130. [Google Scholar] [CrossRef]
  6. Xie, Y.; Meijer, A.H.; Schaaf, M.J.M. Modeling Inflammation in Zebrafish for the Development of Anti-inflammatory Drugs. Front. Cell Dev. Biol. 2021, 8, 620984. [Google Scholar] [CrossRef]
  7. Nishida, Y. The chemical process of oxidative stress by copper(II) and iron(III) ions in several neurodegenerative disorders. Monatsh. Chem. 2011, 142, 375–384. [Google Scholar] [CrossRef]
  8. Birnie-Gauvin, K.; Costantini, D.; Cooke, S.J.; Willmore, W.G. A comparative and evolutionary approach to oxidative stress in fish: A review. Fish Fish. 2017, 18, 928–942. [Google Scholar] [CrossRef]
  9. Lushchak, V.I. Environmentally induced oxidative stress in aquatic animals. Aquat. Toxicol. 2010, 101, 13–30. [Google Scholar] [CrossRef]
  10. Amérand, A.; Vettier, A.; Moisan, C.; Belhomme, M.; Sébert, P. Sex-related differences in aerobic capacities and reactive oxygen species metabolism in the silver eel. Fish Physiol. Biochem. 2010, 36, 741–747. [Google Scholar] [CrossRef]
  11. Meeker, N.D.; Trede, N.S. Immunology and zebrafish: Spawning new models of human disease. Dev. Comp. Immunol. 2007, 32, 745–757. [Google Scholar] [CrossRef]
  12. Beatriz, N.; Antonio, F. Zebrafish: Model for the study of inflammation and the innate immune response to infectious diseases. Adv. Exp. Med. Biol. 2012, 946, 253–275. [Google Scholar] [CrossRef] [Green Version]
  13. Fernando, I.P.S.; Sanjeewa, K.K.A.; Kim, H.-S.; Kim, S.-Y.; Lee, S.-H.; Lee, W.W.; Jeon, Y.-J. Identification of sterols from the soft coral Dendronephthya gigantea and their anti-inflammatory potential. Environ. Toxicol. Pharmacol. 2017, 55, 37–43. [Google Scholar] [CrossRef] [PubMed]
  14. Brandão, P.T.C.; Martha, C.M.; Reis, B.M. Copper toxicology, oxidative stress and inflammation using zebrafish as experimental model. J. Appl. Toxicol. 2016, 36, 876–885. [Google Scholar] [CrossRef]
  15. Huang, Z.-R.; Lin, Y.-K.; Fang, J.-Y. Biological and Pharmacological Activities of Squalene and Related Compounds: Potential Uses in Cosmetic Dermatology. Molecules 2009, 14, 540–554. [Google Scholar] [CrossRef]
  16. Vázquez, L.; Fornari, T.; Señoráns, F.J.; Reglero, G.; Torres, C.F. Supercritical carbon dioxide fractionation of nonesterified alkoxyglycerols obtained from shark liver oil. J. Agric. Food Chem. 2008, 56, 1078–1083. [Google Scholar] [CrossRef]
  17. Narayan, B.H.; Naoto, T.; Hiroshi, N.; Tetsuya, K. Squalene as novel food factor. Curr. Pharm. Biotechnol. 2010, 11, 875–880. [Google Scholar] [CrossRef]
  18. Santana-Molina, C.; Henriques, V.; Hornero-Mendez, D.; Devos, D.P.; Rivas-Marin, E. The squalene route to C30 carotenoid biosynthesis and the origins of carotenoid biosynthetic pathways. Proc. Natl. Acad. Sci. USA 2022, 119, e2210081119. [Google Scholar] [CrossRef]
  19. Sotiroudis, T.G.; Kyrtopoulos, S.A. Anticarcinogenic compounds of olive oil and related biomarkers. Eur. J. Nutr. 2008, 47, 69–72. [Google Scholar] [CrossRef] [PubMed]
  20. Senthilkumar, S.; Yogeeta, S.K.; Subashini, R.; Devaki, T. Attenuation of cyclophosphamide induced toxicity by squalene in experimental rats. Chem. Interact. 2006, 160, 252–260. [Google Scholar] [CrossRef] [PubMed]
  21. Senthilkumar, S.; Devaki, T.; Manohar, B.M.; Babu, M.S. Effect of squalene on cyclophosphamide-induced toxicity. Clin. Chim. Acta. 2005, 364, 335–342. [Google Scholar] [CrossRef] [PubMed]
  22. Kim, S.-K.; Karadeniz, F. Biological Importance and Applications of Squalene and Squalane. Adv. Food Nutr. Res. 2012, 65, 223–233. [Google Scholar] [CrossRef] [PubMed]
  23. Reddy, L.H.; Couvreur, P. Squalene: A natural triterpene for use in disease management and therapy. Adv. Drug Deliv. Rev. 2009, 61, 1412–1426. [Google Scholar] [CrossRef]
  24. Sánchez-Fidalgo, S.; Villegas, I.; Rosillo, M.; Aparicio-Soto, M.; de la Lastra, C.A. Dietary squalene supplementation improves DSS-induced acute colitis by downregulating p38 MAPK and NFkB signaling pathways. Mol. Nutr. Food Res. 2015, 59, 284–292. [Google Scholar] [CrossRef]
  25. Dormont, F.; Brusini, R.; Cailleau, C.; Reynaud, F.; Peramo, A.; Gendron, A.; Mougin, J.; Gaudin, F.; Varna, M.; Couvreur, P. Squalene-based multidrug nanoparticles forimproved mitigation of uncontrolled inflammation in rodents. Sci. Adv. 2020, 5, 23. [Google Scholar] [CrossRef]
  26. Warleta, F.; Campos, M.; Allouche, Y.; Sanchez-Quesada, C.; Ruiz-Mora, J.; Beltran, G.; Gaforio, J.J. Squalene protects against oxidative DNA damage in MCF10A human mammary epithelial cells but not in MCF7 and MDA-MB-231 human breast cancer cells. Food Chem. Toxicol. 2010, 48, 1092–1100. [Google Scholar] [CrossRef] [PubMed]
  27. Elaasser, M.M.; Morsi, M.K.S.; Galal, S.M.; Abd El-Rahman, M.K.; Katry, M.A. Antioxidant, anti-inflammatory and cytotoxic activities of the unsaponifiable fraction of extra virgin olive oil. Grasas Aceites 2020, 71, 386. [Google Scholar] [CrossRef]
  28. Lou-Bonafonte, J.M.; Martinez-Beamonte, R.; Sanclemente, T.; Surra, J.C.; Herrera-Marcos, L.V.; Sanchez-Marco, J.; Arnal, C.; Osada, J. Current Insights into the Biological Action of Squalene. Mol. Nutr. Food Res. 2018, 62, e1800136. [Google Scholar] [CrossRef]
  29. Naziri, E.; Tsimidou, M.Z. Formulated squalene for food related applications. Recent Pat. Food Nutr. Agric. 2013, 5, 83–104. [Google Scholar] [CrossRef]
  30. Ovidiu, P.; Elena, B.N.; Ioana, P.; Sultana, N.; Elena, D.-P.C. Methods for obtaining and determination of squalene from natural sources. BioMed Res. Int. 2015, 2015, 367205. [Google Scholar] [CrossRef] [Green Version]
  31. Zhang, Q.; Ding, A.; Yue, Q.; Li, W.; Zu, Y.; Zhang, Q. Dynamic interaction of neutrophils and RFP-labelled Vibrio parahaemolyticus in zebrafish (Danio rerio). Aquac. Fish. 2017, 2, 269–277. [Google Scholar] [CrossRef]
  32. Zhang, Q.; Dong, X.; Chen, B.; Zhang, Y.; Zu, Y.; Li, W. Zebrafish as a useful model for zoonotic Vibrio parahaemolyticus pathogenicity in fish and human. Dev. Comp. Immunol. 2016, 55, 159–168. [Google Scholar] [CrossRef] [PubMed]
  33. Liu, H.; Wang, L.; Wang, M.-H. Antioxidant and nitric oxide release inhibition activities of methanolic extract from Clerodendrum cyrtophyllum Turcz. Hortic. Environ. Biotechnol. 2011, 52, 309–314. [Google Scholar] [CrossRef]
  34. Wang, C.-z.; Hui-hui, Y.; Xiao-li, B.; Min-bo, L. In vitro antioxidant and cytotoxic properties of ethanol extract of Alpinia oxyphylla fruits. Pharm Biol. 2013, 51, 1419–1425. [Google Scholar] [CrossRef] [PubMed]
  35. Francesco, S.; Gianluca, P.; Domenico, C.; Domenico, C.; Tonino, C.; Ermanno, V. Monitoring antioxidants by coulometry: Quantitative assessment of the strikingly high antioxidant capacity of bergamot (Citrus bergamia R.) by-products. Talanta 2023, 251, 123765. [Google Scholar] [CrossRef]
  36. Kim, S.M.; Huh, C.K. Isolation and identification of squalene as an antioxidative compound from the fruits of Prunus mume. J. Food Process. Preserv. 2021, 45, e15810. [Google Scholar] [CrossRef]
  37. Nguyen, T.H.; Le, H.D.; Kim, T.N.T.; The, H.P.; Nguyen, T.M.; Cornet, V.; Lambert, J.; Kestemont, P. Anti–Inflammatory and Antioxidant Properties of the Ethanol Extract of Clerodendrum cyrtophyllum Turcz in Copper Sulfate-Induced Inflammation in Zebrafish. Antioxidants 2020, 9, 192. [Google Scholar] [CrossRef] [Green Version]
  38. Lu, Z.; Jin-gui, H.U.; Jia-zhi, Z.; Rui, G.E.; Qing-shan, L.I. To investigate the in vivo and in vitro antioxidant effects of extract from Euonymus fortunei (Turcz.) Hand.-Mazz. Nat. Prod. Res. Dev. 2020, 32, 742–748. [Google Scholar] [CrossRef]
  39. Lanzarin, G.; Venâncio, C.; Félix, L.M.; Monteiro, S. Inflammatory, Oxidative Stress, and Apoptosis Effects in Zebrafish Larvae after Rapid Exposure to a Commercial Glyphosate Formulation. Biomedicines 2021, 9, 1784. [Google Scholar] [CrossRef]
  40. Lieke, T.; Steinberg, C.E.W.; Meinelt, T.; Knopf, K.; Kloas, W. Modification of the chemically induced inflammation assay reveals the Janus face of a phenol rich fulvic acid. Sci. Rep. 2022, 12, 5886. [Google Scholar] [CrossRef]
  41. Wang, Y.T.; Chen, G.C. Regulation of oxidative stress-induced autophagy by ATG9A ubiquitination. Autophagy 2022, 18, 2008–2010. [Google Scholar] [CrossRef]
  42. Wenju, L.; Fulong, L.; Xiaohui, W.; Bei, F.; Mingran, Y.; Wu, Z.; Dongyan, G.; Fengzhong, W.; Qiong, W. Anti-Inflammatory Effects and Mechanisms of Dandelion in RAW264.7 Macrophages and Zebrafish Larvae. Front. Pharmacol. 2022, 13, 906927. [Google Scholar] [CrossRef]
  43. Claudia, A.; Oscar, P.; Christine, W.; Viviana, G.; Rebecca, J.; Felix, L.; Urban, L.; Clemens, G.; Miguel, A. A high-throughput chemically induced inflammation assay in zebrafish. BMC Biol. 2010, 8, 151. [Google Scholar] [CrossRef] [Green Version]
  44. Fernando, I.P.S.; Sanjeewa, K.K.A.; Samarakoon, K.W.; Lee, W.W.; Kim, H.S.; Jeon, Y.J. Squalene isolated from marine macroalgae Caulerpa racemosa and its potent antioxidant and anti-inflammatory activities. J. Food Biochem. 2018, 42, e12628. [Google Scholar] [CrossRef]
  45. Bidooki, S.H.; Alejo, T.; Sanchez-Marco, J.; Martinez-Beamonte, R.; Abuobeid, R.; Burillo, J.C.; Lasheras, R.; Sebastian, V.; Rodriguez-Yoldi, M.J.; Arruebo, M.; et al. Squalene Loaded Nanoparticles Effectively Protect Hepatic AML12 Cell Lines against Oxidative and Endoplasmic Reticulum Stress in a TXNDC5-Dependent Way. Antioxidants 2022, 11, 581. [Google Scholar] [CrossRef]
  46. Olivari, F.A.; Hernández, P.P.; Allende, M.L. Acute copper exposure induces oxidative stress and cell death in lateral line hair cells of zebrafish larvae. Brain Res. 2008, 1244, 1–12. [Google Scholar] [CrossRef] [PubMed]
  47. Lee, S.-H.; Ko, C.-I.; Jee, Y.; Jeong, Y.; Kim, M.; Kim, J.-S.; Jeon, Y.-J. Anti-inflammatory effect of fucoidan extracted from Ecklonia cava in zebrafish model. Carbohydr. Polym. 2013, 92, 84–89. [Google Scholar] [CrossRef]
  48. Shibo, S.; Yici, Z.; Weiping, X.; Yue, Z.; Rui, Y.; Jianli, G.; Shui, G.; Qiang, M.; Kun, M.; Jianqiang, X. Chlorophyllin Inhibits Mammalian Thioredoxin Reductase 1 and Triggers Cancer Cell Death. Antioxidants 2021, 10, 1733. [Google Scholar] [CrossRef]
  49. Qingli, Z.; Fuhua, L.; Bing, W.; Jiquan, Z.; Yichen, L.; Qian, Z.; Jianhai, X. The mitochondrial manganese superoxide dismutase gene in Chinese shrimp Fenneropenaeus chinensis: Cloning, distribution and expression. Dev. Comp. Immunol. 2007, 31, 429–440. [Google Scholar] [CrossRef]
  50. Maharajan, K.; Muthulakshmi, S.; Nataraj, B.; Ramesh, M.; Kadirvelu, K. Toxicity assessment of pyriproxyfen in vertebrate model zebrafish embryos (Danio rerio): A multi biomarker study. Aquat Toxicol. 2018, 196, 132–145. [Google Scholar] [CrossRef] [PubMed]
  51. Nair, P.M.G.; Park, S.Y.; Choi, J. Expression of catalase and glutathione S -transferase genes in Chironomus riparius on exposure to cadmium and nonylphenol. Comp. Biochem. Phys. 2011, 154, 399–408. [Google Scholar] [CrossRef] [PubMed]
  52. Mansour, S.A.; Mossa, A.-T.H. Lipid peroxidation and oxidative stress in rat erythrocytes induced by chlorpyrifos and the protective effect of zinc. Pestic. Biochem. Phys. 2008, 93, 34–39. [Google Scholar] [CrossRef]
  53. Kayama, Y.; Raaz, U.; Jagger, A.; Adam, M.; Schellinger, I.N.; Sakamoto, M.; Suzuki, H.; Toyama, K.; Spin, J.M.; Tsao, P.S. Diabetic Cardiovascular Disease Induced by Oxidative Stress. Int. J. Mol. Sci. 2015, 16, 25234–25263. [Google Scholar] [CrossRef] [Green Version]
  54. Ying, C.; Huazhong, L.; Hao, H.; Yuetang, M.; Ruihua, W.; Yong, H.; Xiufen, Z.; Chunmei, C.; Hongfeng, T. Squid Ink Polysaccharides Protect Human Fibroblast against Oxidative Stress by Regulating NADPH Oxidase and Connexin43. Front. Pharmacol. 2019, 10, 1574. [Google Scholar] [CrossRef]
  55. Yan, L.; Ruixue, W.; Yingqiu, L.; Guijin, S.; Haizhen, M. Protective effects of tree peony seed protein hydrolysate on Cd-induced oxidative damage, inflammation and apoptosis in zebrafish embryos. Fish. Shellfish. Immun. 2022, 126, 292–303. [Google Scholar] [CrossRef]
  56. Sabeena Farvin, K.H.; Anandan, R.; Kumar, S.H.; Shiny, K.S.; Sankar, T.V.; Thankappan, T.K. Effect of squalene on tissue defense system in isoproterenol-induced myocardial infarction in rats. Pharmacol. Res. 2004, 50, 231–236. [Google Scholar] [CrossRef]
  57. Motawi, T.M.; Sadik, N.A.; Refaat, A. Cytoprotective effects of DL-alpha-lipoic acid or squalene on cyclophosphamide-induced oxidative injury: An experimental study on rat myocardium, testicles and urinary bladder. Food Chem. Toxicol. 2010, 48, 2326–2336. [Google Scholar] [CrossRef]
  58. Wittmann, C.; Reischl, M.; Shah, A.H.; Mikut, R.; Liebel, U.; Grabher, C. Facilitating drug discovery: An automated high-content inflammation assay in zebrafish. J. Vis. Exp. 2012, 16, e4203. [Google Scholar] [CrossRef]
  59. Fang, A.; Huang, X.; Wu, Y.; Ji, C.; Gao, Y.; Yu, T.; Yan, F. Alleviative effects of a novel strain Bacillus coagulans XY2 on copper-induced toxicity in zebrafish larvae. J. Environ. Sci. 2023, 125, 750–760. [Google Scholar] [CrossRef]
  60. Cárdeno, A.; Aparicio-Soto, M.; Montserrat-de la Paz, S.; Bermudez, B.; Muriana, F.J.; Alarcón-De-La-Lastra, C. Squalene targets pro- and anti-inflammatory mediators and pathways to modulate over-activation of neutrophils, monocytes and macrophages. J. Funct. Foods 2015, 14, 779–790. [Google Scholar] [CrossRef] [Green Version]
  61. Luisa, M. Cyclooxygenase-2 (COX-2) in inflammatory and degenerative brain diseases. J. Neuropathol. Exp. Neurol. 2004, 63, 901–910. [Google Scholar] [CrossRef] [Green Version]
  62. Athapaththu, A.; Lee, K.T.; Kavinda, M.H.D.; Lee, S.; Kang, S.; Lee, M.H.; Kang, C.H.; Choi, Y.H.; Kim, G.Y. Pinostrobin ameliorates lipopolysaccharide (LPS)-induced inflammation and endotoxemia by inhibiting LPS binding to the TLR4/MD2 complex. Biomed. Pharmacother. 2022, 156, 113874. [Google Scholar] [CrossRef]
  63. Zhang, P.; Liu, N.; Xue, M.; Zhang, M.; Liu, W.; Xu, C.; Fan, Y.; Meng, Y.; Zhang, Q.; Zhou, Y. Anti-Inflammatory and Antioxidant Properties of β-Sitosterol in Copper Sulfate-Induced Inflammation in Zebrafish (Danio rerio). Antioxidants 2023, 12, 391. [Google Scholar] [CrossRef]
  64. Di Paola, D.; Abbate, J.M.; Iaria, C.; Cordaro, M.; Crupi, R.; Siracusa, R.; D’Amico, R.; Fusco, R.; Impellizzeri, D.; Cuzzocrea, S.; et al. Environmental Risk Assessment of Dexamethasone Sodium Phosphate and Tocilizumab Mixture in Zebrafish Early Life Stage (Danio rerio). Toxics 2022, 10, 279. [Google Scholar] [CrossRef]
  65. Santos, J.S.; Alvarenga Brizola, V.R.; Granato, D. High-throughput assay comparison and standardization for metal chelating capacity screening: A proposal and application. Food Chem. 2017, 214, 515–522. [Google Scholar] [CrossRef]
  66. Bernut, A.; Loynes, C.A.; Floto, R.A.; Renshaw, S.A. Deletion of cftr Leads to an Excessive Neutrophilic Response and Defective Tissue Repair in a Zebrafish Model of Sterile Inflammation. Front. Immunol. 2020, 11, P1733. [Google Scholar] [CrossRef] [PubMed]
  67. Sultan, M.; Amstislavskiy, V.; Risch, T.; Schuette, M.; Dökel, S.; Ralser, M.; Balzereit, D.; Lehrach, H.; Yaspo, M.-L. Influence of RNA extraction methods and library selection schemes on RNA-seq data. BMC Genom. 2014, 15, 675. [Google Scholar] [CrossRef] [Green Version]
  68. Di Paola, D.; Natale, S.; Iaria, C.; Cordaro, M.; Crupi, R.; Siracusa, R.; D’Amico, R.; Fusco, R.; Impellizzeri, D.; Cuzzocrea, S.; et al. Intestinal Disorder in Zebrafish Larvae (Danio rerio): The Protective Action of N-Palmitoylethanolamide-oxazoline. Life 2022, 12, 125. [Google Scholar] [CrossRef]
  69. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Ijms 24 08518 g001 550
Figure 1. Copper chelating activity of squalene. Each bar represents the mean ± S.D. for three different experiments performed in triplicate, ns, not significant, * p < 0.05, *** p < 0.001 compared with the 0% group (control group).
Figure 1. Copper chelating activity of squalene. Each bar represents the mean ± S.D. for three different experiments performed in triplicate, ns, not significant, * p < 0.05, *** p < 0.001 compared with the 0% group (control group).
Ijms 24 08518 g001
Ijms 24 08518 g002 550
Figure 2. DPPH radical scavenging activity of squalene. Each bar represents the mean ± S.D. for three different experiments performed in triplicate, * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the 0% group (control group). DPPH—2,2-Diphenyl-1-picrylhydrazyl.
Figure 2. DPPH radical scavenging activity of squalene. Each bar represents the mean ± S.D. for three different experiments performed in triplicate, * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the 0% group (control group). DPPH—2,2-Diphenyl-1-picrylhydrazyl.
Ijms 24 08518 g002
Ijms 24 08518 g003a 550Ijms 24 08518 g003b 550
Figure 3. Squalene inhibits CuSO4-induced reactive oxygen species production in zebrafish larvae. (A) Flowchart of the experiments (B) Fluorescence images of representative detections of reactive oxygen species, scale bars represent 200 µm. (C) Fluorescence intensity of juvenile zebrafish compared with that of the group using CuSO4 alone, the data were presented as medians for four different larvae. #### p < 0.001, compared with the control group. ns, not significant. * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the CuSO4 group. H2DCFDA—dichlorodihydrofluorescein diacetate.
Figure 3. Squalene inhibits CuSO4-induced reactive oxygen species production in zebrafish larvae. (A) Flowchart of the experiments (B) Fluorescence images of representative detections of reactive oxygen species, scale bars represent 200 µm. (C) Fluorescence intensity of juvenile zebrafish compared with that of the group using CuSO4 alone, the data were presented as medians for four different larvae. #### p < 0.001, compared with the control group. ns, not significant. * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the CuSO4 group. H2DCFDA—dichlorodihydrofluorescein diacetate.
Ijms 24 08518 g003aIjms 24 08518 g003b
Ijms 24 08518 g004 550
Figure 4. The relative expression of antioxidant-related genes relative to β-actin in zebrafish larvae treated with CuSO4 and squalene for 24 h. (A) The expression of sod gene relative to β-actin (B) The expression of gpx4b gene relative to β-actin, the data were expressed as the mean ± SD, three biological replicates, ## p < 0.05, ### p < 0.01, compared with the control group. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with CuSO4 alone treatment group. sod—superoxide dismutase; gprx4b—glutathione peroxidase 4b.
Figure 4. The relative expression of antioxidant-related genes relative to β-actin in zebrafish larvae treated with CuSO4 and squalene for 24 h. (A) The expression of sod gene relative to β-actin (B) The expression of gpx4b gene relative to β-actin, the data were expressed as the mean ± SD, three biological replicates, ## p < 0.05, ### p < 0.01, compared with the control group. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with CuSO4 alone treatment group. sod—superoxide dismutase; gprx4b—glutathione peroxidase 4b.
Ijms 24 08518 g004
Ijms 24 08518 g005a 550Ijms 24 08518 g005b 550
Figure 5. Effect of squalene on CuSO4-induced inflammatory response in zebrafish. (A) Flowchart of the experiments (B) Neutrophil migration in zebrafish after treatment, scale (I–VII) bars represent 200 µm, scale (i–vii) bars represent 100 µm. (C) Quantification of the number of neutrophils aggregated to the lateral line after CuSO4 treatment, the data are presented as medians for four different larvae. Data are expressed as the mean ± SD. #### p < 0.001, compared with the control group. ns, not significant. ** p < 0.01, *** p < 0.001, compared with the CuSO4 alone treatment group, n = 4. dpf—days post-fertilization; DMSO—dimethyl sulfoxide.
Figure 5. Effect of squalene on CuSO4-induced inflammatory response in zebrafish. (A) Flowchart of the experiments (B) Neutrophil migration in zebrafish after treatment, scale (I–VII) bars represent 200 µm, scale (i–vii) bars represent 100 µm. (C) Quantification of the number of neutrophils aggregated to the lateral line after CuSO4 treatment, the data are presented as medians for four different larvae. Data are expressed as the mean ± SD. #### p < 0.001, compared with the control group. ns, not significant. ** p < 0.01, *** p < 0.001, compared with the CuSO4 alone treatment group, n = 4. dpf—days post-fertilization; DMSO—dimethyl sulfoxide.
Ijms 24 08518 g005aIjms 24 08518 g005b
Ijms 24 08518 g006 550
Figure 6. The expression of immune response-related genes relative to β-actin in zebrafish larvae after CuSO4 stimulation and squalene treatment. (A) The expression of tnfa gene relative to β-actin (B) The expression of cox-2 gene relative to β-actin. The data were expressed as the mean ± SD, three biological replicates, #### p < 0.001, compared with the control group. * p < 0.05, ** p < 0.01 compared with CuSO4 alone treatment group. tnfa—tumor necrosis factor alpha; cox-2—cyclooxygenase 2.
Figure 6. The expression of immune response-related genes relative to β-actin in zebrafish larvae after CuSO4 stimulation and squalene treatment. (A) The expression of tnfa gene relative to β-actin (B) The expression of cox-2 gene relative to β-actin. The data were expressed as the mean ± SD, three biological replicates, #### p < 0.001, compared with the control group. * p < 0.05, ** p < 0.01 compared with CuSO4 alone treatment group. tnfa—tumor necrosis factor alpha; cox-2—cyclooxygenase 2.
Ijms 24 08518 g006
Table
Table 1. Primers sequences [37].
Table 1. Primers sequences [37].
Gene NameForward and Reverse Primer Sequences (5′-3′)Product Size
(bp)		GenBank Accession No.
actbF: CCCCATTGAGCACGGTATTG
R: ATACATGGCAGGGGTGTTGA		193AF057040
tnfaF: CACAAAGGCTGCCATTCACT
R: GATTGATGGTGTGGCTCAGGT		227AB183467
cox-2F: ACAGATGCGCTACCAGTCTT
R: CCCATGAGGCCTTTGAGAGA		240NM_153657.1
sodF: ATGGTGAACAAGGCCGTTTG
R: AAAGCATGGACGTGGAAACC		152NM_131294.1
gpx4bF: TGAGAAGGGTTTACGCATCCTG
R: TGTTGTTCCCCAGTGTTCCT		209BC095133.1
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, P.; Liu, N.; Xue, M.; Zhang, M.; Xiao, Z.; Xu, C.; Fan, Y.; Liu, W.; Qiu, J.; Zhang, Q.; et al. Anti-Inflammatory and Antioxidant Properties of Squalene in Copper Sulfate-Induced Inflammation in Zebrafish (Danio rerio). Int. J. Mol. Sci. 2023, 24, 8518. https://doi.org/10.3390/ijms24108518

AMA Style

Zhang P, Liu N, Xue M, Zhang M, Xiao Z, Xu C, Fan Y, Liu W, Qiu J, Zhang Q, et al. Anti-Inflammatory and Antioxidant Properties of Squalene in Copper Sulfate-Induced Inflammation in Zebrafish (Danio rerio). International Journal of Molecular Sciences. 2023; 24(10):8518. https://doi.org/10.3390/ijms24108518

Chicago/Turabian Style

Zhang, Peng, Naicheng Liu, Mingyang Xue, Mengjie Zhang, Zidong Xiao, Chen Xu, Yuding Fan, Wei Liu, Junqiang Qiu, Qinghua Zhang, and et al. 2023. "Anti-Inflammatory and Antioxidant Properties of Squalene in Copper Sulfate-Induced Inflammation in Zebrafish (Danio rerio)" International Journal of Molecular Sciences 24, no. 10: 8518. https://doi.org/10.3390/ijms24108518

APA Style

Zhang, P., Liu, N., Xue, M., Zhang, M., Xiao, Z., Xu, C., Fan, Y., Liu, W., Qiu, J., Zhang, Q., & Zhou, Y. (2023). Anti-Inflammatory and Antioxidant Properties of Squalene in Copper Sulfate-Induced Inflammation in Zebrafish (Danio rerio). International Journal of Molecular Sciences, 24(10), 8518. https://doi.org/10.3390/ijms24108518

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop