Exploring the Therapeutic Potential of Ampelopsis grossedentata Leaf Extract as an Anti-Inflammatory and Antioxidant Agent in Human Immune Cells
Abstract
:1. Introduction
2. Results
2.1. Quantification of Dihydromyricetin (DHM) Content with HPLC-UV
2.2. Ampelopsis Grossedentata Extract Inhibited ROS Production via Blood Leukocytes
2.3. Ampelopsis Grossedentata Extract Significantly Decreased the Production of Pro-Inflammatory Cytokines in PHA-Stimulated PBMCs
2.4. Ampelopsis Grossedentata Extract Inhibited the Activation of NF-κB in LPS-Stimulated PBMCs
2.5. Ampelopsis Grossedentata Extract Inhibited the NRLP3 Gene-Expression Pathway and COX-2 in LPS-Stimulated Blood Leukocytes
2.6. Ampelopsis Grossedentata Extract Significantly Decreased the Gene Expression of Inflammatory Cytokines in M1-Type Macrophages
3. Discussion
4. Materials and Methods
4.1. Quantification of Dihydromyricetin (DHM) Content using HPLC-UV
4.2. Preparation of Ampelopsis Grossedentata Extract
4.3. Blood Leukocyte Preparation
4.4. PBMC Preparation from Human Blood
4.5. Human Monocytic Leukemia Cells
4.6. Kinetics of ROS Production by Leukocytes
4.7. Leukocyte Viability
4.8. DPPH Assay
4.9. Elisa PGE2
4.10. Determination of Cytokine Concentrations
4.11. Real-Time Quantitative PCR (RT-qPCR)
4.12. Quantitative Measurement of NF-κB by ELISA
4.13. Flow Cytometry
4.14. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Medzhitov, R. Inflammation 2010: New Adventures of an Old Flame. Cell 2010, 140, 771–776. [Google Scholar] [CrossRef]
- Nathan, C.; Ding, A. Nonresolving Inflammation. Cell 2010, 140, 871–882. [Google Scholar] [CrossRef] [PubMed]
- Kaplanski, G.; Marin, V.; Montero-Julian, F.; Mantovani, A.; Farnarier, C. IL-6: A Regulator of the Transition from Neutrophil to Monocyte Recruitment during Inflammation. Trends Immunol. 2003, 24, 25–29. [Google Scholar] [CrossRef] [PubMed]
- Tsuge, K.; Inazumi, T.; Shimamoto, A.; Sugimoto, Y. Molecular Mechanisms Underlying Prostaglandin E2-Exacerbated Inflammation and Immune Diseases. Int. Immunol. 2019, 31, 597–606. [Google Scholar] [CrossRef] [PubMed]
- Blaser, H.; Dostert, C.; Mak, T.W.; Brenner, D. TNF and ROS Crosstalk in Inflammation. Trends Cell Biol. 2016, 26, 249–261. [Google Scholar] [CrossRef]
- Mitchell, J.P.; Carmody, R.J. Chapter Two—NF-κB and the Transcriptional Control of Inflammation. In International Review of Cell and Molecular Biology; Loos, F., Ed.; Transcriptional Gene Regulation in Health and Disease; Academic Press: Cambridge, MA, USA, 2018; Volume 335, pp. 41–84. [Google Scholar]
- Morgan, M.J.; Liu, Z. Crosstalk of Reactive Oxygen Species and NF-κB Signaling. Cell Res. 2011, 21, 103–115. [Google Scholar] [CrossRef]
- Swanson, K.V.; Deng, M.; Ting, J.P.-Y. The NLRP3 Inflammasome: Molecular Activation and Regulation to Therapeutics. Nat. Rev. Immunol. 2019, 19, 477–489. [Google Scholar] [CrossRef]
- Serafini, M.; Peluso, I.; Raguzzini, A. Flavonoids as Anti-Inflammatory Agents. Proc. Nutr. Soc. 2010, 69, 273–278. [Google Scholar] [CrossRef]
- Leyva-López, N.; Gutierrez-Grijalva, E.P.; Ambriz-Perez, D.L.; Heredia, J.B. Flavonoids as Cytokine Modulators: A Possible Therapy for Inflammation-Related Diseases. Int. J. Mol. Sci. 2016, 17, 921. [Google Scholar] [CrossRef]
- Xiao, X.; Shi, D.; Liu, L.; Wang, J.; Xie, X.; Kang, T.; Deng, W. Quercetin Suppresses Cyclooxygenase-2 Expression and Angiogenesis through Inactivation of P300 Signaling. PLoS ONE 2011, 6, e22934. [Google Scholar] [CrossRef]
- Mendes, L.F.; Gaspar, V.M.; Conde, T.A.; Mano, J.F.; Duarte, I.F. Flavonoid-Mediated Immunomodulation of Human Macrophages Involves Key Metabolites and Metabolic Pathways. Sci. Rep. 2019, 9, 14906. [Google Scholar] [CrossRef]
- Pietta, P.-G. Flavonoids as Antioxidants. J. Nat. Prod. 2000, 63, 1035–1042. [Google Scholar] [CrossRef]
- Yamagata, K.; Miyashita, A.; Matsufuji, H.; Chino, M. Dietary Flavonoid Apigenin Inhibits High Glucose and Tumor Necrosis Factor α-Induced Adhesion Molecule Expression in Human Endothelial Cells. J. Nutr. Biochem. 2010, 21, 116–124. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Zhao, Y.; Zhang, M.; Zhang, Y.; Ji, H.; Shen, L. Recent Advances in Research on Vine Tea, a Potential and Functional Herbal Tea with Dihydromyricetin and Myricetin as Major Bioactive Compounds. J. Pharm. Anal. 2021, 11, 555–563. [Google Scholar] [CrossRef] [PubMed]
- Tang, N.; Ma, J.; Wang, K.S.; Mi, C.; Lv, Y.; Piao, L.X.; Xu, G.H.; Li, X.; Lee, J.J.; Jin, X. Dihydromyricetin Suppresses TNF-α-Induced NF-κB Activation and Target Gene Expression. Mol. Cell. Biochem. 2016, 422, 11–20. [Google Scholar] [CrossRef] [PubMed]
- Hou, X.; Tong, Q.; Wang, W.; Xiong, W.; Shi, C.; Fang, J. Dihydromyricetin Protects Endothelial Cells from Hydrogen Peroxide-Induced Oxidative Stress Damage by Regulating Mitochondrial Pathways. Life Sci. 2015, 130, 38–46. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Liu, J.; Liu, B.; Xia, J.; Chen, N.; Chen, X.; Cao, Y.; Zhang, C.; Lu, C.; Li, M.; et al. Dihydromyricetin Promotes Hepatocellular Carcinoma Regression via a P53 Activation-Dependent Mechanism. Sci. Rep. 2014, 4, 4628. [Google Scholar] [CrossRef]
- Le, L.; Jiang, B.; Wan, W.; Zhai, W.; Xu, L.; Hu, K.; Xiao, P. Metabolomics Reveals the Protective of Dihydromyricetin on Glucose Homeostasis by Enhancing Insulin Sensitivity. Sci. Rep. 2016, 6, 36184. [Google Scholar] [CrossRef]
- Furman, D.; Campisi, J.; Verdin, E.; Carrera-Bastos, P.; Targ, S.; Franceschi, C.; Ferrucci, L.; Gilroy, D.W.; Fasano, A.; Miller, G.W.; et al. Chronic Inflammation in the Etiology of Disease across the Life Span. Nat. Med. 2019, 25, 1822–1832. [Google Scholar] [CrossRef]
- Gao, Q.; Ma, R.; Chen, L.; Shi, S.; Cai, P.; Zhang, S.; Xiang, H. Antioxidant Profiling of Vine Tea (Ampelopsis grossedentata): Off-Line Coupling Heart-Cutting HSCCC with HPLC–DAD–QTOF-MS/MS. Food Chem. 2017, 225, 55–61. [Google Scholar] [CrossRef]
- Gao, J.; Liu, B.; Ning, Z.; Zhao, R.; Zhang, A.; Wu, Q. Characterization and Antioxidant Activity of Flavonoid-Rich Extracts from Leaves of Ampelopsis grossedentata. J. Food Biochem. 2009, 33, 808–820. [Google Scholar] [CrossRef]
- Xiao, X.-N.; Wang, F.; Yuan, Y.-T.; Liu, J.; Liu, Y.-Z.; Yi, X. Antibacterial Activity and Mode of Action of Dihydromyricetin from Ampelopsis grossedentata Leaves against Food-Borne Bacteria. Molecules 2019, 24, 2831. [Google Scholar] [CrossRef]
- Zhu, H.; Luo, P.; Fu, Y.; Wang, J.; Dai, J.; Shao, J.; Yang, X.; Chang, L.; Weng, Q.; Yang, B.; et al. Dihydromyricetin Prevents Cardiotoxicity and Enhances Anticancer Activity Induced by Adriamycin. Oncotarget 2014, 6, 3254–3267. [Google Scholar] [CrossRef]
- Qiu, P.; Dong, Y.; Li, B.; Kang, X.; Gu, C.; Zhu, T.; Luo, Y.; Pang, M.; Du, W.; Ge, W. Dihydromyricetin Modulates P62 and Autophagy Crosstalk with the Keap-1/Nrf2 Pathway to Alleviate Ethanol-Induced Hepatic Injury. Toxicol. Lett. 2017, 274, 31–41. [Google Scholar] [CrossRef]
- Silva, J.; Spatz, M.H.; Folk, C.; Chang, A.; Cadenas, E.; Liang, J.; Davies, D.L. Dihydromyricetin Improves Mitochondrial Outcomes in the Liver of Alcohol-Fed Mice via the AMPK/Sirt-1/PGC-1α Signaling Axis. Alcohol 2021, 91, 1–9. [Google Scholar] [CrossRef]
- Tong, Q.; Hou, X.; Fang, J.; Wang, W.; Xiong, W.; Liu, X.; Xie, X.; Shi, C. Determination of Dihydromyricetin in Rat Plasma by LC–MS/MS and Its Application to a Pharmacokinetic Study. J. Pharm. Biomed. Anal. 2015, 114, 455–461. [Google Scholar] [CrossRef]
- Wang, C.; Tong, Q.; Hou, X.; Hu, S.; Fang, J.; Sun, C.C. Enhancing Bioavailability of Dihydromyricetin through Inhibiting Precipitation of Soluble Cocrystals by a Crystallization Inhibitor. Cryst. Growth Des. 2016, 16, 5030–5039. [Google Scholar] [CrossRef]
- Lawrence, T. The Nuclear Factor NF-κB Pathway in Inflammation. Cold Spring Harb. Perspect. Biol. 2009, 1, a001651. [Google Scholar] [CrossRef]
- Hou, X.L.; Tong, Q.; Wang, W.Q.; Shi, C.Y.; Xiong, W.; Chen, J.; Liu, X.; Fang, J.G. Suppression of Inflammatory Responses by Dihydromyricetin, a Flavonoid from Ampelopsis grossedentata, via Inhibiting the Activation of NF-κB and MAPK Signaling Pathways. J. Nat. Prod. 2015, 78, 1689–1696. [Google Scholar] [CrossRef]
- Wang, R.; Pi, J.; Su, X.; Liu, J.; Zeng, X.; Wong, I.; Huang, L.; Zhou, H.; Cai, J.; Li, T.; et al. Dihydromyricetin Suppresses Inflammatory Responses in Vitro and in Vivo through Inhibition of IKKβ Activity in Macrophages. Scanning 2016, 38, 901–912. [Google Scholar] [CrossRef]
- Chu, J.; Wang, X.; Bi, H.; Li, L.; Ren, M.; Wang, J. Dihydromyricetin Relieves Rheumatoid Arthritis Symptoms and Suppresses Expression of Pro-Inflammatory Cytokines via the Activation of Nrf2 Pathway in Rheumatoid Arthritis Model. Int. Immunopharmacol. 2018, 59, 174–180. [Google Scholar] [CrossRef] [PubMed]
- The Water Extract of Ampelopsis Grossedentata Alleviates Oxidative Stress and Intestinal Inflammation—PMC. Available online: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10045513/ (accessed on 21 December 2023).
- Lu, Y.-C.; Yeh, W.-C.; Ohashi, P.S. LPS/TLR4 Signal Transduction Pathway. Cytokine 2008, 42, 145–151. [Google Scholar] [CrossRef] [PubMed]
- Raphael, I.; Nalawade, S.; Eagar, T.N.; Forsthuber, T.G. T Cell Subsets and Their Signature Cytokines in Autoimmune and Inflammatory Diseases. Cytokine 2015, 74, 5–17. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, E.V.M.M.; Oliveira, W.F.; Coelho, L.C.B.B.; Correia, M.T.S. Lectins as Mitosis Stimulating Factors: Briefly Reviewed. Life Sci. 2018, 207, 152–157. [Google Scholar] [CrossRef] [PubMed]
- Lim, J.W.; Kim, H.; Kim, K.H. Nuclear Factor-κB Regulates Cyclooxygenase-2 Expression and Cell Proliferation in Human Gastric Cancer Cells. Lab. Investig. 2001, 81, 349–360. [Google Scholar] [CrossRef]
- Kawahara, K.; Hohjoh, H.; Inazumi, T.; Tsuchiya, S.; Sugimoto, Y. Prostaglandin E2-Induced Inflammation: Relevance of Prostaglandin E Receptors. Biochim. Biophys. Acta BBA-Mol. Cell Biol. Lipids 2015, 1851, 414–421. [Google Scholar] [CrossRef]
- Qi, S.; Xin, Y.; Guo, Y.; Diao, Y.; Kou, X.; Luo, L.; Yin, Z. Ampelopsin Reduces Endotoxic Inflammation via Repressing ROS-Mediated Activation of PI3K/Akt/NF-κB Signaling Pathways. Int. Immunopharmacol. 2012, 12, 278–287. [Google Scholar] [CrossRef]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB Signaling in Inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef]
- Jin, C.; Flavell, R.A. Molecular Mechanism of NLRP3 Inflammasome Activation. J. Clin. Immunol. 2010, 30, 628–631. [Google Scholar] [CrossRef]
- Lee, S.-C.; Hsu, J.-S.; Li, C.-C.; Chen, K.-M.; Liu, C.-T. Protective Effect of Leaf Essential Oil from Cinnamomum Osmophloeum Kanehira on Endotoxin-Induced Intestinal Injury in Mice Associated with Suppressed Local Expression of Molecules in the Signaling Pathways of TLR4 and NLRP3. PLoS ONE 2015, 10, e0120700. [Google Scholar] [CrossRef]
- Li, Q.; Feng, H.; Wang, H.; Wang, Y.; Mou, W.; Xu, G.; Zhang, P.; Li, R.; Shi, W.; Wang, Z.; et al. Licochalcone B Specifically Inhibits the NLRP3 Inflammasome by Disrupting NEK7-NLRP3 Interaction. EMBO Rep. 2022, 23, e53499. [Google Scholar] [CrossRef]
- Shi, C.; Wang, J.; Zhang, R.; Ishfaq, M.; Li, Y.; Zhang, R.; Si, C.; Li, R.; Li, C.; Liu, F. Dihydromyricetin Alleviates Escherichia Coli Lipopolysaccharide-Induced Hepatic Injury in Chickens by Inhibiting the NLRP3 Inflammasome. Vet. Res. 2022, 53, 6. [Google Scholar] [CrossRef]
- Mosser, D.M.; Hamidzadeh, K.; Goncalves, R. Macrophages and the Maintenance of Homeostasis. Cell. Mol. Immunol. 2021, 18, 579–587. [Google Scholar] [CrossRef]
- Funes, S.C.; Rios, M.; Escobar-Vera, J.; Kalergis, A.M. Implications of Macrophage Polarization in Autoimmunity. Immunology 2018, 154, 186–195. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhang, T.; Wang, X.; Wei, X.; Chen, Y.; Guo, L.; Zhang, J.; Wang, C. Curcumin Modulates Macrophage Polarization Through the Inhibition of the Toll-Like Receptor 4 Expression and Its Signaling Pathways. Cell. Physiol. Biochem. 2015, 36, 631–641. [Google Scholar] [CrossRef]
- Shabani, M.; Sadeghi, A.; Hosseini, H.; Teimouri, M.; Babaei Khorzoughi, R.; Pasalar, P.; Meshkani, R. Resveratrol Alleviates Obesity-Induced Skeletal Muscle Inflammation via Decreasing M1 Macrophage Polarization and Increasing the Regulatory T Cell Population. Sci. Rep. 2020, 10, 3791. [Google Scholar] [CrossRef]
- Mittal, M.; Siddiqui, M.R.; Tran, K.; Reddy, S.P.; Malik, A.B. Reactive Oxygen Species in Inflammation and Tissue Injury. Antioxid. Redox Signal. 2014, 20, 1126–1167. [Google Scholar] [CrossRef]
- Slika, H.; Mansour, H.; Wehbe, N.; Nasser, S.A.; Iratni, R.; Nasrallah, G.; Shaito, A.; Ghaddar, T.; Kobeissy, F.; Eid, A.H. Therapeutic Potential of Flavonoids in Cancer: ROS-Mediated Mechanisms. Biomed. Pharmacother. 2022, 146, 112442. [Google Scholar] [CrossRef]
- Xie, K.; He, X.; Chen, K.; Chen, J.; Sakao, K.; Hou, D.-X. Antioxidant Properties of a Traditional Vine Tea, Ampelopsis Grossedentata. Antioxid. Basel Switz. 2019, 8, 295. [Google Scholar] [CrossRef]
- Zhang, X.; Xu, Y.; Xue, H.; Jiang, G.; Liu, X. Antioxidant Activity of Vine Tea (Ampelopsis grossedentata) Extract on Lipid and Protein Oxidation in Cooked Mixed Pork Patties during Refrigerated Storage. Food Sci. Nutr. 2019, 7, 1735–1745. [Google Scholar] [CrossRef]
- Nguyen, T.; Sherratt, P.J.; Pickett, C.B. Regulatory Mechanisms Controlling Gene Expression Mediated by the Antioxidant Response Element. Annu. Rev. Pharmacol. Toxicol. 2003, 43, 233–260. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.; Lu, S.; Dong, X.; Xu, L.; Sun, G.; Sun, X. Dihydromyricetin Protects Human Umbilical Vein Endothelial Cells from Injury through ERK and Akt Mediated Nrf2/HO-1 Signaling Pathway. Apoptosis 2017, 22, 1013–1024. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.; Zhang, T.; Yi, L.; Zhou, X.; Mi, M. Dihydromyricetin Inhibits NLRP3 Inflammasome-Dependent Pyroptosis by Activating the Nrf2 Signaling Pathway in Vascular Endothelial Cells: Nrf2 Signaling Pathway in Vascular Endothelial Cells. BioFactors 2018, 44, 123–136. [Google Scholar] [CrossRef] [PubMed]
- Ruan, L.-P.; Yu, B.-Y.; Fu, G.-M.; Zhu, D.-N. Improving the Solubility of Ampelopsin by Solid Dispersions and Inclusion Complexes. J. Pharm. Biomed. Anal. 2005, 38, 457–464. [Google Scholar] [CrossRef]
- Cholet, J.; Decombat, C.; Vareille-Delarbre, M.; Gainche, M.; Berry, A.; Senejoux, F.; Ripoche, I.; Delort, L.; Vermerie, M.; Fraisse, D.; et al. In Vitro Anti-Inflammatory and Immunomodulatory Activities of an Extract from the Roots of Bupleurum Rotundifolium. Medicines 2019, 6, 101. [Google Scholar] [CrossRef]
Gene | Species | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
---|---|---|---|
GAPDH | Human | CACATGGCCTCCAAGGAGTAA | TGAGGGTCTCTCTCTTCCTCTTGT |
IL-8 | Human | CTGGCCGTGGCTCTCTTG | CCTTGGCAAAACTGCACCTT |
IL-1β | Human | CCTGTCCTGCGTGTTGAAAGA | GGGAACTGGGCAGACTCAAA |
IL-6 | Human | GCTGCAGGCACAGAACCA | ACTCCTTAAAGCTGCGCAGAA |
TNF-α | Human | TCTTCTCGAACCCCGAGTGA | GGAGCTGCCCCTCAGCTT |
CXCL10 | Human | GGAAATCGTGCGTGACATTA | AGGAAGGAAGGCTGGAAGAG |
COX-2 | Human | CCCAGGGCTCAAACATGATG | TCGCTTATGATCTGTCTTGAAAAACT |
NLRP3 | Human | CCACAAGATCGTGAGAAAACCC | CGGTCCTATGTGCTCGTCA |
Caspase1 | Human | GCCTGTTCCTGTGATGTGGAG | TGCCCACAGACATTCATACAGTTC |
HO-1 | Human | ACAGTTGCTGTAGGGCTTTA | CTCTGAAGTTTAGGCCATTG |
GPX1 | Human | GCACCCTCTCTTCGCCTTC | TCAGGCTCGATGTCAATGGTC |
Nrf2 | Human | CACATCCAGTCAGAAACCAGTGG | GGAATGTCTGCGCCAAAAGCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chervet, A.; Nehme, R.; Decombat, C.; Longechamp, L.; Habanjar, O.; Rousset, A.; Fraisse, D.; Blavignac, C.; Filaire, E.; Berthon, J.-Y.; et al. Exploring the Therapeutic Potential of Ampelopsis grossedentata Leaf Extract as an Anti-Inflammatory and Antioxidant Agent in Human Immune Cells. Int. J. Mol. Sci. 2024, 25, 416. https://doi.org/10.3390/ijms25010416
Chervet A, Nehme R, Decombat C, Longechamp L, Habanjar O, Rousset A, Fraisse D, Blavignac C, Filaire E, Berthon J-Y, et al. Exploring the Therapeutic Potential of Ampelopsis grossedentata Leaf Extract as an Anti-Inflammatory and Antioxidant Agent in Human Immune Cells. International Journal of Molecular Sciences. 2024; 25(1):416. https://doi.org/10.3390/ijms25010416
Chicago/Turabian StyleChervet, Arthur, Rawan Nehme, Caroline Decombat, Lucie Longechamp, Ola Habanjar, Amandine Rousset, Didier Fraisse, Christelle Blavignac, Edith Filaire, Jean-Yves Berthon, and et al. 2024. "Exploring the Therapeutic Potential of Ampelopsis grossedentata Leaf Extract as an Anti-Inflammatory and Antioxidant Agent in Human Immune Cells" International Journal of Molecular Sciences 25, no. 1: 416. https://doi.org/10.3390/ijms25010416
APA StyleChervet, A., Nehme, R., Decombat, C., Longechamp, L., Habanjar, O., Rousset, A., Fraisse, D., Blavignac, C., Filaire, E., Berthon, J.-Y., Delort, L., & Caldefie-Chezet, F. (2024). Exploring the Therapeutic Potential of Ampelopsis grossedentata Leaf Extract as an Anti-Inflammatory and Antioxidant Agent in Human Immune Cells. International Journal of Molecular Sciences, 25(1), 416. https://doi.org/10.3390/ijms25010416