Next Article in Journal
Dysregulated Liver Metabolism and Polycystic Ovarian Syndrome
Previous Article in Journal
Detailing Protein-Bound Uremic Toxin Interaction Mechanisms with Human Serum Albumin in the Pursuit of Designing Competitive Binders
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 8
10.3390/ijms24087441
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

OsJRL40, a Jacalin-Related Lectin Gene, Promotes Salt Stress Tolerance in Rice

by
Qinmei Gao
,
Xiaolin Yin
,
Feng Wang
,
Shuchang Hu
,
Weihao Liu
,
Liangbi Chen
,
Xiaojun Dai
* and
Manzhong Liang
*
Hunan Province Key Laboratory of Crop Sterile Germplasm Resource Innovation and Application, Hunan Normal University, Changsha 410081, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(8), 7441; https://doi.org/10.3390/ijms24087441
Submission received: 8 March 2023 / Revised: 12 April 2023 / Accepted: 13 April 2023 / Published: 18 April 2023
(This article belongs to the Section Molecular Plant Sciences)
Browse Figures
Review Reports Versions Notes

Abstract

:
High salinity is a major stress factor affecting the quality and productivity of rice (Oryza sativa L.). Although numerous salt tolerance-related genes have been identified in rice, their molecular mechanisms remain unknown. Here, we report that OsJRL40, a jacalin-related lectin gene, confers remarkable salt tolerance in rice. The loss of function of OsJRL40 increased sensitivity to salt stress in rice, whereas its overexpression enhanced salt tolerance at the seedling stage and during reproductive growth. β-glucuronidase (GUS) reporter assays indicated that OsJRL40 is expressed to higher levels in roots and internodes than in other tissues, and subcellular localization analysis revealed that the OsJRL40 protein localizes to the cytoplasm. Further molecular analyses showed that OsJRL40 enhances antioxidant enzyme activities and regulates Na+-K+ homeostasis under salt stress. RNA-seq analysis revealed that OsJRL40 regulates salt tolerance in rice by controlling the expression of genes encoding Na+/K+ transporters, salt-responsive transcription factors, and other salt response-related proteins. Overall, this study provides a scientific basis for an in-depth investigation of the salt tolerance mechanism in rice and could guide the breeding of salt-tolerant rice cultivars.

1. Introduction

Rice (Oryza sativa L.) is the main agricultural crop in the world and the staple food of most of the global population [1]. Salt stress is one of the important factors affecting rice production. Approximately 7% of the total land area is affected by high salinity [2,3]. Excess salt adversely affects many plant processes including photosynthesis, metabolism, and respiration, resulting in stunted growth and even death [4]. High salt can also cause Na+ poisoning, which seriously affects plant growth and development and consequently reduces grain quality and yield in rice. Plants respond to the unfavorable environment surrounding them by generating complex inter-gene interactions and cross-talk with different molecular pathways [5]. How plants adapt to salt stress and how their salt tolerance levels can be improved further have long been the hot topics of research in the field of plant physiology and ecology.
Plants have evolved several mechanisms of salt tolerance, including membrane modification, ion absorption, transport, and separation, and salt excretion, etc. [6]. Many genes and gene families have been reported to play important roles in plant salt tolerance. For example, OsZFP213 and OsMADS25 are involved in regulating the maintenance of the antioxidant system, which improves the salt tolerance of rice by reducing the electrical conductivity and the accumulation of harmful substances such as hydrogen peroxide and malondialdehyde (MDA) [7,8]. High-affinity K+ transporter (KHT) [9,10], Na+/H+ antiporter (NHX) [11,12], and high-affinity K+ (HAK) transporter [13] gene families regulate Na+-K+ balance under salt stress, thus promoting salt tolerance. In addition, plant hormones are involved in plant response to salt stress, among which abscisic acid (ABA) plays a key role in regulating plant salt tolerance by regulating the expression of salt-stress-related genes [14,15]. Recent studies showed that lectin-related genes play an important role in stress tolerance. Lectins are stress-protective proteins that specifically and reversibly bind to carbohydrates, as shown in rice [16,17,18], localize to the cell cytoplasm or nucleus, and interact with various stress factors and storage proteins or enzymes during plant development [16,18]. Studies show that lectin-related genes are expressed under abiotic and biotic stresses in various plant species including wheat (Triticum aestivum) [19], Arabidopsis thaliana [20], soybean (Glycine max) [21], and rice [16], indicating that these genes are involved in biotic and abiotic stress response. Transcriptome analysis found that some lectin genes exhibit different expression levels under drought and salt stresses [17]. Lectins are not only involved in stress protection but also in plant development, communication, intercellular communication [22], and inhibition of insect and virus growth [23]. Lectins are divided into different families: jacalin-related lectin family, legume lectin family, and LysM domain lectin family.
Jacalin-related lectin (JRL) genes have attracted much attention in recent years [24]. The JRL family is the third largest lectin family in rice. Jacalin lectin is a sugar-binding domain mainly found in plants. The jacalin domain of lectin is related to its function, and other domains bound to jacalin participate in a variety of biotic and abiotic stress responses [25]. Functionally, most JRLs are related to disease resistance and multiple stress response signals [26,27]. Nearly half of the lectin genes show differential expression under biotic and/or abiotic stresses [16]. Studies show that JRLs are composed only of jacalin and are stress proteins related to plant disease, insect resistance, injury response, and abiotic stress response [17]. OsJAC1 is a mannose-binding JRL derived from rice (Oryza sativa) [28], which regulates growth development [29] and is involved in plant defense against pathogen attacks [30]. The expression of HvHorcH enhanced its salt tolerance in Arabidopsis thaliana root tip [31]. In rice, Orysata is up-regulated under various stresses (salt, senescence, pathogen attack, insect attack, hormone, etc.) [32,33,34,35]. Early studies by Zhang and colleagues showed that salt induces the expression of JRL genes in rice [36]. He et al. found that overexpression of OsJRL increased the sensitivity of rice to ABA and affected the expression of some salt stress-related genes [33]. In recent years, similar results have been obtained in several additional plant species including wheat [16], poplar (Populus euphratica) [37], and barley (Hordeum vulgare) [31], suggesting that the JRL family genes play an important role in the salt stress response. In recent years, JRLs have become an important focus of research in the field of plant biochemistry, physiology, and medicine; however, there are few studies on the salt tolerance of JRLs in rice.
In our previous work on the identification of salt tolerance-related candidate genes in ‘Sea Rice 86′(SR86) using quantitative trait locus (QTL)-Seq and bulked segregant analysis (BSA)-Seq, we found a JRL family gene may be an important candidate gene and is named OsJRL40; RT-qPCR analysis showed that this gene actively responds to salt stress [38], but its molecular function was unclear. In the present study, we investigated the spatiotemporal expression patterns of OsJRL40, subcellular localization of the encoded protein, and salt tolerance phenotype of OsJRL40-overexpressing transgenic plants under salt stress. The antioxidant and ion homeostasis capacities of OsJRL40 were also analyzed to clarify its physiological and molecular mechanisms of action. Additionally, transcriptomic analysis of wild-type (WT) and osjrl40 knockout mutant and OsJRL40-overexpressing plants was performed under normal and salt stress conditions. The results showed that OsJRL40 regulates salt tolerance in rice by regulating Na+-K+ transport-related genes, transcription factors associated with salt response, and other salt response-related genes.

2. Results

2.1. Analysis of OsJRL40 Amino Acid Sequence and Phylogenetic Relationship

Os04g0123600, which is located on chromosome 4, has a coding sequence (CDS) of 426 bp and encodes 141-amino acid JRL protein. Amino acid sequence alignment analysis showed that Os04g0123600, barley mJRL protein LEM2, TaJRLL1 [37], AtJAL33 [39], and AtNSP4 [40] possess nine invariant non-polar amino acid residues in the jacalin lectin domain, which are essential for protein folding and mannose-binding [41,42]. A similar mannose-binding site in Heltuba protein has a highly conserved region near the C-terminal end [41] (Figure 1A). These results suggest that the Os04g0123600 encodes an mJRL protein, named OsJRL40.
Next, we conducted the phylogenetic analysis of JRL proteins of rice, maize, wheat, Arabidopsis, and soybean, whose protein sequences are derived from Song et al. [19]. OsJRL40 was found to be most closely related to maize (Figure 1B).

2.2. Expression and Subcellular Localization Assay of OsJRL40

To verify the function of OsJRL40, real-time fluorescence quantitative PCR (RT-qPCR) analysis was performed. The expression of OsJRL40 was most strongly induced when treated with 100 mM NaCl, reaching a peak at 6 h and then declining, indicating that OsJRL40 is a salt stress-responsive gene (Figure 2A). OsJRL40 was also induced in response to exogenous abscisic acid (ABA) application (Figure 2B). Next, we analyzed the OsJRL40 expression pattern in different tissues of japonica rice Nip by RT-qPCR. OsJRL40 showed a higher expression level in the stem than in other tissues (Figure 2C). To further examine the expression pattern of OsJRL40 in different tissues of rice plants, a 2.5-kb OsJRL40 promoter fragment driving the β-glucuronidase (GUS) reporter gene was introduced into the rice. GUS staining was detected in roots, stems, leaves, internodes, bud sheaths, and panicles. The cross-sections of roots and leaves revealed staining of the xylem and vascular systems, respectively (Figure 2D).
To investigate the subcellular localization of OsJRL40, the OsJRL40-GFP fusion was transiently expressed in Nip protoplasts under the control of the cauliflower mosaic virus 35S (CaMV35S) promoter. Green fluorescence was observed in the cytoplasm (Figure 2E), indicating that OsJRL40 is a cytosolic protein.

2.3. OsJRL40 Positively Regulates Salt Stress Tolerance in Rice at the Seedling Stage

In a previous study, we preliminarily determined that OsJRL40 is involved in regulating salt tolerance in rice [38]. To investigate the possible function of OsJRL40 in the salt stress response, two OsJRL40 loss-of-function knockout mutant lines (KO1 and KO2) were generated in the Nip background using the CRISPR/Cas9 technology. The KO1 mutant contained a 1-nt deletion in the first exon of OsJRL40, causing premature termination of protein, while the KO2 mutant contained a 1-nt insertion in the second exon of OsJRL40, resulting in frameshift mutation (Figure 3A). We also generated two independent OsJRL40 overexpression lines (OE1 and OE2) in the Nip background. RT-qPCR indicated that OsJRL40 was significantly up-regulated in both OE1 and OE2 compared with the WT (Nip) (Figure 3B). Next, we evaluated the salt tolerance of WT, KO, and OE plants at the seedling stage. The KO1 and KO2 seedlings showed severe wilting, while the OE1 and OE2 seedlings grew better than the WT (Figure 3C). Compared with the WT, the survival rate, fresh weight, and chlorophyll content of KO1 and KO2 lines were significantly lower, while those of OE1 and OE2 were higher after the NaCl treatment (Figure 3D–F). These results indicate that OsJRL40 positively regulates salt stress tolerance in rice.

2.4. OsJRL40 Enhances Salt Tolerance in Rice at the Reproductive Stage

To determine whether OsJRL40 affects salt tolerance in rice at the reproductive stage, we examined the phenotypes and agronomic traits of WT, KO, and OE plants under normal (0 mM NaCl) and salt stress (150 mM NaCl) conditions (Figure 4). Under normal conditions, the thousand-grain weight of KO plants was lower, while that of OE plants was higher than the WT (Figure 4H), and no significant differences were observed in the other traits (Figure 4). Under salt stress conditions, all KO plants died, while the OE lines showed significantly greater plant height, panicle length, seed setting rate, and thousand-grain weight than the WT (Figure 4D,F–H). The WT, KO, and OE plants showed no significant difference in panicle number under salt stress conditions (Figure 4E). These results suggest that OsJRL40 enhances the salt tolerance and yield of reproductive-stage rice plants under salt stress.

2.5. ABA Affects Seed Germination and Plant Growth of OE Lines

According to previous research [43], overexpression of JRL family genes increases the sensitivity of plants to ABA and alters the expression of downstream genes. RT-qPCR analysis revealed that the OsJRL40 was responsive to exogenous ABA (Figure 2B). Under normal conditions, the germination rate of KO and OE seeds was similar to that of WT seeds. However, in the 2 μM ABA treatment, the germination rate of KO seeds was higher than that of WT seeds, whereas the germination rate of OE seeds was lower than that of WT seeds. In the 5 μM ABA treatment, the seed germination rate of KO lines was approximately 30%, whereas that of OE seeds was almost 0 (Figure 5A,B).
To further investigate the relationship between OsJRL40 expression and exogenous ABA application, we germinated the WT, OE, and KO seeds on half-strength Murashige and Skoog (1/2 MS) medium for 2 days and then transferred them to 1/2 MS medium containing varying concentrations of ABA to evaluate seedling growth. On normal medium, the growth of the KO and OE lines was similar to that of WT plants (Figure 5C–E). However, in the presence of 2 and 5 μM ABA, the roots and shoots of WT plants were shorter than those of KO lines and longer than those of OE lines (Figure 5C–E). These results indicate that overexpression of OsJRL40 increases the ABA sensitivity of rice plants, whereas knockout mutation of OsJRL40 has the opposite effect.

2.6. OsJRL40 Enhances the Antioxidant Capacity of Rice under Salt Stress

To explore the molecular mechanism of OsJRL40-induced salt stress tolerance in rice, we studied the physiological and biochemical parameters of WT, KO, and OE plants under salt stress. No significant differences were observed among the three genotypes under normal conditions. However, a 2 d treatment with 100 mM NaCl led to the accumulation of reactive oxygen species (ROS) as revealed by diaminobenzidine (DAB) staining, which was stronger in KO mutants than in the WT (Figure 6A,B). Additionally, the content of hydrogen peroxide (H2O2) was higher in KO mutant leaves than in WT leaves (Figure 6D). The malondialdehyde (MDA) content and relative electrical conductivity (EC) were significantly higher in KO mutants (Figure 6C,E), which is consistent with their performance under salt stress. The trends displayed by OE plants, in terms of ROS and MDA contents and EC, were opposite to those displayed by KO plants. The activities of ROS scavenging enzymes are closely related to the salt stress tolerance levels of plants [44]. Consistently, the activities of superoxide dismutase (SOD) and peroxidase (POD) were dramatically lower in KO1 and KO2 lines and significantly higher in OE1 and OE2 lines than in the WT (Figure 6F,G). These results indicate that OsJRL40 improves antioxidant enzyme activity in rice under salt stress.

2.7. OsJRL40 Regulates Na+-K+ Homeostasis under Salt Stress

To test whether the growth phenotype of KO1 and KO2 lines under high salinity conditions was caused by the overaccumulation of Na+, we determined the Na+ and K+ contents of the roots and shoots of WT, KO1, KO2, OE1, and OE2 plants. No differences in Na+ and K+ contents were detected among the different genotypes under normal conditions. However, under salt stress conditions, the KO1 and KO2 plants accumulated more Na+ (Figure 7A,D), but less K+ (Figure 7B,E), in shoots and roots than the WT plants, while the OE plants showed the opposite results. The Na+/K+ ratio was significantly higher in the shoots and roots of KO1 and KO2 plants than in those of WT, OE1, and OE2 plants (Figure 7C,F). Taken together, these results suggest that OsJRL40 enhances salt tolerance in rice by reducing Na+ accumulation in the shoot and root, thus modifying the Na+/K+ ratio.

2.8. OsJRL40 Mediates Salt Tolerance in Yeast

To further clarify the function of OsJRL40, we performed functional assays in yeast (Saccharomyces cerevisiae) strain BY4741. The plasmid containing OsJRL40 was transformed into BY4741 cells, and the transformed cells were grown on media containing different concentrations of NaCl (Figure 8). Under normal conditions (0% NaCl), no significant difference was detected between yeast transformants carrying the empty pYES2 vector (control) and those expressing OsJRL40 (Figure 8). Under salt stress conditions, the growth of BY4741 cells carrying the empty vector was inhibited more significantly than that of yeast cells expressing OsJRL40, and the growth inhibition of yeast cells increased with the increase in NaCl concentration (Figure 8). These results suggest that OsJRL40 enhances the salt tolerance of yeast.

2.9. OsJRL40 Affects the Expression Profiles of Stress-Responsive Genes

To further clarify the mechanism of action of OsJRL40 at the molecular level, we performed RNA-seq analysis on WT and KO1 plants grown under normal (0 mM NaCl) or salt stress (100 mM NaCl) conditions. A total of 2533 genes showing differential expression between WT and KO1 plants were identified, of which 446 were up-regulated and 1406 were down-regulated in KO1 plants compared with the WT (Figure 9A). Under normal conditions, 254 genes were up-regulated and 229 genes were down-regulated in KO1 plants compared with the WT (Figure 10A). Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis showed that these differentially expressed genes (DEGs) were involved in plant-pathogen interaction, sesquiterpenoid and triterpenoid biosynthesis, and mitogen-activated protein kinase (MAPK) signaling pathway (Figure 9B), and Gene Ontology (GO) enrichment analysis showed that these DEGs were involved in defense response, DNA integration, and ADP binding (Figure 9C). Under salt stress conditions, 192 genes were up-regulated and 1177 genes were down-regulated in KO1 plants compared with the WT (Figure 10B). KEGG enrichment analysis showed that these DEGs were enriched in plant-pathogen interaction, flavonoid biosynthesis, phenylpropanoid biosynthesis, and MAPK signaling pathway (Figure 10C). GO enrichment analysis showed that most of these DEGs were involved in response to wounding, defense response, stress regulation, and so on (Figure 10D).
Because most of the DEGs were down-regulated after salt treatment and most of them were involved in stress response, we focused on these down-regulated genes. A comparison of the DEGs identified in KO plants before and after salt stress treatment revealed that 1021 DEGs were only down-regulated in KO plants. These down-regulated genes were defined as the candidate targets of OsJRL40 (Figure 11A) and were further annotated by KEGG and GO enrichment analyses. The results of KEGG enrichment analysis showed that most of these DEGs were involved in plant-pathogen interaction, hormone signal transduction, MAPK signaling pathway, and the biosynthesis and metabolism of phenylpropanoids, starch and sucrose, and flavonoids. The results of GO enrichment analysis showed that most of the genes were involved in stress response, stress regulation, and bind activity, and some genes were involved in the salt stress response regulation pathway (Figure 11B,C). We focused on some genes involved in stress response pathways, including transcription factor genes (WARKY54, WARKY71, MYB2, and NAC19), Na+-K+ ion transporter genes (OsHAK1, OsHAK17, OsKAT1, OsAKT1, and OsAKT2), and some salt stress response-related genes. Most of these genes have been reported to respond to salt stress and play an important role in salt tolerance. The OsHAK1 regulates salt tolerance in rice by regulating K+ concentration [13]. The OsKAT1 confers salinity tolerance to yeast and rice cells [45]. The expressing NAC19 gene increased the salt tolerance of plants, and the leaf water content and chlorophyll content of these plants were higher than those of the WT [46]. OsWRKY54 regulates the expression of some essential genes related to salt tolerance [47]. The expression of the OsWRKY71 transcript level was the highest under salinity stress [48]. OsGAP1 attenuates salt stress and binds to phospholipids and the unconventional G protein OsYCHF1 [49].
To confirm the results of RNA-seq analysis, we selected eight genes for RT-qPCR analysis. Our RT-qPCR results indicated that these genes were up-regulated in WT plants and down-regulated in KO plants under salt stress (Figure 12A), which was consistent with our RNA-seq results. Collectively, RNA-seq analysis revealed that OsJRL40 regulates salt tolerance in rice by regulating Na+-K+ transport-related genes, salt response-associated transcription factor genes, and other salt response-related genes.

3. Discussion

The JRL family is the third largest family of lectins in rice. Transcriptome and whole-genome sequencing analyses show that JRL family genes are involved in the salt stress response, although the experimental evidence available is limited. Here, we provide genetic evidence demonstrating that the JRL family gene OsJRL40 positively regulates tolerance to salt stress in rice. OsJRL40 was mainly expressed in nodes and responded quickly to salt stress. The osjrl40 KO mutants were sensitive to salt stress, while OsJRL40 OE lines exhibited enhanced salt stress tolerance. In addition, the OE plants showed strong salt tolerance at the reproductive stage, as evident from their increased panicle length, seed setting rate, thousand-grain weight, and consequent yield under salt stress conditions. Under salt stress conditions, OsJRL40 overexpression enhanced the antioxidant capacity of cells and eliminated excessive ROS accumulation. In addition, OsJRL40 regulated the Na+-K+ balance and the expression of many stress-related genes, suggesting that OsJRL40 plays an important role in salt stress tolerance.
In most plant species, salt stress tolerance is associated with a decrease in Na+ accumulation in aerial plant parts. Plants have evolved various mechanisms to enhance salt tolerance, including increasing the Na+-chelating capacity of vacuoles and promoting the transfer of Na+ from bud to root via the phloem sap [50]. According to previous studies, K+ channel proteins including HAKs, AKTs, and KATs play important roles in salt stress tolerance in rice [51,52]. HAK family genes regulate K+ uptake and translocation, salt tolerance, and osmotic potential regulation [13,53]. The expression of OsAKTs and OsKATs is induced in the root and stem tissues of rice in response to salt stress. The K+ transporter OsHAK1 regulates salt tolerance in rice by regulating K+ concentration [48]. AKT1, AKT2, and KAT1 are induced by salt stress [54]. The rice Shaker K+ channel protein OsKAT1 confers salinity tolerance to yeast and rice cells [45]. While the loss-of-function mutation of OsJRL40 increased the Na+ content of shoots and roots, its overexpression had the opposite effect. This suggests that OsJRL40 regulates K+ transporters to maintain Na+-K+ homeostasis in rice under salt stress conditions. RT-qPCR results showed that, under salt stress conditions, the expression levels of OsHAK1, OsAKT1, and OsKAT1 were significantly lower in KO mutant plants and significantly higher in OE plants than in the WT. These results will serve as a reference for in-depth research on the salt tolerance mechanism of JRL family genes.
RNA-seq analysis showed that 1406 and 162 genes were down-regulated in the KO mutant and OE plants, respectively, compared with the WT. KEGG enrichment analysis demonstrated that most DEGs were involved in plant hormone signaling and MAPK signaling pathways and substance anabolic pathways. GO functional analysis showed that most DEGs were involved in stress response regulation. Our results showed that OsJRL40 was also responsive to exogenous ABA application, and the OE lines were sensitive to ABA. Previous research shows that members of the OsJRL family regulate ABA response and the expression of genes involved in the ABA signaling pathway [43]. Poplar JRL genes mediate the response to ABA under salt stress, maintaining ROS and ion homeostasis [37]. Thus, it is possible that the rice JRL family genes impart salt tolerance by participating in the ABA signaling pathway. Our RT-qPCR showed that the expression of some salt tolerance genes, including OsWARKY71, OsMYB2, OsNAC19, OsJAC1, and OsCDPK13, was enhanced by OsJRL40. This suggests that the participation of OsJRL40 in salt tolerance may be related to the regulation of the expression of these genes. OsNAC2, a member of the NAC transcription factor family, was strongly induced by ABA and osmotic stresses such as drought and high salt [55]. The expressing NAC19 gene increased drought and salt tolerance of plants, and the leaf water content and chlorophyll content of these plants were higher than those of the WT [46]. OsWRKY54 regulates the expression of some essential genes related to salt tolerance [47]. The expression of the OsWRKY71 gene was up-regulated in response to low temperature, salinity, drought, and injury, and its transcript level was the highest under salinity stress [48]. Calmodulin (CAM) subtypes mediate salt-induced Ca2+ signaling through the activation of MYB transcriptional activators, leading to salt tolerance in plants [56]. OsGAP1 attenuates salt stress, stimulates a defense response, and binds to phospholipids and the unconventional G protein OsYCHF1 [49]. These results suggest that the involvement of OsJRL40 in salt tolerance is attributable to the regulation of the expression of these genes.
Overall, this study shows that the JRL family gene OsJRL40 induces salt tolerance in rice by regulating some critical Na+/K+ transporters, upstream regulatory factors, and stress-related genes.

4. Materials and Methods

4.1. Plant Material and ABA Treatment

Rice (Oryza sativa ssp. japonica) cultivar Nipponbare (Nip) was used as the WT in this study. After germination, the seeds were transferred to a normal hydroponic medium, and seedlings were grown to the three-leaf stage over a period of approximately 15 d. Then, the seedlings were grown in 100 mM NaCl for 4 d and subsequently returned to the normal hydroponic medium to recover for 7 d. Finally, the survival rate, fresh weight, and chlorophyll content of seedlings were determined. To observe the salt-tolerant phenotype of rice plants at the reproductive stage, plants at the tillering stage were transferred to 150 mM NaCl-containing soil and grown to maturity before quantifying the agronomic traits. To understand the effect of ABA treatment on rice, seeds and seedlings of WT and mutants (KO1, KO2, OE1, and OE2), they were treated with 0, 2, and 5 μM ABA, respectively. Referring to the previous research and modifying it slightly [57], seeds were inoculated on 1/2 MS medium supplemented with different concentrations of ABA (0, 2, 5 mM) for 5 days. To observe seedling phenotypes, budding seedlings were transferred to 1/2 MS medium supplemented with different concentrations of ABA (0, 2, 5 mM) for about 7 days. Then the phenotype was observed and the root length and shoot length were measured.

4.2. Generation of Mutant and Transgenic Lines

The CRISPR/Cas9 method was used to create the osjrl40 KO mutants. According to the criteria described by Maio and colleagues [58], two 20-bp target sites (1: GGACGTGATCGCCATGGTGG; 2: GGAAAGGGTTGCATCGTCGT) were selected. The CRISPR-Cas9-OsJRL40 constructs were then transformed into Nip plants via Agrobacterium-mediated transformation. The resultant mutant lines were screened for hygromycin resistance and then confirmed by PCR using sequence-specific primers. Two KO mutant lines, KO1 and KO2, were obtained. Primers used for the generation and identification of KO lines are listed in Table S1.
To construct the OsJRL40 overexpression plants (OE1 and OE2), the open reading frame of OsJRL40 was amplified by PCR from rice cDNA using the sequence-specific primer pair 1390-OsJRL40-F/R (Table S1). The purified PCR product was cloned into the pCAMBIA1390-Ubi vector using SpeI and BamHI restriction endonucleases. To generate plants expressing the pOsJRL40: GUS construct, the OsJRL40 promoter (2500 bp upstream of ATG) was amplified by PCR from Nip genomic DNA using the primer pair 1301-OsJRL40-F/R (Table S1). The PCR product was cloned into the pCAMBIA1301 binary vector. The resultant plasmid was introduced into Agrobacterium tumefaciens strain EHA105, which was then used to transform Nip plants as described previously [59].

4.3. Gene Expression Analysis

Total RNA was extracted from whole plants using the TRIzol Reagent (Invitrogen, Waltham, MA, USA) and subjected to reverse transcription to synthesize cDNA. Then, RT-qPCR was performed on the ABI PRISM 7500 RT-qPCR instrument (Applied Biosystems, Waltham, MA, USA) using the Takara quantitative kit RR420A and sequence-specific primers, which were designed with Primer Premier 5 and synthesized by Sangon Biotech (Shanghai, China). The Osactin gene was used as an internal reference.

4.4. GUS Staining Assay

GUS staining was performed as described previously [60]. Briefly, the tissues of ProOsJRL40-GUS transgenic rice were incubated overnight in a GUS staining solution at 37 °C. Then, chlorophyll was removed using 75% ethanol. Finally, the tissues were examined and photographed using the Olympus SZX7 microscope.

4.5. DAB Staining Assay

As described previously [61], Leaves were collected from rice plants before and after the NaCl stress treatment. The leaf samples were incubated in 1 mg mL−1 3,3′-DAB solution (containing 0.05% Tween and 10 mM Na2HPO4 [pH 3.8]) at 37°C overnight. The stained leaves were discolored with ethanol. Finally, the leaves are transferred to fresh ethanol and imaged.

4.6. Electrolyte Leakage Assay

The relative conductivity is as described previously [38]. Rice leaves are washed with deionized water, and the surface water was soaked dry. Next, 25 mL of deionized water was added to the test tube containing the sample and incubated at room temperature for 1 h. The EC of the leachate was measured with a conductivity meter as the initial conductivity (al), and that of the extract (a2) was measured at 0, 2, 4, 6, 8, 10, 12, and 24 h. Finally, the samples were boiled for 15 min. The value of absolute EC (EC after boiling; a3). To determine the cell membrane permeability, relative EC (%) was calculated using the equation below:
R e l a t i v e   E C = a 2 − a 1 a 3 − a 1 × 100

4.7. Measurement of Antioxidant Enzyme Activities and H2O2 Content

Plants of all genotypes (WT, KO1, KO2, OE1, and OE2) were grown in normal hydroponic solution for 14 d and then treated with 100 mM NaCl for 2 d. The activities of SOD and POD and the content of H2O2 were measured using the corresponding assay kits (Jiancheng Bioengineering Institute, Nanjing, China), according to the manufacturer’s instructions.

4.8. Measurement of MDA and Chlorophyll Contents

To measure the MDA content, an indicator of the degree of lipid peroxidation [62], fresh rice leaves were ground in trichloroacetic acid on ice. After centrifugation, the supernatant was added to thiobarbituric acid, and the sample was boiled in a water bath for 15 min. After cooling to room temperature, the absorbance of the sample was measured at 450, 532, and 600 nm. To determine the chlorophyll content of leaves, chlorophyll was extracted from leaves (100 mg), and the absorbance of the extract was measured at 663 and 645 nm [38,61].

4.9. Subcellular Localization Analysis

To analyze the subcellular localization of OsJRL40, the CDS of OsJRL40 minus the stop codon was amplified from Nip genomic DNA using gene-specific primers (Table S1), digested with PstI, and cloned into the PstI-digested pCAMBIA1390-GFP vector. The resultant 35S:OsJRL40-GFP construct was transiently expressed in rice protoplasts via polyethylene glycol (PEG)-mediated transformation [63]. The GFP signal was detected using the Zeiss LSM 880 microscope [64].

4.10. Yeast Complementation Assay

The OsJRL40 CDS was amplified using gene-specific primers (Table S1), and then cloned into the pYES2 vector using HindIII and XbaI restriction enzymes. The resultant vector was introduced into BY4741 yeast cells via the LiAC/ssDNA/PEG-mediated transformation method. Yeast growth was observed on a uracil-deficient medium containing 2% galactose (carbon source) and 2%, 5%, or 8% NaCl.

4.11. Ion Content Analysis

Whole plants of all genotypes (WT, KO1, KO2, OE1, and OE2) were ground with a plant grinder, and the powdered samples were passed through a 1 mm sieve. Then, 2 mL of nitric acid–perchloric acid (5:1) mixture was added to 50 mg of the ground sample. The digested sample was filtered, and K+ and Na+ concentrations were determined by inductively coupled plasma mass spectrometry (ICP-MS) (Agilent 7850).

4.12. RNA-Seq Analysis

Whole WT and KO1 plants were sampled before and after the 6 h 100 mM NaCl treatment and sent to Biomarker Technologies for RNA-seq analysis. The RNA-seq data were analyzed as described by Zhang et al. [65]. Then, the DEGs were functionally annotated by performing the GO and KEGG enrichment analyses [66,67].

4.13. Statistical Analysis

Figures were constructed using GraphPad Prism5. Data were represented as the mean ± SD of three independent replicates. The mean of three replicates per treatment was calculated using the PASW statistical Software18, and statistically significant differences were detected using one-way analysis of variance (ANOVA) and Student’s t-test.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24087441/s1.

Author Contributions

Conceptualization, M.L. and Q.G; implementation, Q.G. and X.Y.; data analysis, Q.G., M.L, X.D., and X.Y.; writing—original draft preparation, Q.G.; writing—review and editing, M.L., X.D., and X.Y; funding acquisition, M.L., F.W., S.H., W.L., and L.C. provided assistance during the experiments. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key Research and Development Program of China (grant numbers 2016YFD0101107 and 2018YFD0100902) and the Hunan Province Key Research and Development Plan (grant number 2016JC2023).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data supporting the conclusions of this article are provided within the article and in its additional files and are available upon reasonable request to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Godfray, H.; Crute, I.R.; Haddad, L.; Lawrence, D.; Whiteley, R. The future of the global food system. Philos. Trans. R. Soc. B Biol. Sci. 2010, 365, 2769–2777. [Google Scholar] [CrossRef]
  2. Munns, R.; Tester, M. Mechanisms of salinity tolerance. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef] [PubMed]
  3. Zhu, J.K. Abiotic stress signaling and responses in plants. Cell 2016, 167, 313–324. [Google Scholar] [CrossRef] [PubMed]
  4. Bhatt, T.; Sharma, A.; Puri, S.; Minhas, A.P. Salt tolerance mechanisms and approaches: Future scope of halotolerant genes and rice landraces. Rice Sci. 2020, 27, 368–383. [Google Scholar] [CrossRef]
  5. Ullah, F.; Xu, Q.; Zhao, Y.; Zhou, D.X. Histone deacetylase hda710 controls salt tolerance by regulating aba signaling in rice. J. Integr. Plant Biol. 2020, 63, 451–467. [Google Scholar] [CrossRef]
  6. Li, N.; Chen, S.; Zhou, X.; Li, C.; Shao, J.; Wang, R. Effect of NaCl on photosynthesis, salt accumulation and ion compartmentation in two mangrove species, Kandelia candel and Bruguiera gymnorhiza. Aquat. Bot. 2008, 88, 303–310. [Google Scholar] [CrossRef]
  7. Zhang, Z.; Liu, H.; Sun, C.; Ma, Q.; Bu, H.; Chong, K.; Xu, Y. A C2H2 zinc-finger protein OsZFP213 interacts with OsMAPK3 to enhance salt tolerance in rice. J. Plant Physiol. 2018, 229, 100–110. [Google Scholar] [CrossRef]
  8. Xu, N.; Chu, Y.; Chen, H.; Li, X.; Wu, Q.; Jin, L.; Wang, G.; Huang, J. Rice transcription factor OsMADS25 modulates root growth and confers salinity tolerance via the ABA-mediated regulatory pathway and ROS scavenging. PLoS Genet. 2018, 14, e1007662. [Google Scholar] [CrossRef]
  9. Suzuki, K.; Yamaji, N.; Costa, A.; Okuma, E.; Kobayashi, N.; Kashiwagi, T.; Katsuhara, M.; Wang, C.; Tanoi, K.T.; Murata, Y.; et al. OsHKT1;4-mediated Na+ transport in stems contributes to Na+ exclusion from leaf blades of rice at the reproductive growth stage upon salt stress. BMC Plant Biol. 2016, 19, 16–22. [Google Scholar] [CrossRef]
  10. Venkataraman, G.; Shabala, S.; Véry, A.A.; Hariharan, G.N.; Somasundaram, S.; Pulipati, S.; Sellamuthu, G.; Harikrishnan, M.; Kumari, K.; Shabala, L. To exclude or to accumulate? Revealing the role of the sodium HKT1;5 transporter in plant adaptive responses to varying soil salinity. Plant Physiol. Biochem. 2021, 169, 333–342. [Google Scholar] [CrossRef]
  11. Fukuda, A.; Nakamura, A.; Hara, N.; Toki, S.; Tanaka, Y. Molecular and functional analyses of rice NHX-type Na+/H+ antiporter genes. Planta 2011, 233, 175–188. [Google Scholar] [CrossRef]
  12. Kong, M.S.; Luo, M.J.; Li, J.G.; Feng, Z.; Zhang, Y.X.; Song, W.; Zhang, R.Y.; Wang, R.H.; Wang, Y.D.; Zhao, J.R.; et al. Genome-wide identification, characterization, and expression analysis of the monovalent cation-proton antiporter superfamily in maize, and functional analysis of its role in salt tolerance. Genomics 2021, 113, 1940–1951. [Google Scholar] [CrossRef]
  13. Chen, G.; Hu, Q.D.; Luo, L.; Yang, T.Y.; Zhang, S.; Hu, Y.B.; Yu, L.; Xu, G.H. Rice potassium transporter oshak1 is essential for maintaining potassium-mediated growth and functions in salt tolerance over low and high potassium concentration ranges. Plant Cell Environ. 2015, 38, 2747–2765. [Google Scholar] [CrossRef]
  14. Chen, H.; Cheng, W.; Hong, C.; Chang, Y.; Chang, M. The transcription factor OsbHLH035 mediates seed germination and enables seedling recovery from salt stress through ABA-dependent and ABA-independent pathways, respectively. Rice 2018, 11, 50. [Google Scholar] [CrossRef] [PubMed]
  15. Li, Y.; Zhou, J.; Li, Z.; Qiao, J.; Quan, R.; Wang, J.; Huang, R.; Qin, H. ABA RESPONSE ERF1 improves seed germination and salt tolerance by repressing ABA signaling in rice. Plant Physiol. 2022, 189, 1110–1127. [Google Scholar] [CrossRef] [PubMed]
  16. Jiang, S.Y.; Ma, Z.; Ramachandran, S. Evolutionary history and stress regulation of the lectin superfamily inhigher plants. BMC Evol. Biol. 2010, 10, 79. [Google Scholar] [CrossRef]
  17. Tsaneva, M.; De Schutter, K.; Verstraeten, B.; Van Damme, E.J.M. Lectin Sequence Distribution in QTLs from Rice (Oryza sativa) Suggest A Role in Morphological Traits and Stress Responses. Int. J. Mol. Sci. 2019, 20, 437. [Google Scholar] [CrossRef] [PubMed]
  18. Damme, E.; Lannoo, N.; Peumans, W.J. Plant lectins. Adv. Bot. Res. 2008, 48, 107–209. [Google Scholar] [CrossRef]
  19. Song, M.; Xu, W.; Xiang, Y.; Jia, H.; Zhang, L.; Ma, Z. Association of jacalin-related lectins with wheat responses to stresses revealed by transcriptional profiling. Plant Mol. Biol. 2014, 84, 95–110. [Google Scholar] [CrossRef]
  20. Eggermont, L.; Verstraeten, B.; Damme, E.V. Genome-wide screening for lectin motifs in Arabidopsis thaliana. Plant Genome 2017, 10. [Google Scholar] [CrossRef]
  21. Van Holle, S.; Van Damme, E.J.M. Distribution and evolution of the lectin family in soybean (Glycine max). Molecules 2015, 20, 2868–2891. [Google Scholar] [CrossRef]
  22. Hirano, K.; Teraoka, T.; Yamanaka, H.; Harashima, A.; Kunisaki, A.; Takahashi, H.; Hosokawa, D. Novel mannose-binding rice lectin composed of some isolectins and its relation to a stress inducible salT gene. Plant Cell Physiol. 2000, 41, 258–267. [Google Scholar] [CrossRef] [PubMed]
  23. Sharon, N.; Lis, H. Lectins as cell recognition molecules. Science 1989, 246, 227–234. [Google Scholar] [CrossRef]
  24. Atalah, B.A.; Smagghe, G.; Damme, E.V.J.P.S. Orysata, a jacalin-related lectin from rice, could protect plants against biting-chewing and piercing-sucking insects. Plant Sci. 2014, 221–222, 21–28. [Google Scholar] [CrossRef] [PubMed]
  25. Bourne, Y.; Roig-Zamboni, V.; Barre, A.; Peumans, W.; Astoul, C.; Van Damme, E. The crystal structure of the Calystegia sepium agglutinin reveals a novel quaternary arrangement of lectin subunits with a beta-prism fold. J. Biol. Chem. 2004, 279, 527–533. [Google Scholar] [CrossRef] [PubMed]
  26. Lannoo, N.; Van Damme, E. Lectin domains at the frontiers of plant defense. Front. Plant Sci. 2014, 5, 397. [Google Scholar] [CrossRef]
  27. Zhang, Z.; Huang, B.; Chen, J.; Jiao, Y.; Guo, H.; Liu, S.; Ramakrishnan, M.; Qi, G. Genome-Wide Identification of JRL Genes in Moso Bamboo and Their Expression Profiles in Response to Multiple Hormones and Abiotic Stresses. Front. Plant Sci. 2022, 12, 809666. [Google Scholar] [CrossRef]
  28. Jiang, J.; Han, Y.; Xing, L.; Xu, Y.; Xu, Z.; Chong, K. Cloning and expression of a novel cDNA encoding a mannose-specific jacalin-related lectin from Oryza sativa. Toxicon 2006, 47, 133–139. [Google Scholar] [CrossRef]
  29. Jiang, J.; Xu, Y.; Chong, K. Overexpression of OsJAC1, a Lectin gene, suppresses the coleoptile and stem elongation in Rice. J. Integr. Plant Biol. 2007, 49, 230–237. [Google Scholar] [CrossRef]
  30. Weidenbach, D.; Esch, L.; Moller, C.; Hensel, G.; Kumlehn, J.; Hofle, C.; Huckelhoven, R.; Schaffrath, U. Polarized defense against fungal pathogens is mediated by the Jacalin-related Lectin domain of modular Poaceae-specific proteins. Mol. Plant 2016, 9, 514–527. [Google Scholar] [CrossRef]
  31. Witzel, K.; Matros, A.; Bertsch, U.; Aftab, T.; Rutten, T.; Ramireddy, E.; Melzer, M.; Kunze, G.; Mock, H. The Jacalin-Related Lectin HvHorcH Is Involved in the Physiological Response of Barley Roots to Salt Stress. Int. J. Mol. Sci. 2021, 22, 10248. [Google Scholar] [CrossRef]
  32. Sofie, V.H.; Kristof, D.S.; Lore, E.; Mariya, T.; Dang, L.; Els, V.D. Comparative Study of Lectin Domains in Model Species: New Insights into Evolutionary Dynamics. Int. J. Mol. Sci. 2017, 18, 1136–1164. [Google Scholar] [CrossRef]
  33. Zhang, W.; Peumans, W.J.; Barre, A.; Astoul, C.H.; Rovira, P.; Rougé, P. Isolation and characterization of a jacalin-related mannose-binding lectin from salt-stressed rice (Oryza sativa) plants. Planta 2000, 210, 970–978. [Google Scholar] [CrossRef] [PubMed]
  34. Lee, R.H.; Wang, C.H.; Huang, L.T.; Chen, S.C.G. Leaf senescence in rice plants: Cloning and characterization of senescence up-regulated genes. J. Exp. Bot. 2001, 52, 1117–1122. [Google Scholar] [CrossRef]
  35. Filho, G.; Ferreira, B.S.; Dias, J.M.; Queiroz, K.S.; Branco, A.T.; Bressan-Smith, R.E. Accumulation of SALT protein in rice plants as a response to environmental stresses. Plant Sci. 2003, 164, 623–628. [Google Scholar] [CrossRef]
  36. Qin, Q.M.; Zhang, Q.; Zhao, W.S.; Wang, Y.Y.; Peng, Y.L. Identification of a Lectin Gene Induced in Rice in Response to Magnaporthe grisea Infection. Acta Bot. Sin. 2003, 45, 76–81. [Google Scholar] [CrossRef]
  37. Zhang, H.; Deng, C.; Yao, J.; Zhang, Y.; Deng, S.; Zhao, N. Molecular sciences populus euphratica jrl mediates aba response, ionic and ros homeostasis in arabidopsis under salt stress. Int. J. Mol. Sci. 2019, 20, 815. [Google Scholar] [CrossRef]
  38. Gao, Q.; Wang, H.; Yin, X.; Wang, F.; Hu, S.; Liu, W.; Chen, L.; Dai, X.; Liang, M. Identification of Salt Tolerance Related Candidate Genes in ‘Sea Rice 86’ at the Seedling and Reproductive Stages Using QTL-Seq and BSA-Seq. Genes 2023, 14, 458. [Google Scholar] [CrossRef] [PubMed]
  39. Takeda, M.; Sugimori, N.; Torizawa, T.; Terauchi, T.; Ono, A.M.; Yagi, H.; Yamaguchi, Y.; Kato, K.; Ikeya, T.; Jee, J.G. Structure of the putative 32 K Damyrosinase-binding protein from Arabidopsis (At3g16450.1) determined by SAIL-NMR. FEBS J. 2008, 275, 5873–5884. [Google Scholar] [CrossRef]
  40. Burow, M.; Losansky, A.; Muller, R.; Plock, A.; Kliebenstein, D.J.; Wittstock, U. The Genetic Basis of Constitutive and Herbivore-Induced ESP-Independent Nitrile Formation in Arabidopsis. Plant Physiol. 2009, 149, 561–574. [Google Scholar] [CrossRef]
  41. Raval, S.; Gowda, S.B.; Singh, D.D.; Chandra, N.R. A database analysis of jacalin-like lectins: Sequence-structure-function relationships. Glycobiology 2005, 14, 1247–1263. [Google Scholar] [CrossRef]
  42. Zhang, H.X.; Zhang, G.M.; Lu, X.T.; Zhou, D.W.; Han, X.G. Salt tolerance during seed germination and early seedling stages of 12 halophytes. Plant Soil 2015, 388, 229–241. [Google Scholar] [CrossRef]
  43. He, X.; Li, L.; Xu, H.; Xi, J.; Cao, X.; Xu, H. A rice jacalin-related mannose-binding lectin gene, OsJRL, enhances Escherichia coli viability under high salinity stress and improves salinity tolerance of rice. Plant Biol. 2017, 19, 257–261. [Google Scholar] [CrossRef] [PubMed]
  44. Dong, W.; Wang, M.; Xu, F.; Quan, T.; Peng, K.; Xiao, L. Wheat oxophytodienoate reductase gene TaOPR1 confers salinity tolerance via enhancement of abscisic acid signaling and reactive oxygen species scavenging. Plant Physiol. 2013, 161, 1217–1228. [Google Scholar] [CrossRef] [PubMed]
  45. Obata, T.; Kitamoto, H.K.; Nakamura, A.; Fukuda, A.; Tanaka, Y. Rice Shaker potassium channel OsKAT1 confers tolerance to salinity stress on yeast and rice cells. Plant Physiol. 2007, 144, 1978–1985. [Google Scholar] [CrossRef] [PubMed]
  46. Saad, A.; Li, X.; Li, H.P.; Huang, T.; Gao, C.S.; Guo, M.W.; Cheng, W.; Zhao, G.Y.; Liao, Y.C. A rice stress-responsive nac gene enhances tolerance of transgenic wheat to drought and salt stresses. Plant Sci. 2013, 203, 33–40. [Google Scholar] [CrossRef]
  47. Huang, J.J.; Liu, F.H.; Chao, D.; Xin, B.N.; Liu, K.; Cao, S.L.; Chen, X.X.; Peng, L.Y.; Zhang, B.L.; Fu, S.; et al. The WRKY Transcription Factor OsWRKY54 Is Involved in Salt Tolerance in Rice. Int. J. Mol. Sci. 2022, 23, 11999. [Google Scholar] [CrossRef]
  48. Deeba, F.; Sultana, T.; Majeed, N.; Naqvi, S.M.S. Heterologous expression of a plant WRKY protein confers multiple stress tolerance in E. coli. Biochem. Mol. Biol. 2020, 45, 131–141. [Google Scholar] [CrossRef]
  49. Yung, Y.L.; Cheung, M.Y.; Miao, R.; Fong, Y.H.; Li, K.P.; Yu, M.H.; Chye, M.L.; Wong, K.B.; Lam, H.M. Site-directed Mutagenesis Shows the Significance of Interactions with Phospholipids and the G-protein OsYchF1 for the Physiological Functions of the Rice GTPase-activating Protein 1 (OsGAP1). Biochem. Mol. Biol. 2015, 290, 23984–23996. [Google Scholar] [CrossRef]
  50. Ishikawa, T.; Shabala, S. Control of xylem Na+ loading and transport to the shoot in rice and barley as a determinant of differential salinity stress tolerance. Physiol. Plant. 2018, 165, 619–631. [Google Scholar] [CrossRef]
  51. Saha, J.; Chaudhuri, D.; Kundu, A.; Bhattacharya, S.; Roy, S.; Giri, K. Phylogenetic, structural, functional characterisation and effect of exogenous spermidine on rice (Oryza sativa) HAK transporters under salt stress. Funct. Plant Biol. 2023, 50, 160–182. [Google Scholar] [CrossRef] [PubMed]
  52. Musavizadeh, Z.; Najafi-Zarrini, H.; Kazemitabar, S.K.; Hashemi, S.H.; Faraji, S.; Barcaccia, G.; Heidari, P. Genome-Wide Analysis of Potassium Channel Genes in Rice: Expression of the OsAKT and OsKAT Genes under Salt Stress. Genes 2021, 12, 784. [Google Scholar] [CrossRef] [PubMed]
  53. Cai, K.; Zeng, F.; Wang, J.; Zhang, G. Identification and characterization of HAK/KUP/KT potassium transporter gene family in barley and their expression under abiotic stress. BMC Genom. 2021, 22, 317. [Google Scholar] [CrossRef] [PubMed]
  54. Su, H.; Golldack, D.; Katsuhara, M.; Zhao, C.; Bohnert, H.J. Expression and Stress-Dependent Induction of Potassium Channel Transcripts in the Common Ice Plan. Plant Physiol. 2001, 125, 604–614. [Google Scholar] [CrossRef]
  55. Shen, J.B.; Lv, B.; Luo, L.Q.; He, J.M.; Mao, C.J.; Xi, D.D.; Ming, F. The NAC-type transcription factor OsNAC2 regulates ABA-dependent genes and abiotic stress tolerance in rice. Sci. Rep. 2017, 7, 40641. [Google Scholar] [CrossRef]
  56. Yoo, J.H.; Park, C.Y.; Kim, J.C.; Heo, W.D.; Cheong, M.S.; Park, H.C.; Kim, M.C.; Moon, B.C.; Choi, M.S.; Kang, Y.H.; et al. Direct interaction of a divergent CaM isoform and the transcription factor, MYB2, enhances salt tolerance in Arabidopsis. Biochem. Mol. Biol. 2005, 280, 3697–3706. [Google Scholar] [CrossRef]
  57. Ni, L.; Fu, X.; Zhang, H.; Li, X.; Cai, X.; Zhang, P. Abscisic acid inhibits rice protein phosphatase pp45 via H2O2 and relieves repression of the Ca2+/cam-dependent protein kinase dmi3. Am. Soc. Plant Biol. 2019, 31, 128–152. [Google Scholar] [CrossRef] [PubMed]
  58. Jin, M.; Guo, D.; Zhang, J.; Huang, Q.; Qu, G.; Xin, Z. Targeted mutagenesis in rice using CRISPR- Cas9system. Cell Res. 2013, 23, 1233–1236. [Google Scholar] [CrossRef]
  59. Hiei, Y.; Ohta, S.; Komari, T.; Kumashiro, T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 1994, 6, 271–282. [Google Scholar] [CrossRef] [PubMed]
  60. Li, J.; Huang, Y.; Tan, H.; Yang, X.; Tian, L.F.; Luan, S. An endoplasmic reticulum magnesium transporter is essential for pollen development in Arabidopsis. Plant Sci. 2015, 231, 212–220. [Google Scholar] [CrossRef]
  61. Huang, Y.; Jiao, Y.; Xie, N.; Guo, Y.; Zhang, F.; Xiang, Z.; Wang, R.; Wang, F.; Gao, Q.; Tian, L.; et al. OsNCED5, a 9-cis-epoxycarotenoid dioxygenase gene, regulates salt and water stress tolerance and leaf senescence in rice. Plant Sci. 2019, 287, 110188. [Google Scholar] [CrossRef] [PubMed]
  62. Heath, R.L.; Packer, L. Photoperoxidation in isolated chloroplasts. I. Kinetics and stoichiometry of fatty acid peroxidation. Arch. Biochem. Biophys. 1968, 125, 180–198. [Google Scholar] [CrossRef] [PubMed]
  63. Wang, X.; Li, J.; Li, F.; Pan, Y.; Cai, D.; Mao, D. Rice potassium transporter OsHAK8 mediates K+ uptake and translocation in response to low K+ stress. Front. Plant Sci. 2021, 12, 730002. [Google Scholar] [CrossRef] [PubMed]
  64. Wang, F.; Cheng, Z.; Wang, J.; Zhang, F.; Zhang, B.; Luo, S.; Lei, C.; Pan, T.; Wang, Y.; Zhu, Y. Rice STOMATAL CYTOKINESIS DEFECTIVE2 regulates cell expansion by affecting vesicular trafficking in rice. Plant Physiol. 2022, 189, 567–584. [Google Scholar] [CrossRef] [PubMed]
  65. Zhang, K.; Su, J.; Xu, M.; Zhou, Z.; Zhu, X.; Ma, X. A common wild rice-derived boc1 allele reduces callus browning in indica rice transformation. Nat. Publ. Group 2020, 11, 443. [Google Scholar] [CrossRef] [PubMed]
  66. Conesa, A.; Götz, S.; García-Gómez, J.M.; Terol, J.; Talón, M.; Robles, M. Blast2GO: A universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 2005, 21, 3674–3676. [Google Scholar] [CrossRef]
  67. Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, D480–D484. [Google Scholar] [CrossRef]
Ijms 24 07441 g001 550
Figure 1. Analysis of OsJRL40 amino acid sequence and phylogenetic relationship. (A) Amino acid sequence alignment of OsJRL40, barley LEM2 (AAM18206), TaJRLL1 (ADP37001), AtJRL33 (NP_001030711), and AtNSP4 (NP_188262). Dark shading indicates conserved residues, and invariant residues are marked with lowercase letters. Asterisks indicate mannose-binding sites in the Heltuba protein. ‘*’ represents the mannose-binding site. (B) Analysis of the evolutionary relationship between OsJRL40 and JRLs in other species (rice, Arabidopsis, wheat, maize, and soybean). The phylogenetic tree was constructed using the neighbor-joining method in MEGA 7.
Figure 1. Analysis of OsJRL40 amino acid sequence and phylogenetic relationship. (A) Amino acid sequence alignment of OsJRL40, barley LEM2 (AAM18206), TaJRLL1 (ADP37001), AtJRL33 (NP_001030711), and AtNSP4 (NP_188262). Dark shading indicates conserved residues, and invariant residues are marked with lowercase letters. Asterisks indicate mannose-binding sites in the Heltuba protein. ‘*’ represents the mannose-binding site. (B) Analysis of the evolutionary relationship between OsJRL40 and JRLs in other species (rice, Arabidopsis, wheat, maize, and soybean). The phylogenetic tree was constructed using the neighbor-joining method in MEGA 7.
Ijms 24 07441 g001
Ijms 24 07441 g002 550
Figure 2. Expression analysis of OsJRL40. (A) RT-qPCR analysis of OsJRL40 in rice seedlings treated with 100 mM NaCl. (B) RT-qPCR analysis of OsJRL40 in rice seedlings treated with 100 uM ABA. (C) Transcript levels of OsJRL40 in different organs of rice plants including the root (R), node (N), leaf (L), culm (C), flower (F), and embryo (E). (D) Analysis of GUS staining in transgenic plants expressing the OsJRL40-Pro: GUS construct. GUS staining of seedlings (a), culms and nodes (b), leaves (c), panicles (d), root cross-sections (e), and leaf cross-sections (f) are shown. Scale bar = 20 μm. (E) Subcellular localization analysis of OsJRL40 in Nip rice by confocal fluorescence microscopy. The red signal represents chlorophyll autofluorescence, and the green fluorescence represents the OsJRL40-GFP fusion protein. Scale bar = 10 μm.
Figure 2. Expression analysis of OsJRL40. (A) RT-qPCR analysis of OsJRL40 in rice seedlings treated with 100 mM NaCl. (B) RT-qPCR analysis of OsJRL40 in rice seedlings treated with 100 uM ABA. (C) Transcript levels of OsJRL40 in different organs of rice plants including the root (R), node (N), leaf (L), culm (C), flower (F), and embryo (E). (D) Analysis of GUS staining in transgenic plants expressing the OsJRL40-Pro: GUS construct. GUS staining of seedlings (a), culms and nodes (b), leaves (c), panicles (d), root cross-sections (e), and leaf cross-sections (f) are shown. Scale bar = 20 μm. (E) Subcellular localization analysis of OsJRL40 in Nip rice by confocal fluorescence microscopy. The red signal represents chlorophyll autofluorescence, and the green fluorescence represents the OsJRL40-GFP fusion protein. Scale bar = 10 μm.
Ijms 24 07441 g002
Ijms 24 07441 g003 550
Figure 3. OsJRL40 confers salt stress tolerance in rice. (A) Schematic representation of the OsJRL40 CDS. Black and gray rectangles indicate exons and intron, respectively. The CRISPR/Cas9-targeted sites used for the generation of osjrl40 KO mutants are indicated. The 1-nt deletion and 1-nt insertion in OsJRL40 exons in KO1 and KO2 lines, respectively, are also shown. Premature stop codons in the deduced amino acid sequences of the mutant OsJRL40 proteins are indicated with asterisks. (B) Relative expression levels of OsJRL40 in WT, OE1, and OE2 leaves. (C) Phenotypic comparison of KO1, KO2, OE1, OE2, and WT seedlings treated with 100 mM NaCl at the three-leaf stage. (D–F) Chlorophyll content (D), fresh weight (E), and survival rate (F) of KO1, KO2, OE1, OE2, and WT seedlings treated with 100 mM NaCl. Data represent mean ± standard deviation (SD) of three independent replicates. Asterisks indicate statistically significant differences (Student’s t-test; * p < 0.05, ** p < 0.01).
Figure 3. OsJRL40 confers salt stress tolerance in rice. (A) Schematic representation of the OsJRL40 CDS. Black and gray rectangles indicate exons and intron, respectively. The CRISPR/Cas9-targeted sites used for the generation of osjrl40 KO mutants are indicated. The 1-nt deletion and 1-nt insertion in OsJRL40 exons in KO1 and KO2 lines, respectively, are also shown. Premature stop codons in the deduced amino acid sequences of the mutant OsJRL40 proteins are indicated with asterisks. (B) Relative expression levels of OsJRL40 in WT, OE1, and OE2 leaves. (C) Phenotypic comparison of KO1, KO2, OE1, OE2, and WT seedlings treated with 100 mM NaCl at the three-leaf stage. (D–F) Chlorophyll content (D), fresh weight (E), and survival rate (F) of KO1, KO2, OE1, OE2, and WT seedlings treated with 100 mM NaCl. Data represent mean ± standard deviation (SD) of three independent replicates. Asterisks indicate statistically significant differences (Student’s t-test; * p < 0.05, ** p < 0.01).
Ijms 24 07441 g003
Ijms 24 07441 g004 550
Figure 4. OsJRL40 enhances salt tolerance of rice plants at the reproductive stage. (A–C) Phenotypic comparison of WT, KO1, KO2, OE2, and OE2 plants under normal (0 mM NaCl) and salt stress (150 mM NaCl) conditions. Scale bar = 5 cm. (D–H) Plant height (D), effective panicle number (E), main panicle length (F), seed setting rate (G) and thousand grain weight (H) of WT, KO1, KO2, OE2, and OE2 plants. Data represent mean ± SD (n = 10), and asterisks indicate statistically significant differences (* p < 0.05, ** p < 0.01; Student’s t-test).
Figure 4. OsJRL40 enhances salt tolerance of rice plants at the reproductive stage. (A–C) Phenotypic comparison of WT, KO1, KO2, OE2, and OE2 plants under normal (0 mM NaCl) and salt stress (150 mM NaCl) conditions. Scale bar = 5 cm. (D–H) Plant height (D), effective panicle number (E), main panicle length (F), seed setting rate (G) and thousand grain weight (H) of WT, KO1, KO2, OE2, and OE2 plants. Data represent mean ± SD (n = 10), and asterisks indicate statistically significant differences (* p < 0.05, ** p < 0.01; Student’s t-test).
Ijms 24 07441 g004
Ijms 24 07441 g005 550
Figure 5. Germination of WT, KO1, KO2, OE1, and OE2 seeds in the ABA treatment. (A) Germination of OE1 and OE2 seeds treated with 0, 2, and 5 μM ABA for 5 days. (B) Germination rates of WT, KO, and OE seeds on 1/2 MS medium containing 0, 2, and 5 μM ABA. (C) Growth of WT, KO, and OE plants treated with 0, 2, and 5 μM ABA after seed germination on 1/2 MS medium for 2 days. Scale bar = 2 cm. (D,E) Shoot length (D) and root length of WT, KO, and OE plants. Data represent the mean ± SD of three independent replicates. Asterisks indicate statistically significant differences (* p < 0.05, ** p < 0.01).
Figure 5. Germination of WT, KO1, KO2, OE1, and OE2 seeds in the ABA treatment. (A) Germination of OE1 and OE2 seeds treated with 0, 2, and 5 μM ABA for 5 days. (B) Germination rates of WT, KO, and OE seeds on 1/2 MS medium containing 0, 2, and 5 μM ABA. (C) Growth of WT, KO, and OE plants treated with 0, 2, and 5 μM ABA after seed germination on 1/2 MS medium for 2 days. Scale bar = 2 cm. (D,E) Shoot length (D) and root length of WT, KO, and OE plants. Data represent the mean ± SD of three independent replicates. Asterisks indicate statistically significant differences (* p < 0.05, ** p < 0.01).
Ijms 24 07441 g005
Ijms 24 07441 g006 550
Figure 6. OsJRL40 increased the antioxidant capacity of rice under salt stress. (A,B) DAB staining of the leaves of WT, KO, and OE seedlings exposed to salt stress for 2 d. (C) Percent electrolyte leakage. (D) H2O2 content. (E) Malondialdehyde (MDA) content. (F) Superoxide dismutase (SOD) activity. (G) Peroxidase (POD) activity. In (C–G), 15-day-old seedlings were treated with 100 mM NaCl for 2 d prior to the sampling of leaves. Data represent the mean ± SD of three independent replicates. Asterisks indicate statistically significant differences (Student’s t-test; * p < 0.05, ** p < 0.01).
Figure 6. OsJRL40 increased the antioxidant capacity of rice under salt stress. (A,B) DAB staining of the leaves of WT, KO, and OE seedlings exposed to salt stress for 2 d. (C) Percent electrolyte leakage. (D) H2O2 content. (E) Malondialdehyde (MDA) content. (F) Superoxide dismutase (SOD) activity. (G) Peroxidase (POD) activity. In (C–G), 15-day-old seedlings were treated with 100 mM NaCl for 2 d prior to the sampling of leaves. Data represent the mean ± SD of three independent replicates. Asterisks indicate statistically significant differences (Student’s t-test; * p < 0.05, ** p < 0.01).
Ijms 24 07441 g006
Ijms 24 07441 g007 550
Figure 7. Effects of OsJRL40 on Na+ and K+ accumulation in rice seedlings under salt stress conditions. Fifteen–day–old seedlings were treated with a hydroponic medium containing 100 mM NaCl for 2 days. (A,B) Contents of Na+ (A) and K+ (B) in shoots. (C) Na+/K+ ratio in shoots. (D,E) Contents of Na+ (D) and K+ (E) in roots. (F) Na+/K+ ratio in roots. Data represent mean ± SD (n = 3). Asterisks indicate statistically significant differences (Student’s t-test; * p < 0.05, ** p < 0.01). DW, dry weight.
Figure 7. Effects of OsJRL40 on Na+ and K+ accumulation in rice seedlings under salt stress conditions. Fifteen–day–old seedlings were treated with a hydroponic medium containing 100 mM NaCl for 2 days. (A,B) Contents of Na+ (A) and K+ (B) in shoots. (C) Na+/K+ ratio in shoots. (D,E) Contents of Na+ (D) and K+ (E) in roots. (F) Na+/K+ ratio in roots. Data represent mean ± SD (n = 3). Asterisks indicate statistically significant differences (Student’s t-test; * p < 0.05, ** p < 0.01). DW, dry weight.
Ijms 24 07441 g007
Ijms 24 07441 g008 550
Figure 8. Comparison of the salt tolerance phenotypes of yeast BY4741 cells expressing OsJRL40 or the empty pYES2 vector control. Ten-fold serial dilutions of yeast cultures were spotted onto plates containing various concentrations of NaCl and incubated at 30 °C. Pictures were taken after 7 days.
Figure 8. Comparison of the salt tolerance phenotypes of yeast BY4741 cells expressing OsJRL40 or the empty pYES2 vector control. Ten-fold serial dilutions of yeast cultures were spotted onto plates containing various concentrations of NaCl and incubated at 30 °C. Pictures were taken after 7 days.
Ijms 24 07441 g008
Ijms 24 07441 g009 550
Figure 9. Results of GO and KEGG enrichment analyses of WT and KO1 plants under normal and salt stress conditions. (A) Venn diagram showing the overlap of DEGs identified in WT and KO1 seedlings under normal and salt stress conditions. KO-H2O/WT-H2O-Up/Down: DEGs up-regulated and down-regulated in KO1 plants compared with the WT under normal conditions; KO-NaCl/WT-NaCl-Up/Down: DEGs up-regulated and down-regulated in KO1 plants compared with the WT under salt stress conditions; (B) KEGG enrichment analysis of DEGs detected under normal conditions. (C) Functional annotation of genes differentially expressed between WT and KO1 plants with normal conditions. These genes were grouped into three categories: biological process (green columns), cellular component (blue columns), and molecular function (purple columns).
Figure 9. Results of GO and KEGG enrichment analyses of WT and KO1 plants under normal and salt stress conditions. (A) Venn diagram showing the overlap of DEGs identified in WT and KO1 seedlings under normal and salt stress conditions. KO-H2O/WT-H2O-Up/Down: DEGs up-regulated and down-regulated in KO1 plants compared with the WT under normal conditions; KO-NaCl/WT-NaCl-Up/Down: DEGs up-regulated and down-regulated in KO1 plants compared with the WT under salt stress conditions; (B) KEGG enrichment analysis of DEGs detected under normal conditions. (C) Functional annotation of genes differentially expressed between WT and KO1 plants with normal conditions. These genes were grouped into three categories: biological process (green columns), cellular component (blue columns), and molecular function (purple columns).
Ijms 24 07441 g009
Ijms 24 07441 g010 550
Figure 10. GO and KEGG enrichment analyses of DEGs detected in WT and KO1 plants under salt stress. (A,B) Volcan plots of DEGs detected under normal conditions (A) and salt stress conditions (B). (C) KEGG enrichment analysis of DEGs detected under salt stress conditions. (D) Categorization and functional annotation of DEGs. The different categories were as follows: biological process (green columns), cellular component (blue columns), and molecular function (purple columns).
Figure 10. GO and KEGG enrichment analyses of DEGs detected in WT and KO1 plants under salt stress. (A,B) Volcan plots of DEGs detected under normal conditions (A) and salt stress conditions (B). (C) KEGG enrichment analysis of DEGs detected under salt stress conditions. (D) Categorization and functional annotation of DEGs. The different categories were as follows: biological process (green columns), cellular component (blue columns), and molecular function (purple columns).
Ijms 24 07441 g010
Ijms 24 07441 g011 550
Figure 11. GO and KEGG enrichment analyses of DEGs regulated by OsJRL40. (A) Venn diagram showing the number of genes up-regulated (fold change > 1.5) in KO1 plants compared with WT plants under normal and salt stress conditions. (B) KEGG enrichment results. (C) Categorization and functional annotation of DEGs detected in KO1 plants under salt stress. The different categories were as follows: biological process (green columns), cellular component (blue columns), and molecular function (purple columns).
Figure 11. GO and KEGG enrichment analyses of DEGs regulated by OsJRL40. (A) Venn diagram showing the number of genes up-regulated (fold change > 1.5) in KO1 plants compared with WT plants under normal and salt stress conditions. (B) KEGG enrichment results. (C) Categorization and functional annotation of DEGs detected in KO1 plants under salt stress. The different categories were as follows: biological process (green columns), cellular component (blue columns), and molecular function (purple columns).
Ijms 24 07441 g011
Ijms 24 07441 g012 550
Figure 12. OsJRL40 regulates the expression of salt stress signaling-related genes under salt stress. WT, KO1, KO2, OE1, and OE2 seedlings at the three-leaf stage were treated with 100 mM NaCl for 8 h. After RNA extraction and reverse transcription, RT-qPCR was performed. Osactin was used as the internal control gene. Data represent the mean ± SD of three independent replicates. Asterisks indicate statistically significant differences (* p < 0.05, ** p < 0.01).
Figure 12. OsJRL40 regulates the expression of salt stress signaling-related genes under salt stress. WT, KO1, KO2, OE1, and OE2 seedlings at the three-leaf stage were treated with 100 mM NaCl for 8 h. After RNA extraction and reverse transcription, RT-qPCR was performed. Osactin was used as the internal control gene. Data represent the mean ± SD of three independent replicates. Asterisks indicate statistically significant differences (* p < 0.05, ** p < 0.01).
Ijms 24 07441 g012
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gao, Q.; Yin, X.; Wang, F.; Hu, S.; Liu, W.; Chen, L.; Dai, X.; Liang, M. OsJRL40, a Jacalin-Related Lectin Gene, Promotes Salt Stress Tolerance in Rice. Int. J. Mol. Sci. 2023, 24, 7441. https://doi.org/10.3390/ijms24087441

AMA Style

Gao Q, Yin X, Wang F, Hu S, Liu W, Chen L, Dai X, Liang M. OsJRL40, a Jacalin-Related Lectin Gene, Promotes Salt Stress Tolerance in Rice. International Journal of Molecular Sciences. 2023; 24(8):7441. https://doi.org/10.3390/ijms24087441

Chicago/Turabian Style

Gao, Qinmei, Xiaolin Yin, Feng Wang, Shuchang Hu, Weihao Liu, Liangbi Chen, Xiaojun Dai, and Manzhong Liang. 2023. "OsJRL40, a Jacalin-Related Lectin Gene, Promotes Salt Stress Tolerance in Rice" International Journal of Molecular Sciences 24, no. 8: 7441. https://doi.org/10.3390/ijms24087441

APA Style

Gao, Q., Yin, X., Wang, F., Hu, S., Liu, W., Chen, L., Dai, X., & Liang, M. (2023). OsJRL40, a Jacalin-Related Lectin Gene, Promotes Salt Stress Tolerance in Rice. International Journal of Molecular Sciences, 24(8), 7441. https://doi.org/10.3390/ijms24087441

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop