Next Article in Journal
Genome of Russian Snow-White Chicken Reveals Genetic Features Associated with Adaptations to Cold and Diseases
Previous Article in Journal
Variants rs3804099 and rs3804100 in the TLR2 Gene Induce Different Profiles of TLR-2 Expression and Cytokines in Response to Spike of SARS-CoV-2
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 25
Issue 20
10.3390/ijms252011064
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Efficacy and Potential Mechanisms of Naringin in Atopic Dermatitis

by
Seung-Ah Yoo
1,
Ki-Chan Kim
2 and
Ji-Hyun Lee
1,2,*
1
Department of Dermatology, Seoul St. Mary’s Hospital, College of Medicine, The Catholic University of Korea, Seoul 06591, Republic of Korea
2
Department of Medical Sciences, Graduate School of The Catholic University of Korea, Seoul 06591, Republic of Korea
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(20), 11064; https://doi.org/10.3390/ijms252011064
Submission received: 28 September 2024 / Revised: 14 October 2024 / Accepted: 14 October 2024 / Published: 15 October 2024
(This article belongs to the Special Issue Challenges and Future Trends of Inflammatory Skin Diseases Treatment, 2nd Ediion)
Browse Figures
Versions Notes

Abstract

:
Atopic dermatitis (AD) is one of the most prevalent chronic inflammatory skin diseases. Topical treatments are recommended for all patients regardless of severity, making it essential to develop an effective topical AD treatment with minimal side effects; We investigated the efficacy of topical application of naringin in AD and explored the possible mechanisms using an AD mouse model induced by 1-chloro-2,4-dinitrobenzene (DNCB). Clinical, histological, and immunological changes related to AD and Janus kinase (JAK)-signal transducer and activator of transcription (STAT) signaling proteins in the skin tissues were measured as outcomes; Naringin treatment resulted in a significant improvement in dermatitis severity score and reduced epidermal thickness and mast cell count in the skin (p < 0.05). Naringin also demonstrated the ability to inhibit DNCB-induced changes in interleukin (IL) 4, chemokine (C-C motif) ligand (CCL) 17, CCL22, IL1β, interferon-gamma (IFN-γ), and tumor necrosis factor-alpha (TNF-α) levels by quantitative real-time polymerase chain reaction (qRT-PCR) and IL13 by enzyme-linked immunosorbent assay (ELISA) (p < 0.05). Western blot results exhibited the decreased JAK1, JAK2, STAT1, STAT3, phospho-STAT3, and STAT6 expression in the naringin-treated groups (p < 0.05); The findings of this study suggest that topical naringin may effectively improve the symptoms of AD and could be used as a therapeutic agent for AD.

1. Introduction

Atopic dermatitis (AD) is a burdensome chronic skin disease, with a worldwide prevalence of up to 20% in the pediatric population and 10% in adults [1,2,3]. The pathogenesis of AD is marked by immune dysregulation, primarily driven by T helper (Th) 2 cytokines such as interleukin (IL) 4, IL5, IL13, leading to inflammatory responses. Acute AD is Th2-dominant, whereas chronic AD shifts to a mixed Th1/Th2 response, with Th1 cytokines like interferon-gamma (IFN-γ) sustaining inflammation [4]. These processes contribute to persistent and severe pruritus and sleep disturbances, imposing a significant disease burden on affected individuals [5]. Current treatment guidelines for AD recommend the use of topical corticosteroids (TCS) and topical calcineurin inhibitors (TCI) for all patients, regardless of severity [6,7]. Both effectively reduce inflammation and pruritus but are limited by adverse effects. TCS cause skin atrophy and pose systemic absorption risks, while TCI often lead to burning and discomfort in nearly 50% of patients [8,9]. Despite these limitations, few alternatives have been developed. Given the high prevalence and disease burden of AD, the need for safe, effective, and affordable topical treatments remains critical.
The historical use of plants and plant-derived substances to reduce inflammation and treat diseases is well documented [10,11,12]. Citrus unshiu, cultivated in various regions such as Argentina, Australia, China, Japan, Spain, South Korea, and South Africa, has a long history of medicinal use. A steady stream of research has focused on the therapeutic effects of flavonoids derived from Citrus unshiu peel and fruits, particularly naringin [13,14,15].
Naringin, a flavanone glycoside with a molecular formula of C27H32O14 and a specific molecular weight of 272.257 g/mol (Figure 1), has demonstrated potent anti-inflammatory and anti-allergic properties through the modulation of various inflammatory pathways and cytokine production [16,17,18,19]. In addition, naringin exhibits dose-dependent anti-oxidative properties, reducing DNA damage and enhancing antioxidant enzyme activities [20,21].
In this study, we investigated the efficacy and potential mechanisms of topically applied naringin in a mouse model of AD, to address the unmet need for the development of topical treatments for AD.

2. Results

To evaluate the efficacy of naringin in AD, we established an AD mouse model using NC/Nga mice. Sensitization was performed with 1% 1-chloro-2,4-dinitrobenzene (DNCB), followed by the application of 0.4% DNCB three times a week throughout the challenge period to induce AD symptoms, except for the normal control (NC) group (Figure 2).

2.1. Naringin Exhibits Clinical Efficacy in Atopic Dermatitis Mouse Model

Topical application of naringin significantly improved AD-like clinical symptoms (Figure 3A). Mice in the DNCB group exhibited significantly higher dermatitis severity scores, including erythema/hemorrhage, scaling/dryness, excoriation, and edema, compared to the NC group, confirming the successful induction of AD (Figure 3B, p < 0.01). In contrast, naringin treatment significantly reduced these severity scores (Figure 3B, p < 0.05). Ear thickness, an indicator of edema, was also significantly lower in the 200 mM naringin group compared to the DNCB-only group (Figure 3B, p < 0.01).

2.2. Naringin Exhibits Histopathological Efficacy in Atopic Dermatitis Mouse Model

Histopathological analysis further confirmed the efficacy of naringin in suppressing AD-related skin changes (Figure 4). Hematoxylin and eosin (H&E) staining of dorsal skin tissues revealed significantly greater hyperkeratosis and epithelial hyperplasia in the DNCB-only group compared to the NC group, with naringin treatment resulting in a significant reduction in epidermal thickness (Figure 4, p < 0.001). Similarly, quantification of mast cells through toluidine blue staining showed a significantly higher number of mast cells in the DNCB-only group, while naringin treatment led to a significant decrease in mast cells (Figure 4, p < 0.001).

2.3. Naringin Modulates AD-Related Cytokine Changes at the mRNA Level

Molecular analysis of dorsal skin tissues revealed that naringin modulated AD-related cytokine changes are consistent with the clinical and histopathological findings (Figure 5). Quantitative reverse transcription polymerase chain reaction (qRT-PCR) revealed significant decreases in Th2- and Th1-related cytokines, including IL4, thymus and activation-regulated chemokine (TARC)/chemokine C-C motif ligand (CCL) 17, macro-phage-derived chemokine (MDC)/CCL22, IL1β, interferon-gamma (IFN-γ), and tumor necrosis factor-alpha (TNF-α) with naringin treatment (p < 0.05). Naringin treatment also led to reductions in IL31 and thymic stromal lymphopoietin (TSLP) compared to the DNCB-only group. Enzyme-Linked Immunosorbent Assay (ELISA) results further confirmed a significant dose-dependent reduction in IL13 levels in naringin-treated groups (p < 0.001).

2.4. Naringin Alleviates Atopic Dermatitis by Inhibiting the JAK-STAT Pathway

Western blot analysis demonstrated that naringin modulates the expression of proteins involved in the Janus kinase (JAK)-signal transducer and activator of transcription (STAT) pathway in the AD mouse model (Figure 6). The DNCB-only group showed significantly increased expression of JAK1, JAK2, STAT1, STAT3, phospho-STAT3 (p-STAT3), and STAT6 compared to the NC group (Figure 6, p < 0.001). Naringin treatment resulted in a statistically significant downregulation of JAK1, JAK2, STAT1, STAT3, p-STAT3, and STAT6 in a dose-dependent manner (Figure 6, p < 0.05).

3. Discussion

This study investigated the efficacy of topical naringin using an AD mouse model induced by DNCB. The DNCB-only group exhibited significantly increased dermatitis scores, ear and epidermal thickness, and mast cell count (Figure 3 and Figure 4), with elevated mRNA levels of pro-inflammatory cytokines, including TNF-α and IL1β, as well as Th1-related cytokines like IFN-γ and Th2-related cytokines such as IL4, IL13, IL31, TSLP, TARC/CCL17, and MDC/CCL22 (Figure 5). DNCB acts as an allergen-associated hapten that activates local skin dendritic cells, triggering Th cell responses and leading to inflammatory responses that mimic key features of human AD [22,23]. The observed findings in the DNCB-only group confirm that the mouse model in this study effectively replicates the clinical, histological, and immunological features of AD.
In this study, topical naringin significantly reduced dermatitis severity and skin thickness, representing alleviated skin inflammation—edema, vascular permeability, inflammatory cell infiltration, and epidermal hyperplasia (Figure 3). During inflammatory responses in the skin, the activation of nuclear factor kappa B (NF-κB) signaling is crucial both at the initiation and throughout the progression of inflammation, inducing pro-inflammatory cytokines such as TNF-α, IL1, and IL6, adhesion molecules, chemokines, and enzymes such as cyclooxygenase (COX)-2 [24,25,26]. COX enzymes catalyze the conversion of arachidonic acid to prostaglandins, and COX-2 is recognized for its role in various inflammatory diseases, including skin inflammation, allergic asthma, and rheumatoid arthritis. [27,28] COX-2 is produced in response to inflammatory signals, physiological stimuli, and growth factors and plays a key role in the generation of prostaglandins, which contribute to pain and promote inflammation [29]. Previous studies reporting on naringin’s protective and regenerative effects on skin have noted its anti-inflammatory properties through the reduction in NF-κB and COX-2 expression [30,31]. CX3C motif chemokine receptor (CX3CR) 1 macrophages are important in the inflammatory response and release TNF and TGFβ1. These factors stimulate hair follicle stem cells (HFSCs), leading to wound-induced hair follicle neogenesis and hair follicle regeneration [32,33,34,35]. On the other hand, Langerhans cells, suprabasal HFSCs, sebaceous gland filling and the surrounding microbiome are also involved in the wound response, the process of which may interact with our findings [36,37,38]. Besides, naringin demonstrated significant antioxidant properties by increasing glutathione levels and superoxide dismutase activity, thereby inhibiting reactive oxygen species (ROS). Moreover, naringin has been shown to reduce DNA damage, oxidative stress, and various inflammatory markers, including TNF-α, total leukocytes, neutrophils, tissue edema, and inflammatory cell infiltration [20,21].
Our results revealed that topical naringin significantly reduced the number of mast cells in AD skin lesions (Figure 4). Mast cells play a crucial role in inflammatory responses by releasing potent signaling molecules like histamine, which intensifies inflammation and contributes to symptoms such as erythema, swelling, and pruritus [39]. Histamine is a major driver of the severe itching commonly experienced by AD patients. Additionally, mast cells release IL4 and IL13, amplifying the Th2 immune response, a hallmark of the immunological profile of AD. Previous studies have shown that naringin inhibits histamine release from mast cells in vitro, as well as histamine, inflammatory cytokines, and immunoglobulin (Ig) E in vivo [40,41]. Furthermore, the oral administration of naringin in an oxazolone-induced AD mouse model dose-dependently suppressed both type 1 and type 4 skin allergic reactions [42]. Our findings suggest that naringin alleviates AD symptoms by modulating mast cell infiltration and reducing the release of inflammatory mediators, contributing to its therapeutic effects beyond mere histamine inhibition.
In this study, the DNCB-only group exhibited a significant increase in the expression of IL4, IL13, IL31, TSLP, TARC/CCL17, MDC/CCL22, IFN-γ, IL1β, and TNF-α, all of which are consistently expressed with AD. Naringin treatment significantly reduced characteristic cytokines of AD including IL4, IL13, TARC/CCL17, MDC/CCL22, IFN-γ, IL1β, and TNF-α (Figure 5). IL4 and IL13 are key biomarkers in AD pathogenesis, driving the Th2 immune responses. IL31, which is correlated with the IL4 and IL13 expressions, is another Th2 cytokine. They contribute to hallmark features such as pruritus and barrier dysfunction [43,44,45,46,47,48]. IFN-γ and TNF-α, primarily secreted by Th1 cells, are more prominent in the chronic phase of AD and exacerbate inflammation [49,50]. IFN-γ, in conjunction with Th2 cytokines, promotes macrophage activation, increases TSLP secretion, and alters stratum corneum lipid composition, contributing to the chronicity of AD [51]. Furthermore, IFN-γ has been shown to downregulate mRNA levels of key enzymes involved in ceramide synthesis in three-dimensional epidermal models, while TNF-α, either alone or in combination with Th2 cytokines, decreased levels of long-chain free fatty acids and ceramides, both of which compromise the skin barrier [51,52,53]. Naringin’s ability to reduce these cytokines suggests it may not only alleviate inflammation but also help restore the skin barrier, offering a dual benefit in treating AD.
TARC/CCL17 and MDC/CCL22 are chemokines that recruit immune cells to inflamed tissues and have emerged as biomarkers for AD, with a correlation to clinical severity [54,55,56,57,58,59]. These established biomarkers are often used as reliable tools to predict clinical prognosis and therapeutic outcomes, enabling more personalized and effective treatment strategies for patients. TARC/CCL17, a Th2 chemoattractant, has been recognized as a prognostic biomarker for AD [60,61,62,63]. In Japan, TARC/CCL17 has been measured under health insurance coverage for monitoring treatment effectiveness since 2008 [61]. Activation of the IL22/IL22Rα pathway in AD induces TARC/CCL17, IL1α, and IL6, recruiting CCR4+ T cells. In severe AD, regulatory T cells (Tregs) with high CCR4 expression are recruited but show reduced ability to secrete TGF-β and IL10, indicating impaired Treg function in AD [64]. On the other hand, lesional MDC/CCL22 level has been found as a promising predictive biomarker for AD [59,65,66]. MDC/CCL22 has been used across multiple studies validating treatment responses of topical crisaborole, oral cyclosporine, and a targeted treatment, fezakinumab [6,54,67]. Naringin’s ability to reduce the expression of these key biomarkers suggests that naringin can be utilized for the treatment of AD.
The JAK-STAT signaling pathway significantly regulates Th2 differentiation in AD, with elevated levels of STAT proteins associated with disease severity [48,68]. Naringin was found to reduce the expression of STAT1, STAT2, STAT3, phosphorylated STAT3 (P-STAT3), STAT6, JAK1, and JAK2, which are key components of this pathway (Figure 6). This suggests that naringin may alleviate AD by modulating the JAK-STAT signaling pathway. JAK1 and JAK2 are mediated by IL31 to activate IL31RA, leading to STAT3-mediated β-endorphin production, potentially contributing to peripheral itching in AD [69]. IL-4 engages two types of receptors. It binds to type 1 receptors (IL-4Rα and γ chains), which activates JAK1 and JAK3, leading to STAT6 activation. Conversely, IL-4 and IL-13 interact with type 2 receptors (IL-4Rα and IL-13Rα1), activating JAK1 and TYK2, which subsequently activate STAT6 and STAT3 [70,71]. STAT1, STAT2, and STAT3 play a role in mediating pro-inflammatory signals. At the same time, STAT6 is essential for Th2 signaling [72,73]. Additionally, the signaling pathways of TSLP and IL31 also involve JAK1 and JAK2, impacting STAT1, STAT3, and STAT5 [74,75]. Inhibiting these pathways has been shown to reduce inflammation and improve clinical outcomes in AD [76,77,78]. This extends to topical applications as well, with ruxolitinib cream, a selective JAK1/JAK2 inhibitor, receiving the Food and Drug Administration (FDA) approval for the treatment of AD, and momelotinib, another JAK1/JAK2 inhibitor, demonstrating significant anti-inflammatory effects through topical application [79,80]. Naringin’s ability to reduce the expression of JAK1, JAK2, and various STAT proteins suggests that it interferes with the signaling cascades that drive inflammation in AD, reducing inflammation and improving skin condition.
While this study highlights the efficacy of naringin in modulating inflammatory responses in the skin lesions of AD, further analysis of Th2 cells and type 2 innate lymphoid cells (ILC2s) as key drivers of the pathology is needed. In addition, we used only male mice in our experiments to prevent hormonal fluctuations from influencing inflammatory and immune responses, which may limit the generalizability of our findings. Further investigation is warranted to validate whether naringin alters the phenotype of immune cells, thereby clarifying its mechanism of action, as well as to examine potential differences in efficacy across different sexes.

4. Materials and Methods

4.1. Animal Study

Specific pathogen-free male NC/Nga mice, 4 weeks old and weighing between 16–21 g, were obtained from Central Laboratory Animals Inc. (Seoul, Republic of Korea). The mice were quarantined for one week and acclimated for another one week; the mice were 6 weeks old at the beginning of the experiment. A total of 30 mice were used, with 6 mice assigned to each group. The animals were housed in a temperature-controlled environment (23 ± 3 °C) with 50 ± 10% relative humidity on a 12-h light/dark cycle. Water and commercial rodent chow were provided ad libitum.

4.2. Atopic Dermatitis Mouse Model and Drug Challenge

The mice were divided into five groups as follows: normal control (NC; n = 6), DNCB-only (DNCB, Sigma-Aldrich, St Louis, MO, USA; n = 6), Tacrolimus (DNCB + 0.03% tacrolimus ointment, Protopic®, LEO Pharma, Ballerup, Denmark; n = 6), and 50 mM/200 mM naringin (DNCB + naringin, Sigma-Aldrich, St Louis, MO, USA; n = 6 per group). Figure 2 schematically represents the experimental schedule. The DNCB solution was prepared at a concentration of 1% and 0.4% in the vehicle, which consisted of a glycerol/ethanol suspension (1:4). For sensitization, 1% DNCB was applied to the abdomen of mice twice a week, except the NC group. After the sensitization, the dorsal hair of mice was shaved using animal clippers and hair removal cream followed by 48 h of stabilization. During the 16-day challenge period, 0.4% DNCB was applied to the mice, except for the NC group, thrice a week. The mice in each group were applied with 0.03% tacrolimus ointment, 50 mM naringin, or 200 mM naringin thrice a week as well. Topical tacrolimus, one of the topical treatments recommended by AD treatment guidelines, was used as a standard of care control. The concentrations of naringin were selected based on our preliminary in vivo experiments with 10 mM, 50 mM, and 100 mM topical naringin, the concentrations of which were based on previous studies [30,31]. The volume of DNCB, vehicle solution, and naringin applied to each group was 50 μL for the back and 20 μL for each ear. On day 16, dorsal and both ear skin tissues were collected 4 h after the last application. All animal research procedures were conducted in compliance with the Laboratory Animals Welfare Act, the Guide for the Care and Use of Laboratory Animals, and the Guidelines and Policies for Rodent Experiments established by the Institutional Animal Care and Use Committee of the School of Medicine, The Catholic University of Korea (CUMS-2023-0145-01).

4.3. Dermatitis Severity and Ear Thickness Assessment

Ear thickness was assessed twice weekly using a digital caliper (Kroeplin, Schlüchtern, Germany). Dermatitis severity was scored by two blinded investigators, based on clinical photographs taken twice weekly, and the average was calculated; each mouse was scored on a scale of 0–3 for erythema/hemorrhage, scaling/dryness, excoriation, and edema. The final score was defined as the sum of these individual scores (maximum score, 12).

4.4. Histological Assessment

Dorsal skin tissues were fixed in 10% neutral buffered formalin for histological analysis and were then paraffin-embedded. The tissues were sectioned at 4 μm thickness and stained with H&E to analyze histological changes. Epidermal thickness was measured in three randomly selected areas, with five points randomly selected in each area on the slides strained with H&E using a microscope (Leica, Hessen, Germany). Mast cell count in dorsal skin tissues was evaluated by toluidine blue staining, and the number of mast cells was counted in three randomly selected areas. All measurements were performed using ImageJ Fiji software (Version 1.54 g; WS Rasband, National Institute of Health, Bethesda, MD, USA).

4.5. Quantitative Real-Time PCR

Total RNA was isolated from each sample using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s guidelines. RNA concentration and purity (260:280 ratio) were determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). For qRT-PCR, the synthesized primers were diluted and mixed with Power SYBR® Green PCR Master Mix (Takara Biomedical Inc., Shiga, Japan). The primer sequences used in this study are provided in Table 1. Quantitative real-time PCR (qRT-PCR) was performed on a CFX-96 thermocycler (Bio-Rad, Hercules, CA, USA), with an initial denaturation at 95 °C for 10 min, followed by 45 cycles of 95 °C for 15 s and 60 °C for 30 s. Gene expression levels were calculated using the cycle threshold (Ct) values and the ΔCt method. Each qRT-PCR reaction was performed in triplicate. Data were normalized to the housekeeping gene β-actin and presented as a ratio relative to the untreated control.

4.6. ELISA Assay

The levels of IL13 in the dorsal skin tissues of the models were quantified using ELISA kits (Labiskoma, Seoul, Republic of Korea) as per the manufacturer’s guidelines. Data were obtained using a microplate reader (VersaMax, Molecular devices, Silicon Valley, CA, USA).

4.7. Western Blot

Protein lysates were extracted using T-PER lysis buffer (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with a protease inhibitor cocktail (Thermo Fisher Scientific, Waltham, MA, USA). Protein concentrations were measured using a BCA Protein Assay Kit II (Thermo Fisher Scientific, Waltham, MA, USA). Equal amounts of protein (20 or 40 μg) were loaded onto 6–15% SDS-PAGE gels, separated, and transferred onto polyvinylidene fluoride membranes (MilliporeSigma, St. Louis, MO, USA). After blocking with either 5% skim milk or 5% BSA in TBS-T (Tris-buffered saline with 0.1% Tween 20), membranes were incubated overnight at 4 °C with primary antibodies diluted in 5% BSA/TBS-T. The following primary antibodies were used: mouse monoclonal anti-β-actin (1:2500, #3700), JAK1 (1:400, #3344), JAK2 (1:1000, #3230), STAT1 (1:1000, #14994), STAT3 (1:1000, #9139), anti-P-STAT3 (1:1000, #9145), and STAT6 (1:1000 #9362S). After incubation, membranes were washed four times with TBS-T and treated with horseradish peroxidase-conjugated goat anti-mouse or rabbit IgG secondary antibodies (GTX213111-01 or GTX213110-01; GeneTex, Irvine, CA, USA) for two hours at room temperature. Following another set of four washes in TBS-T, protein bands were visualized using an ECL substrate (Thermo Fisher Scientific, Waltham, MA, USA) and captured with an Amersham™ Imager 600 (GE Healthcare, Chicago, IL, USA). The band intensities were analyzed using ImageJ software (version 1.8.0) (U.S. NIH, Bethesda, MD, USA).

4.8. Statistics Analysis

Statistical analysis was conducted using one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test. For comparisons between two groups, unpaired t-tests were employed. Graphs were generated using GraphPad Prism 5 (GraphPad Software, La Jolla, CA, USA), and all data are expressed as mean ± standard error of the mean (SEM). Statistical significance was set at p < 0.05 (* p < 0.05; ** p < 0.01; and *** p < 0.001).

5. Conclusions

Based on the results of our study, the topical application of naringin may effectively alleviate the symptoms of AD, primarily through its anti-inflammatory properties. These findings suggest that naringin could serve as a therapeutic agent for AD.

Author Contributions

Conceptualization, S.-A.Y. and J.-H.L.; methodology, S.-A.Y. and J.-H.L.; validation, S.-A.Y. and K.-C.K.; data curation and writing, S.-A.Y.; visualization, K.-C.K.; supervision and review, J.-H.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Research Fund of Seoul St. Mary’s Hospital, The Catholic University of Korea, grant number ZC23TISI0839.

Institutional Review Board Statement

All animal research procedures were conducted in compliance with the Laboratory Animals Welfare Act, the Guide for the Care and Use of Laboratory Animals, and the Guidelines and Policies for Rodent Experiments established by the Institutional Animal Care and Use Committee of the School of Medicine, The Catholic University of Korea (protocol code, CUMS-2023-0145-01, 7 June 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Davis, D.M.R.; Drucker, A.M.; Alikhan, A.; Bercovitch, L.; Cohen, D.E.; Darr, J.M.; Eichenfield, L.F.; Frazer-Green, L.; Paller, A.S.; Silverberg, J.I.; et al. American Academy of Dermatology Guidelines: Awareness of comorbidities associated with atopic dermatitis in adults. J. Am. Acad. Dermatol. 2022, 86, 1335–1336 e18. [Google Scholar] [CrossRef] [PubMed]
  2. Langan, S.M.; Irvine, A.D.; Weidinger, S. Atopic dermatitis. Lancet 2020, 396, 345–360. [Google Scholar] [CrossRef] [PubMed]
  3. Roh, Y.S.; Huang, A.H.; Sutaria, N.; Choi, U.; Wongvibulsin, S.; Choi, J.; Bordeaux, Z.A.; Parthasarathy, V.; Deng, J.; Patel, D.P.; et al. Real-world comorbidities of atopic dermatitis in the US adult ambulatory population. J. Am. Acad. Dermatol. 2022, 86, 835–845. [Google Scholar] [CrossRef]
  4. Li, H.; Zhang, Z.; Zhang, H.; Guo, Y.; Yao, Z. Update on the Pathogenesis and Therapy of Atopic Dermatitis. Clin. Rev. Allergy Immunol. 2021, 61, 324–338. [Google Scholar] [CrossRef] [PubMed]
  5. Silverberg, J.I.; Mohawk, J.A.; Cirulli, J.; Nograles, K.; Punzalan, J.C.; Kelly, K.M.; Kim, B.S.; Guttman-Yassky, E.; Lebwohl, M. Burden of Disease and Unmet Needs in Atopic Dermatitis: Results From a Patient Survey. Dermatitis 2023, 34, 135–144. [Google Scholar] [CrossRef]
  6. AAAAI/ACAAI JTF Atopic Dermatitis Guideline Panel; Chu, D.K.; Schneider, L.; Asiniwasis, R.N.; Boguniewicz, M.; De Benedetto, A.; Ellison, K.; Frazier, W.T.; Greenhawt, M.; Huynh, J.; et al. Atopic dermatitis (eczema) guidelines: 2023 American Academy of Allergy, Asthma and Immunology/American College of Allergy, Asthma and Immunology Joint Task Force on Practice Parameters GRADE- and Institute of Medicine-based recommendations. Ann. Allergy Asthma Immunol. 2024, 132, 274–312. [Google Scholar] [CrossRef]
  7. Kim, J.E.; Kim, H.J.; Lew, B.L.; Lee, K.H.; Hong, S.P.; Jang, Y.H.; Park, K.Y.; Seo, S.J.; Bae, J.M.; Choi, E.H.; et al. Consensus Guidelines for the Treatment of Atopic Dermatitis in Korea (Part II): Systemic Treatment. Ann. Dermatol. 2015, 27, 578–592. [Google Scholar] [CrossRef]
  8. Hengge, U.R.; Ruzicka, T.; Schwartz, R.A.; Cork, M.J. Adverse effects of topical glucocorticosteroids. J. Am. Acad. Dermatol. 2006, 54, 1–15, quiz 6–8. [Google Scholar] [CrossRef]
  9. Seo, S.R.; Lee, S.G.; Lee, H.J.; Yoon, M.S.; Kim, D.H. Disrupted Skin Barrier is Associated with Burning Sensation after Topical Tacrolimus Application in Atopic Dermatitis. Acta Derm. Venereol. 2017, 97, 957–958. [Google Scholar] [CrossRef]
  10. Nunes, C.D.R.; Barreto Arantes, M.; Menezes de Faria Pereira, S.; Leandro da Cruz, L.; de Souza Passos, M.; Pereira de Moraes, L.; Vieira, I.J.C.; de Oliveira, D.B. Plants as Sources of Anti-Inflammatory Agents. Molecules 2020, 25, 3726. [Google Scholar] [CrossRef]
  11. Tasneem, S.; Liu, B.; Li, B.; Choudhary, M.I.; Wang, W. Molecular pharmacology of inflammation: Medicinal plants as anti-inflammatory agents. Pharmacol. Res. 2019, 139, 126–140. [Google Scholar] [CrossRef] [PubMed]
  12. Pirintsos, S.; Panagiotopoulos, A.; Bariotakis, M.; Daskalakis, V.; Lionis, C.; Sourvinos, G.; Karakasiliotis, I.; Kampa, M.; Castanas, E. From Traditional Ethnopharmacology to Modern Natural Drug Discovery: A Methodology Discussion and Specific Examples. Molecules 2022, 27, 4060. [Google Scholar] [CrossRef] [PubMed]
  13. Park, H.; Hwang, Y.H.; Choi, J.G.; Ma, J.Y. In vitro and in vivo evaluation of systemic and genetic toxicity of Citrus unshiu peel. J. Ethnopharmacol. 2018, 215, 120–123. [Google Scholar] [CrossRef]
  14. Kim, C.; Ji, J.; Ho Baek, S.; Lee, J.H.; Ha, I.J.; Lim, S.S.; Yoon, H.J.; Je Nam, Y.; Ahn, K.S. Fermented dried Citrus unshiu peel extracts exert anti-inflammatory activities in LPS-induced RAW264.7 macrophages and improve skin moisturizing efficacy in immortalized human HaCaT keratinocytes. Pharm. Biol. 2019, 57, 392–402. [Google Scholar] [CrossRef] [PubMed]
  15. Shin, M.S.; Park, S.B.; Shin, K.S. Molecular mechanisms of immunomodulatory activity by polysaccharide isolated from the peels of Citrus unshiu. Int. J. Biol. Macromol. 2018, 112, 576–583. [Google Scholar] [CrossRef] [PubMed]
  16. Bajgai, B.; Suri, M.; Singh, H.; Hanifa, M.; Bhatti, J.S.; Randhawa, P.K.; Bali, A. Naringin: A flavanone with a multifaceted target against sepsis-associated organ injuries. Phytomedicine 2024, 130, 155707. [Google Scholar] [CrossRef]
  17. Guihua, X.; Shuyin, L.; Jinliang, G.; Wang, S. Naringin Protects Ovalbumin-Induced Airway Inflammation in a Mouse Model of Asthma. Inflammation 2016, 39, 891–899. [Google Scholar] [CrossRef]
  18. Gopinath, K.; Sudhandiran, G. Naringin modulates oxidative stress and inflammation in 3-nitropropionic acid-induced neurodegeneration through the activation of nuclear factor-erythroid 2-related factor-2 signalling pathway. Neuroscience 2012, 227, 134–143. [Google Scholar] [CrossRef]
  19. Jain, M.; Parmar, H.S. Evaluation of antioxidative and anti-inflammatory potential of hesperidin and naringin on the rat air pouch model of inflammation. Inflamm. Res. 2011, 60, 483–491. [Google Scholar] [CrossRef]
  20. Cavia-Saiz, M.; Busto, M.D.; Pilar-Izquierdo, M.C.; Ortega, N.; Perez-Mateos, M.; Muniz, P. Antioxidant properties, radical scavenging activity and biomolecule protection capacity of flavonoid naringenin and its glycoside naringin: A comparative study. J. Sci. Food Agric. 2010, 90, 1238–1244. [Google Scholar] [CrossRef]
  21. Ali, M.M.; El Kader, M.A. The influence of naringin on the oxidative state of rats with streptozotocin-induced acute hyperglycaemia. Z. Für Naturforschung C 2004, 59, 726–733. [Google Scholar] [PubMed]
  22. Pickard, C.; Smith, A.M.; Cooper, H.; Strickland, I.; Jackson, J.; Healy, E.; Friedmann, P.S. Investigation of mechanisms underlying the T-cell response to the hapten 2,4-dinitrochlorobenzene. J. Investig. Dermatol. 2007, 127, 630–637. [Google Scholar] [CrossRef] [PubMed]
  23. Riedl, R.; Kuhn, A.; Rietz, D.; Hebecker, B.; Glowalla, K.G.; Peltner, L.K.; Jordan, P.M.; Werz, O.; Lorkowski, S.; Wiegand, C.; et al. Establishment and Characterization of Mild Atopic Dermatitis in the DNCB-Induced Mouse Model. Int. J. Mol. Sci. 2023, 24, 12325. [Google Scholar] [CrossRef]
  24. Barnabei, L.; Laplantine, E.; Mbongo, W.; Rieux-Laucat, F.; Weil, R. NF-kappaB: At the Borders of Autoimmunity and Inflammation. Front. Immunol. 2021, 12, 716469. [Google Scholar] [CrossRef]
  25. Vu, A.T.; Chen, X.; Xie, Y.; Kamijo, S.; Ushio, H.; Kawasaki, J.; Hara, M.; Ikeda, S.; Okumura, K.; Ogawa, H.; et al. Extracellular double-stranded RNA induces TSLP via an endosomal acidification- and NF-kappaB-dependent pathway in human keratinocytes. J. Investig. Dermatol. 2011, 131, 2205–2212. [Google Scholar] [CrossRef] [PubMed]
  26. Hoesel, B.; Schmid, J.A. The complexity of NF-kappaB signaling in inflammation and cancer. Mol. Cancer 2013, 12, 86. [Google Scholar] [CrossRef] [PubMed]
  27. Kim, H.J.; Kim, T.Y. IGF-II-mediated COX-2 gene expression in human keratinocytes through extracellular signal-regulated kinase pathway. J. Investig. Dermatol. 2004, 123, 547–555. [Google Scholar] [CrossRef]
  28. Lee, J.L.; Mukhtar, H.; Bickers, D.R.; Kopelovich, L.; Athar, M. Cyclooxygenases in the skin: Pharmacological and toxicological implications. Toxicol. Appl. Pharmacol. 2003, 192, 294–306. [Google Scholar] [CrossRef]
  29. Simon, L.S. Role and regulation of cyclooxygenase-2 during inflammation. Am. J. Med. 1999, 106, 37S–42S. [Google Scholar] [CrossRef]
  30. Ren, X.; Shi, Y.; Zhao, D.; Xu, M.; Li, X.; Dang, Y.; Ye, X. Naringin protects ultraviolet B-induced skin damage by regulating p38 MAPK signal pathway. J. Dermatol. Sci. 2016, 82, 106–114. [Google Scholar] [CrossRef]
  31. Vabeiryureilai, M.; Lalrinzuali, K.; Jagetia, G.C. NF-kappaB and COX-2 repression with topical application of hesperidin and naringin hydrogels augments repair and regeneration of deep dermal wounds. Burns 2022, 48, 132–145. [Google Scholar] [CrossRef]
  32. Wang, X.; Chen, H.; Tian, R.; Zhang, Y.; Drutskaya, M.S.; Wang, C.; Ge, J.; Fan, Z.; Kong, D.; Wang, X.; et al. Macrophages induce AKT/beta-catenin-dependent Lgr5(+) stem cell activation hair follicle regeneration through TNF. Nat. Commun. 2017, 8, 14091. [Google Scholar] [CrossRef] [PubMed]
  33. Rahmani, W.; Liu, Y.; Rosin, N.L.; Kline, A.; Raharjo, E.; Yoon, J.; Stratton, J.A.; Sinha, S.; Biernaskie, J. Macrophages Promote Wound-Induced Hair Follicle Regeneration in a CX(3)CR1- and TGF-beta1-Dependent Manner. J. Investig. Dermatol. 2018, 138, 2111–2122. [Google Scholar] [CrossRef] [PubMed]
  34. Chen, H.; Wang, X.; Han, J.; Fan, Z.; Sadia, S.; Zhang, R.; Guo, Y.; Jiang, Y.; Wu, Y. AKT and its related molecular feature in aged mice skin. PLoS ONE 2017, 12, e0178969. [Google Scholar] [CrossRef] [PubMed]
  35. Chen, H.; Wang, X.; Chen, Y.; Han, J.; Kong, D.; Zhu, M.; Fu, X.; Wu, Y. Pten loss in Lgr5(+) hair follicle stem cells promotes SCC development. Theranostics 2019, 9, 8321–8331. [Google Scholar] [CrossRef] [PubMed]
  36. Moresi, J.M.; Horn, T.D. Distribution of Langerhans cells in human hair follicle. J. Cutan. Pathol. 1997, 24, 636–640. [Google Scholar] [CrossRef] [PubMed]
  37. Jaworsky, C.; Kligman, A.M.; Murphy, G.F. Characterization of inflammatory infiltrates in male pattern alopecia: Implications for pathogenesis. Br. J. Dermatol. 1992, 127, 239–246. [Google Scholar] [CrossRef] [PubMed]
  38. Han, J.; Lin, K.; Choo, H.; Chen, Y.; Zhang, X.; Xu, R.H.; Wang, X.; Wu, Y. Distinct bulge stem cell populations maintain the pilosebaceous unit in a beta-catenin-dependent manner. iScience 2023, 26, 105805. [Google Scholar] [CrossRef]
  39. Lee, Y.; Choi, H.K.; N’Deh, K.P.U.; Choi, Y.J.; Fan, M.; Kim, E.K.; Chung, K.-H.; An, J.H. Inhibitory Effect of Centella asiatica Extract on DNCB-Induced Atopic Dermatitis in HaCaT Cells and BALB/c Mice. Nutrients 2020, 12, 411. [Google Scholar] [CrossRef]
  40. Oh, H.A.; Kim, M.J.; Shin, T.Y.; Kim, H.M.; Jeong, H.J. The antiallergic mechanisms of Citrus sunki and bamboo salt (K-ALL) in an allergic rhinitis model. Exp. Biol. Med. 2014, 239, 83–93. [Google Scholar] [CrossRef]
  41. Graziano, A.C.; Cardile, V.; Crasci, L.; Caggia, S.; Dugo, P.; Bonina, F.; Panico, A. Protective effects of an extract from Citrus bergamia against inflammatory injury in interferon-gamma and histamine exposed human keratinocytes. Life Sci. 2012, 90, 968–974. [Google Scholar] [CrossRef] [PubMed]
  42. Itoh, K.; Masuda, M.; Naruto, S.; Murata, K.; Matsuda, H. Antiallergic activity of unripe Citrus hassaku fruits extract and its flavanone glycosides on chemical substance-induced dermatitis in mice. J. Nat. Med. 2009, 63, 443–450. [Google Scholar] [CrossRef] [PubMed]
  43. Pavel, A.B.; Zhou, L.; Diaz, A.; Ungar, B.; Dan, J.; He, H.; Estrada, Y.D.; Xu, H.; Fernandes, M.; Renert-Yuval, Y.; et al. The proteomic skin profile of moderate-to-severe atopic dermatitis patients shows an inflammatory signature. J. Am. Acad. Dermatol. 2020, 82, 690–699. [Google Scholar] [CrossRef] [PubMed]
  44. Dubin, C.; Del Duca, E.; Guttman-Yassky, E. The IL-4, IL-13 and IL-31 pathways in atopic dermatitis. Expert Rev. Clin. Immunol. 2021, 17, 835–852. [Google Scholar] [CrossRef] [PubMed]
  45. Zhou, J.; Gemperline, D.C.; Turner, M.J.; Oldach, J.; Molignano, J.; Sims, J.T.; Stayrook, K.R. Transcriptomic Analysis of Healthy and Atopic Dermatitis Samples Reveals the Role of IL-37 in Human Skin. Immunohorizons 2021, 5, 830–843. [Google Scholar] [CrossRef]
  46. Tominaga, M.; Takamori, K. Peripheral itch sensitization in atopic dermatitis. Allergol. Int. 2022, 71, 265–277. [Google Scholar] [CrossRef]
  47. Upadhyay, P.R.; Seminario-Vidal, L.; Abe, B.; Ghobadi, C.; Sims, J.T. Cytokines and Epidermal Lipid Abnormalities in Atopic Dermatitis: A Systematic Review. Cells 2023, 12, 2793. [Google Scholar] [CrossRef]
  48. Huang, I.H.; Chung, W.H.; Wu, P.C.; Chen, C.B. JAK-STAT signaling pathway in the pathogenesis of atopic dermatitis: An updated review. Front. Immunol. 2022, 13, 1068260. [Google Scholar] [CrossRef]
  49. Tuzlak, S.; Dejean, A.S.; Iannacone, M.; Quintana, F.J.; Waisman, A.; Ginhoux, F.; Korn, T.; Becher, B. Repositioning T(H) cell polarization from single cytokines to complex help. Nat. Immunol. 2021, 22, 1210–1217. [Google Scholar] [CrossRef]
  50. Weidinger, S.; Beck, L.A.; Bieber, T.; Kabashima, K.; Irvine, A.D. Atopic dermatitis. Nat. Rev. Dis. Primers 2018, 4, 1. [Google Scholar] [CrossRef]
  51. Danso, M.O.; van Drongelen, V.; Mulder, A.; van Esch, J.; Scott, H.; van Smeden, J.; El Ghalbzouri, A.; Bouwstra, J.A. TNF-alpha and Th2 cytokines induce atopic dermatitis-like features on epidermal differentiation proteins and stratum corneum lipids in human skin equivalents. J. Investig. Dermatol. 2014, 134, 1941–1950. [Google Scholar] [CrossRef] [PubMed]
  52. Kanoh, H.; Ishitsuka, A.; Fujine, E.; Matsuhaba, S.; Nakamura, M.; Ito, H.; Inagaki, N.; Banno, Y.; Seishima, M. IFN-gamma Reduces Epidermal Barrier Function by Affecting Fatty Acid Composition of Ceramide in a Mouse Atopic Dermatitis Model. J. Immunol. Res. 2019, 2019, 3030268. [Google Scholar] [CrossRef] [PubMed]
  53. Tawada, C.; Kanoh, H.; Nakamura, M.; Mizutani, Y.; Fujisawa, T.; Banno, Y.; Seishima, M. Interferon-gamma decreases ceramides with long-chain fatty acids: Possible involvement in atopic dermatitis and psoriasis. J. Investig. Dermatol. 2014, 134, 712–718. [Google Scholar] [CrossRef] [PubMed]
  54. Bakker, D.; de Bruin-Weller, M.; Drylewicz, J.; van Wijk, F.; Thijs, J. Biomarkers in atopic dermatitis. J. Allergy Clin. Immunol. 2023, 151, 1163–1168. [Google Scholar] [CrossRef]
  55. Nakazato, J.; Kishida, M.; Kuroiwa, R.; Fujiwara, J.; Shimoda, M.; Shinomiya, N. Serum levels of Th2 chemokines, CCL17, CCL22, and CCL27, were the important markers of severity in infantile atopic dermatitis. Pediatr. Allergy Immunol. 2008, 19, 605–613. [Google Scholar] [CrossRef]
  56. Kakinuma, T.; Nakamura, K.; Wakugawa, M.; Mitsui, H.; Tada, Y.; Saeki, H.; Torii, H.; Asahina, A.; Onai, N.; Matsushima, K.; et al. Thymus and activation-regulated chemokine in atopic dermatitis: Serum thymus and activation-regulated chemokine level is closely related with disease activity. J. Allergy Clin. Immunol. 2001, 107, 535–541. [Google Scholar] [CrossRef]
  57. Fujisawa, T.; Fujisawa, R.; Kato, Y.; Nakayama, T.; Morita, A.; Katsumata, H.; Nishimori, H.; Iguchi, K.; Kamiya, H.; Gray, P.W.; et al. Presence of high contents of thymus and activation-regulated chemokine in platelets and elevated plasma levels of thymus and activation-regulated chemokine and macrophage-derived chemokine in patients with atopic dermatitis. J. Allergy Clin. Immunol. 2002, 110, 139–146. [Google Scholar] [CrossRef]
  58. Kataoka, Y. Thymus and activation-regulated chemokine as a clinical biomarker in atopic dermatitis. J. Dermatol. 2014, 41, 221–229. [Google Scholar] [CrossRef]
  59. Angelova-Fischer, I.; Hipler, U.C.; Bauer, A.; Fluhr, J.W.; Tsankov, N.; Fischer, T.W.; Elsner, P. Significance of interleukin-16, macrophage-derived chemokine, eosinophil cationic protein and soluble E-selectin in reflecting disease activity of atopic dermatitis--from laboratory parameters to clinical scores. Br. J. Dermatol. 2006, 154, 1112–1117. [Google Scholar] [CrossRef]
  60. Rinnov, M.R.; Halling, A.S.; Gerner, T.; Ravn, N.H.; Knudgaard, M.H.; Trautner, S.; Goorden, S.M.I.; der Vlugt, K.J.M.G.; Stet, F.S.; Skov, L.; et al. Skin biomarkers predict development of atopic dermatitis in infancy. Allergy 2023, 78, 791–802. [Google Scholar] [CrossRef]
  61. Renert-Yuval, Y.; Thyssen, J.P.; Bissonnette, R.; Bieber, T.; Kabashima, K.; Hijnen, D.; Guttman-Yassky, E. Biomarkers in atopic dermatitis-a review on behalf of the International Eczema Council. J. Allergy Clin. Immunol. 2021, 147, 1174–1190 e1. [Google Scholar] [CrossRef] [PubMed]
  62. Halling, A.S.; Rinnov, M.R.; Ruge, I.F.; Gerner, T.; Ravn, N.H.; Knudgaard, M.H.; Trautner, S.; Loft, N.; Skov, L.; Thomsen, S.F.; et al. Skin TARC/CCL17 increase precedes the development of childhood atopic dermatitis. J. Allergy Clin. Immunol. 2023, 151, 1550–1557 e6. [Google Scholar] [CrossRef] [PubMed]
  63. Yasukochi, Y.; Nakahara, T.; Abe, T.; Kido-Nakahara, M.; Kohda, F.; Takeuchi, S.; Hagihara, A.; Furue, M. Reduction of serum TARC levels in atopic dermatitis by topical anti-inflammatory treatments. Asian Pac. J. Allergy Immunol. 2014, 32, 240–245. [Google Scholar] [PubMed]
  64. Catherine, J.; Roufosse, F. What does elevated TARC/CCL17 expression tell us about eosinophilic disorders? Semin. Immunopathol. 2021, 43, 439–458. [Google Scholar] [CrossRef] [PubMed]
  65. Leung, T.F.; Ma, K.C.; Hon, K.L.; Lam, C.W.; Wan, H.; Li, C.Y.; Chan, I.H. Serum concentration of macrophage-derived chemokine may be a useful inflammatory marker for assessing severity of atopic dermatitis in infants and young children. Pediatr. Allergy Immunol. 2003, 14, 296–301. [Google Scholar] [CrossRef]
  66. Kakinuma, T.; Nakamura, K.; Wakugawa, M.; Mitsui, H.; Tada, Y.; Saeki, H.; Torii, H.; Komine, M.; Asahina, A.; Tamaki, K. Serum macrophage-derived chemokine (MDC) levels are closely related with the disease activity of atopic dermatitis. Clin. Exp. Immunol. 2002, 127, 270–273. [Google Scholar] [CrossRef]
  67. Glickman, J.W.; Han, J.; Garcet, S.; Krueger, J.G.; Pavel, A.B.; Guttman-Yassky, E. Improving evaluation of drugs in atopic dermatitis by combining clinical and molecular measures. J. Allergy Clin. Immunol. Pract. 2020, 8, 3622–3625 e19. [Google Scholar] [CrossRef]
  68. Hu, X.; Li, J.; Fu, M.; Zhao, X.; Wang, W. The JAK/STAT signaling pathway: From bench to clinic. Signal Transduct. Target. Ther. 2021, 6, 402. [Google Scholar] [CrossRef]
  69. Lee, C.H.; Hong, C.H.; Yu, W.T.; Chuang, H.Y.; Huang, S.K.; Chen, G.S.; Yoshioka, T.; Sakata, M.; Liao, W.T.; Ko, Y.C.; et al. Mechanistic correlations between two itch biomarkers, cytokine interleukin-31 and neuropeptide beta-endorphin, via STAT3/calcium axis in atopic dermatitis. Br. J. Dermatol. 2012, 167, 794–803. [Google Scholar] [CrossRef]
  70. Mowen, K.A.; Glimcher, L.H. Signaling pathways in Th2 development. Immunol. Rev. 2004, 202, 203–222. [Google Scholar] [CrossRef]
  71. Jeong, G.H.; Lee, J.H. Dysregulated Hippo Signaling Pathway and YAP Activation in Atopic Dermatitis: Insights from Clinical and Animal Studies. Int. J. Mol. Sci. 2023, 24, 17322. [Google Scholar] [CrossRef] [PubMed]
  72. Pfitzner, E.; Kliem, S.; Baus, D.; Litterst, C.M. The role of STATs in inflammation and inflammatory diseases. Curr. Pharm. Des. 2004, 10, 2839–2850. [Google Scholar] [CrossRef] [PubMed]
  73. Maier, E.; Duschl, A.; Horejs-Hoeck, J. STAT6-dependent and -independent mechanisms in Th2 polarization. Eur. J. Immunol. 2012, 42, 2827–2833. [Google Scholar] [CrossRef] [PubMed]
  74. Borgia, F.; Custurone, P.; Li Pomi, F.; Cordiano, R.; Alessandrello, C.; Gangemi, S. IL-31: State of the Art for an Inflammation-Oriented Interleukin. Int. J. Mol. Sci. 2022, 23, 6507. [Google Scholar] [CrossRef]
  75. Guttman-Yassky, E.; Irvine, A.D.; Brunner, P.M.; Kim, B.S.; Boguniewicz, M.; Parmentier, J.; Platt, A.M.; Kabashima, K. The role of Janus kinase signaling in the pathology of atopic dermatitis. J. Allergy Clin. Immunol. 2023, 152, 1394–1404. [Google Scholar] [CrossRef]
  76. Rodrigues, M.A.; Torres, T. JAK/STAT inhibitors for the treatment of atopic dermatitis. J. Dermatol. Treat. 2020, 31, 33–40. [Google Scholar] [CrossRef] [PubMed]
  77. Nakashima, C.; Yanagihara, S.; Otsuka, A. Innovation in the treatment of atopic dermatitis: Emerging topical and oral Janus kinase inhibitors. Allergol. Int. 2022, 71, 40–46. [Google Scholar] [CrossRef]
  78. Roskoski, R., Jr. Janus kinase (JAK) inhibitors in the treatment of neoplastic and inflammatory disorders. Pharmacol. Res. 2022, 183, 106362. [Google Scholar] [CrossRef]
  79. Jin, W.; Huang, W.; Chen, L.; Jin, M.; Wang, Q.; Gao, Z.; Jin, Z. Topical Application of JAK1/JAK2 Inhibitor Momelotinib Exhibits Significant Anti-Inflammatory Responses in DNCB-Induced Atopic Dermatitis Model Mice. Int. J. Mol. Sci. 2018, 19, 3973. [Google Scholar] [CrossRef]
  80. Scuron, M.D.; Fay, B.L.; Connell, A.J.; Peel, M.T.; Smith, P.A. Ruxolitinib Cream Has Dual Efficacy on Pruritus and Inflammation in Experimental Dermatitis. Front. Immunol. 2020, 11, 620098. [Google Scholar] [CrossRef]
Ijms 25 11064 g001
Figure 1. Chemical structures of (A) flavonoid and (B) naringin.
Figure 1. Chemical structures of (A) flavonoid and (B) naringin.
Ijms 25 11064 g001
Ijms 25 11064 g002
Figure 2. Schematic description of the experiment (n = 6 per group). DNCB, 1-chloro-2,4-dinitrobenzene.
Figure 2. Schematic description of the experiment (n = 6 per group). DNCB, 1-chloro-2,4-dinitrobenzene.
Ijms 25 11064 g002
Ijms 25 11064 g003
Figure 3. (A) Clinical images of the ear and back at the end of the challenge period (day 16). (B) Graphs representing dermatitis severity and ear thickness assessment results. Values represent the mean ± SEM (n = 6). Data compared among multiple groups were analyzed using one-way analysis of variance. * p < 0.05, ** p < 0.01, *** p < 0.001 compared to the NC or DNCB-only group. DNCB, 1-chloro-2,4-dinitrobenzene; NC, normal control.
Figure 3. (A) Clinical images of the ear and back at the end of the challenge period (day 16). (B) Graphs representing dermatitis severity and ear thickness assessment results. Values represent the mean ± SEM (n = 6). Data compared among multiple groups were analyzed using one-way analysis of variance. * p < 0.05, ** p < 0.01, *** p < 0.001 compared to the NC or DNCB-only group. DNCB, 1-chloro-2,4-dinitrobenzene; NC, normal control.
Ijms 25 11064 g003
Ijms 25 11064 g004
Figure 4. (A) Pathology images of H&E and toluidine blue staining in dorsal skin tissue samples. Mast cells are stained purple with toluidine blue. Original magnification = ×200, scale bar = 100 μm. (B) Graphs representing the epidermal thickness and the number of mast cells. Values are mean ± SEM (n = 6). Data compared among multiple groups were analyzed using one-way analysis of variance. *** p < 0.001 compared to the NC or DNCB-only group. H&E, hematoxylin and eosin; NC, normal control; DNCB, 1-chloro-2,4-dinitrobenzene.
Figure 4. (A) Pathology images of H&E and toluidine blue staining in dorsal skin tissue samples. Mast cells are stained purple with toluidine blue. Original magnification = ×200, scale bar = 100 μm. (B) Graphs representing the epidermal thickness and the number of mast cells. Values are mean ± SEM (n = 6). Data compared among multiple groups were analyzed using one-way analysis of variance. *** p < 0.001 compared to the NC or DNCB-only group. H&E, hematoxylin and eosin; NC, normal control; DNCB, 1-chloro-2,4-dinitrobenzene.
Ijms 25 11064 g004
Ijms 25 11064 g005
Figure 5. Expressed mRNA level of (A) TNF-α, (B) IFN-γ, (C) IL4, (D) CCL17, (E) CCL22, (F) IL1β, (G) IL31, and (H) TSLP quantified by qRT-PCR and (I) IL13 by ELISA in dorsal skin tissues. The expression of each gene was normalized to that of Actb. Each qRT-PCR reaction was performed in triplicate. Values are mean ± SEM (n = 6). Data compared among multiple groups were analyzed using one-way analysis of variance. * p < 0.05, ** p < 0.01, *** p < 0.001 compared to the NC or DNCB-only group. CCL, chemokine C-C motif ligand; DNCB, 1-chloro-2,4-dinitrobenzene; IL, interleukin; INF-γ, interferon-gamma; NC, normal control; TNF-α, tumor necrosis factor-alpha; TSLP, thymic stromal lymphopoietin.
Figure 5. Expressed mRNA level of (A) TNF-α, (B) IFN-γ, (C) IL4, (D) CCL17, (E) CCL22, (F) IL1β, (G) IL31, and (H) TSLP quantified by qRT-PCR and (I) IL13 by ELISA in dorsal skin tissues. The expression of each gene was normalized to that of Actb. Each qRT-PCR reaction was performed in triplicate. Values are mean ± SEM (n = 6). Data compared among multiple groups were analyzed using one-way analysis of variance. * p < 0.05, ** p < 0.01, *** p < 0.001 compared to the NC or DNCB-only group. CCL, chemokine C-C motif ligand; DNCB, 1-chloro-2,4-dinitrobenzene; IL, interleukin; INF-γ, interferon-gamma; NC, normal control; TNF-α, tumor necrosis factor-alpha; TSLP, thymic stromal lymphopoietin.
Ijms 25 11064 g005
Ijms 25 11064 g006
Figure 6. Expression of JAK–STAT proteins in dorsal skin tissues. Immunoblotting intensities were calculated with ImageJ software (version 1.8.0). Values are mean ± SEM (n = 6). Data compared among multiple groups were analyzed using one-way analysis of variance. * p < 0.05, ** p < 0.01, *** p < 0.001 compared to the NC or DNCB-only group. DNCB, 1-chloro-2,4-dinitrobenzene; JAK-STAT, Janus kinase-signal transducer and activator of transcription; NC, normal control; P-STAT3, phospho-STAT3.
Figure 6. Expression of JAK–STAT proteins in dorsal skin tissues. Immunoblotting intensities were calculated with ImageJ software (version 1.8.0). Values are mean ± SEM (n = 6). Data compared among multiple groups were analyzed using one-way analysis of variance. * p < 0.05, ** p < 0.01, *** p < 0.001 compared to the NC or DNCB-only group. DNCB, 1-chloro-2,4-dinitrobenzene; JAK-STAT, Janus kinase-signal transducer and activator of transcription; NC, normal control; P-STAT3, phospho-STAT3.
Ijms 25 11064 g006
Table 1. Primer sequences for quantitative real-time PCR amplifications.
Table 1. Primer sequences for quantitative real-time PCR amplifications.
Target GeneForward/ReverseSequence (5′-3′)
Il4FTCACTGACGGCACAGAGCTA
RCTTCTCCTGTGACCTCGTT
Il31FACACCGAGTTGGAGAGCCGTAT
RCTGTCCTCAGACCGATGTTCTC
Tarc/Ccl17FCGAGAGTGCTGCCTGGATTACT
RGGTCTGCACAGATGAGCTTGCC
Mdc/Ccl22FGTGGAAGACAGTATCTGCTGCC
RAGGCTTGCGGCAGGATTTTGAG
TslpFAGCTTGTCTCCTGAAAATCGAG
RAGGTTTGATTCAGGCAGATGTT
TnfaFAACTCCAGGCGGTGCCTATG
RTCCAGCTGCTCCTCCACTTG
IfngFAAGCGTCATTGAATCACACC
RTGACCTCAAACTTGGCAATA
Il1bFTGGACCTTCCAGGATGAGGACA
RGTTCATCTCGGAGCCTGTAGTG
ActbFCATTGCTGACAGGATGCAGAAGG
RTGCTGGAAGGTGGACAGTGAGG
Ccl, chemokine C-C motif ligand; Il, interleukin; Infg, interferon-gamma; Mdc, macrophage-derived chemokine; Tarc, thymus and activation-regulated chemokine; Tnfa, tumor necrosis factor-alpha; Tslp, thymic stromal lymphopoietin.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yoo, S.-A.; Kim, K.-C.; Lee, J.-H. Efficacy and Potential Mechanisms of Naringin in Atopic Dermatitis. Int. J. Mol. Sci. 2024, 25, 11064. https://doi.org/10.3390/ijms252011064

AMA Style

Yoo S-A, Kim K-C, Lee J-H. Efficacy and Potential Mechanisms of Naringin in Atopic Dermatitis. International Journal of Molecular Sciences. 2024; 25(20):11064. https://doi.org/10.3390/ijms252011064

Chicago/Turabian Style

Yoo, Seung-Ah, Ki-Chan Kim, and Ji-Hyun Lee. 2024. "Efficacy and Potential Mechanisms of Naringin in Atopic Dermatitis" International Journal of Molecular Sciences 25, no. 20: 11064. https://doi.org/10.3390/ijms252011064

APA Style

Yoo, S. -A., Kim, K. -C., & Lee, J. -H. (2024). Efficacy and Potential Mechanisms of Naringin in Atopic Dermatitis. International Journal of Molecular Sciences, 25(20), 11064. https://doi.org/10.3390/ijms252011064

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop