Next Article in Journal
Deciphering the Role of the SREBF1 Gene in the Transcriptional Regulation of Porcine Adipogenesis Using CRISPR/Cas9 Editing
Previous Article in Journal
Sex-Related Differences in Pancreatic Ductal Adenocarcinoma Progression and Response to Therapy
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

gnas Knockdown Induces Obesity and AHO Features in Early Zebrafish Larvae

1
Department of Biomedical Sciences, College of Health Sciences, QU Health, Qatar University, Doha P.O. Box 2713, Qatar
2
Biomedical Research Center, Qatar University, Doha P.O. Box 2713, Qatar
3
Division of Endocrinology, Department of Pediatric Medicine, Sidra Medicine, Doha P.O. Box 26999, Qatar
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(23), 12674; https://doi.org/10.3390/ijms252312674
Submission received: 16 October 2024 / Revised: 22 November 2024 / Accepted: 22 November 2024 / Published: 26 November 2024
(This article belongs to the Section Molecular Genetics and Genomics)

Abstract

:
GNAS (Guanine Nucleotide-Binding Protein, Alpha Stimulating) is a complex gene that encodes the alpha subunit of the stimulatory G protein (Gsα), critical for signaling through various G protein-coupled receptors. Inactivating genetic and epigenetic changes in GNAS, resulting in Gsα deficiency, cause different variants of pseudohypoparathyroidism, which may manifest features of Albright hereditary osteodystrophy (AHO, a syndrome characterized by early-onset obesity and other developmental defects). Recent findings have linked Gsα deficiency with isolated, severe, early-onset obesity, suggesting it as a potential, underrecognized cause of monogenic, non-syndromic obesity. This study was prompted by identifying several GNAS variants of uncertain significance (VUSs) in pediatric patients presenting with unexplained, severe, early-onset obesity at Sidra Medicine in Qatar. To functionally characterize these variants, we developed the first zebrafish model of Gsα deficiency, offering numerous advantages over other model systems. This was achieved by knockdown of the ortholog through microinjection of translation-blocking Morpholino antisense oligonucleotides into the yolks of 1-8-cell-stage zebrafish embryos. The morphant larvae displayed an obese phenotype, marked by significantly enlarged yolk sacs, increased neutral lipid accumulation, and reduced metabolic rates, among other developmental abnormalities resembling those in AHO. This zebrafish model lays the foundation for efficient functional characterization of GNAS VUSs and paves the way for enhancing our understanding of Gsα deficiency-associated early-onset obesity.

1. Introduction

Early-onset obesity, defined as obesity occurring in children aged 5 years and below, represents a significant global health problem [1]. As reported by the World Health Organization, approximately 39 million children under the age of 5 years were overweight or obese in 2020 [2]. Childhood obesity is particularly prevalent in the Middle East and North Africa (MENA) region [3]. A notable example is Qatar, where about 50% of school-aged children are classified as overweight or obese [4]. The consequences of early-onset obesity extend far beyond increased body weight; it is linked to several comorbidities and complications, including type 2 diabetes mellitus, cardiovascular diseases, polycystic ovarian syndrome, sleep apnea, psychological problems, and musculoskeletal disorders [5].
This condition is classified into distinct forms based on its etiology and clinical spectrum, namely, polygenic, monogenic, and syndromic [6]. The polygenic form is the most prevalent, resulting from complex interactions between multiple genetic and environmental factors [7]. Conversely, the monogenic form is rare, primarily caused by autosomal recessive variants in single genes, often associated with the leptin-melanocortin pathway, which regulates energy homeostasis and appetite [8]. It presents as severe, early-onset obesity, indicated by a body mass index (BMI) that is at least 120% of the 95th age- and sex-specific percentile [1], and is frequently associated with endocrine disorders and hyperphagia [9]. Given the high prevalence of consanguinity [10], monogenic obesity poses a significant health concern in Arab populations [11], underscoring the need for more research efforts to explore the genetic basis of obesity in the region [12]. Lastly, the syndromic form arises from various genetic factors, involves multiple organ systems, and is associated with additional clinical features, such as developmental and hormonal abnormalities [6].
GNAS (Guanine Nucleotide-Binding Protein, Alpha Stimulating) is an imprinted, complex gene located on chromosome 20 that encodes the alpha subunit of the heterotrimeric stimulatory G protein (Gsα) [13]. This protein subunit mediates signaling through various seven-transmembrane G protein-coupled receptors (GPCRs), including the melanocortin 4 receptor (MC4R), which plays a crucial role in regulating energy homeostasis, food intake, and body weight [14]. Genetic or epigenetic alterations in GNAS that lead to Gsα deficiency are known to cause pseudohypoparathyroidism (PHP) in its different subtypes [15]. PHP refers to a group of rare disorders characterized by resistance to parathyroid hormone (PTH), among other clinical symptoms [16]. Some PHP subtypes exhibit features of Albright hereditary osteodystrophy (AHO), a rare syndrome that includes early-onset obesity, short stature, skeletal anomalies, developmental delay, and mental development issues [17]. More recently, Gsα deficiency has been linked to isolated, severe, early-onset obesity, with accumulating evidence suggesting that it may be an underappreciated cause of monogenic, non-syndromic obesity [18,19].
To delineate the molecular mechanisms underlying Gsα deficiency-associated early-onset obesity, various functional studies have been conducted in mice, where the Gnas gene was manipulated to model Gsα deficiency [20,21,22,23]. Although the mouse model has significantly advanced our understanding of the disease pathogenesis, much remains to be explained [23]. Importantly, the mouse model has notable limitations, including its frequent inability to accurately model human diseases due to the differences between humans and mice in the processes that link genetic changes to disease development [24]. Additionally, mouse models are expensive, complicated, and time-consuming to generate and study [25]. Therefore, there is a pressing need for an improved and more robust model organism to facilitate further studies of the pathophysiology of early-onset obesity associated with GNAS changes. This would accelerate the discovery of novel therapies and enable the functional characterization of GNAS variants of uncertain significance (VUSs), ultimately improving patient outcomes.
The zebrafish (Danio rerio) has become an increasingly valuable model for studying various human metabolic disorders, including obesity and diabetes [26]. This is primarily due to the remarkable similarity and functional conservation of the main organs and metabolic pathways between zebrafish and humans [27]. Zebrafish have proven to be an excellent model for human developmental and genetic diseases owing to their multiple advantageous features [28]. Notably, zebrafish are approximately 70% genetically similar to humans, sharing over 80% of human disease-associated genes [29]. This model organism is easy to manipulate genetically, produces large numbers of offspring, is cost-effective and easy to maintain, and has a fully sequenced genome [30]. Moreover, its rapid and external development and the transparency of its embryonic and larval stages make it easy to manipulate and study [31]. Furthermore, this vertebrate is anatomically and physiologically similar to humans, making it a suitable animal model for human diseases [32].
Despite the development of multiple zebrafish obesity models, including diet-induced models and various transgenic and mutant lines [27], early-onset obesity induced by Gsα deficiency has yet to be modeled in zebrafish. Thus, owing to its numerous advantages, we sought to develop the first zebrafish model of this specific condition. Utilizing Morpholino-mediated knockdown of the gnas gene, we examined the effects of Gsα deficiency in the zebrafish during the embryonic and early larval stages (up to 5 days post-fertilization). Our study focused on various metabolic, morphometric, and developmental parameters to establish the loss-of-function phenotype in zebrafish and provide novel insights into the disease pathophysiology. This zebrafish model lays the groundwork for further functional studies, potentially enabling the efficient reclassification of novel and previously reported GNAS VUSs.

2. Results

2.1. GαsS Temporal Expression Analysis in the Zebrafish

Prior to the knockdown experiments, the temporal expression pattern of the protein of interest, specifically the short Gαs isoform (GαsS) encoded by gnas, was analyzed by Western blotting in whole zebrafish embryos and larvae at 24–96 hpf. This analysis was performed to determine the appropriate timepoint at which to assess the knockdown efficiency of the translation-blocking Morpholinos. There is at least one other Gαs splice variant expressed in zebrafish, known as the long Gαs isoform (GαsL; 49 kDa) [33]. However, its expression level is much lower compared to GαsS. Consequently, GαsS was selected as the isoform of interest. The results revealed that GαsS expression increased significantly from 24 hpf until 72 hpf (1.07 a.u. at 72 hpf vs. 0.49 a.u. at 24 hpf; p < 0.05), followed by a significant decrease to 0.55 a.u. at 96 hpf (p < 0.05) (Figure 1). Based on these findings and considering the diminishing effectiveness of Morpholinos over time [34], 48 hpf was chosen as a suitable timepoint to analyze knockdown efficacy. Importantly, we tested different commercially available antibodies during this stage and successfully validated the anti-GNAS antibody (Abcam, Cambridge, UK; catalog # ab97629), targeting the human Gsα protein, for use with zebrafish samples. This represents the first validation of this antibody for zebrafish, enhancing its utility for future research.

2.2. Determination of Optimal Morpholino Dose for gnas Gene Knockdown in Zebrafish

To block the translation of the two Gsα splice variants in zebrafish, two different Morpholino oligomers (MOs), each targeting one of the splice variants, were simultaneously microinjected into the yolks of 1-8-cell-stage embryos (Table 1). Three doses (1, 3, and 5 ng) of both MOs mixed were tested for toxicity and efficacy to identify the optimal dose. These doses were selected based on reports that MO doses of 5 ng or less result in specific loss-of-function phenotypes with minimal off-target effects and toxicity [35,36,37].

2.2.1. Knockdown Efficacy at 48 Hours Post-Fertilization

The level of gnas knockdown was quantified at the protein level by Western blotting at 48 hpf to determine the knockdown efficiency of the three MO doses (1, 3, and 5 ng). Compared to non-injected controls, the decrease in expression level was statistically significant at MO doses of 3 ng and 5 ng (p < 0.0001). The 5 ng gnas MO dose resulted in the highest level of knockdown, causing approximately 66% reduction in GαsS expression level (Figure 2).

2.2.2. Toxicity Assessment of the Morpholino Doses

To assess the toxicity of the different gnas MO doses, the survival, tail-flicking, and hatching rates of the morphant zebrafish embryos were measured and compared to those of non-injected controls and negative controls injected with 5 ng of Std Ctrl MO. Firstly, the survival rate was recorded every 24 hpf until the experimental endpoint, which was 48 hpf in this first phase of this study that aimed to determine the optimal MO dose for gnas knockdown in zebrafish embryos. The survival rates of all injected groups were expressed as a percentage of that of the non-injected control group. There was no significant difference between the mean survival rates of the different experimental and control groups (n = 4; Figure 3). However, a dose-dependent decrease in survival rate was observed in the groups injected with the different doses of gnas MOs, with the lowest survival rates (83% and 80% at 24 and 48 hpf, respectively) seen in the group injected with the highest dose of 5 ng. Nevertheless, this decrease in survival was statistically insignificant (Figure 3).
Secondly, the rate of spontaneous tail flicks of zebrafish embryos at 24 hpf was measured as an indicator of neurotoxicity using the DanioScope software [38]. Tail flicking is the first movement elicited by the developing nervous system of zebrafish embryos [39]. Our analysis revealed no significant differences in the tail-flicking rates, represented by the mean burst count per minute, among the different injected and non-injected groups (Figure 4). However, the frequency of tail flicks was higher, yet more variable, in the group injected with 5 ng of gnas MOs compared to the other groups (Figure 4).
Finally, the embryo-hatching rate was recorded at 48 hpf, as it may serve as an indicator of developmental toxicity, where a delay in hatching could reflect developmental delay [39]. The normal zebrafish hatching period is between 48 and 72 hpf [40]. The hatching rates across all groups exhibited substantial variability, as indicated by the large error bars in Figure 5. This variability will be further discussed in Section 3. Overall, no statistically significant differences existed between the mean hatching rates of all experimental and control groups.

2.3. Phenotypic Analyses of gnas Morphants

To assess the dose-dependent specific effects of MO-mediated gnas knockdown on different phenotypes related to Gsα deficiency and obesity, zebrafish embryos injected with 3 ng and 5 ng of gnas MOs were evaluated for their yolk sac areas, body lengths, body weights, neutral lipid contents, and hatching rates (at 72 hpf), which were compared to those of non-injected and Std Ctrl MO-injected controls.

2.3.1. gnas Knockdown Increased Neutral Lipid Content and Yolk Sac Size in Zebrafish Larvae at 120 hpf

The amounts of neutral lipids in the zebrafish larvae were quantified at 120 hpf by Oil Red O (ORO) staining of the whole larvae, followed by extraction of the stain from the zebrafish bodies and measurement of the absorbance at 495 nm. ORO staining was performed at this specific timepoint to capture the largest possible differences in neutral lipid content between experimental groups, as resorption of the lipid-rich yolk becomes evident around 120 hpf during normal development [41,42]. In addition, previous studies have performed ORO staining at this stage and shown that lipids accumulate in many tissues and organs at 120 hpf [43,44].
A dose-dependent increase in the absorbance (A495) was observed in the gnas morphants compared to the controls, indicating an increase in neutral lipid content (Figure 6). This change was statistically significant at the higher (5 ng) gnas MO dose relative to the UI Ctrl and Std Ctrl groups (p < 0.05 and p < 0.01, respectively). This is likely a specific effect of gnas knockdown, as Std Ctrl morphants did not exhibit an increase in staining, but rather a slight, insignificant decrease compared to non-injected controls.
The yolk of the zebrafish embryo, rich in lipids and proteins, is a site of active lipid metabolism, where lipid breakdown and synthesis occur before mobilization to the embryo [45]. An increase in yolk size, known as yolk retention, indicates impaired lipid metabolism and uptake [46]. Yolk sac size was measured at 72 and 120 hpf, as described in a previous study [47], to assess differences in yolk consumption across groups at both timepoints.
Knockdown of the gnas gene resulted in a significant increase in yolk sac area in zebrafish larvae at 120 hpf, compared to non-injected controls (p < 0.05), as depicted in Figure 7. At 72 hpf, slight but insignificant increases in yolk sac areas were noted in gnas morphants compared to non-injected controls. No significant difference was observed between the mean yolk size of Std Ctrl morphants and that of non-injected controls, suggesting that this effect was specific to gnas knockdown.

2.3.2. gnas Knockdown Led to a Significant, Specific Reduction in Metabolic Rate

The alamarBlueTM assay, which measures in vivo NADH2 production via the Krebs cycle as a direct indicator of metabolic rate, was performed at 72–96 hpf based on previous studies [48,49]. In this assay, the non-fluorescent compound resazurin permeates the zebrafish tissues, where it is reduced by NADH2 in the metabolically active cells to produce the fluorescent compound resorufin [48]. Compared to non-injected controls, gnas morphants exhibited significantly lower metabolic rates, as indicated by the relative change in fluorescence from 72 to 96 hpf (p < 0.01). This decrease was greatest for the morphants injected with 5 ng of gnas MOs, with a relative change in fluorescence of 0.44 (p < 0.01), and smallest for the morphants injected with 5 ng of Std Ctrl MO, which displayed a relative change in fluorescence of 0.70 (ns; Figure 8). Thus, this effect was MO-dose-dependent, statistically significant, and specific to gnas knockdown.

2.3.3. gnas Morphants Exhibited Skeletal Abnormalities and Reduced Body Lengths

The body lengths of the zebrafish morphants were measured using ImageJ software to assess the effect of gnas knockdown on growth and skeletal development, considering the association of Gsα deficiency with skeletal defects and short stature in humans [18]. This was performed at 72 and 120 hpf, as described by Shah et al. (2019) [47]. The results showed that gnas morphants exhibited slightly reduced body lengths at 72 and 120 hpf compared to controls. However, this trend was not statistically significant (Figure 9). Additionally, morphological assessments revealed a greater incidence of skeletal abnormalities, such as scoliosis and tail curvature, in gnas morphants compared to controls (Figure 10).

2.3.4. gnas Morphants Showed a Slight but Non-Specific Increase in Mean Larval Wet Mass

In the investigation of larval mass at 120 hpf, wet masses of zebrafish larvae were quantitatively assessed using a high-precision analytical balance. This timepoint was chosen for this assessment to facilitate larval mass measurement, as it was the final timepoint before euthanasia and the larvae were at their largest. The results indicated that both gnas and Std Ctrl morphants had slightly increased average larval masses compared to non-injected controls, although this was not statistically significant (Figure 11). This may be explained by the challenges associated with the measurement technique, which are further discussed in Section 3.1.

2.3.5. gnas Knockdown Resulted in Delayed Hatching at 72 hpf

The hatching rate of zebrafish larvae at 72 hpf may indicate their development rate. gnas morphants exhibited delayed hatching at this timepoint compared to non-injected controls and Std Ctrl morphants, suggesting developmental delay due to gnas knockdown. However, this effect was not statistically significant given the relatively large variability in the hatching rates of the gnas morphants, as indicated by the error bars in Figure 12.

2.3.6. gnas Morphants Manifested Largely Increased Triglyceride Levels with No Appreciable Changes in cAMP and Leptin Levels

ELISA was employed to assess the triglyceride (TG), cAMP, and leptin levels in gnas morphant larvae compared to controls. This was performed at 72 hpf as it was an appropriate timepoint as described in the literature [50]. The results indicated a dose-dependent increase in TG levels specific to the gnas morphants, while the cAMP and leptin levels remained largely unaffected. Despite these observations, the increase in TG level did not show statistical significance due to the large variability in the data, particularly for the morphants injected with 5 ng of MOs, as indicated by the large error bar (Figure 13). This variability may be due to various reasons, including variability in kit age and gene knockdown efficiency across different embryos within the same experimental group.

3. Discussion

In the current study, we characterized the impacts of gnas gene knockdown on various parameters in early zebrafish larvae to establish the loss-of-function phenotype. This investigation provides significant insights into the roles of Gsα deficiency in inducing obesity, metabolic dysfunction, and developmental abnormalities. The knockdown of the zebrafish gnas gene was effectively achieved through the microinjection of translation-blocking MOs into the yolks of 1-8-cell-stage embryos. The embryos and larvae were closely monitored for 5 days post-fertilization. During this time, comprehensive assessments of several metabolic, morphometric, and developmental parameters were made, establishing the first zebrafish knockdown model of Gsα deficiency.
In our research, MO doses of 5 ng or lower were employed, consistent with research reports that these concentrations generally induce specific loss-of-function phenotypes with minimal toxicity and off-target effects [35,36,37]. Among the dosages tested in our experiments, 5 ng was identified as the optimal concentration due to its superior efficacy and low toxicity (Figure 2). The specificity of the gnas MO-induced knockdown was confirmed by the modest 15% reduction in GαsS expression observed with the 5 ng dose of the Std Ctrl MO.
The specificity of the gnas knockdown facilitated a focused examination of different phenotypes in the early zebrafish embryos. With respect to the hatching rate at 48 hpf (Figure 5), the large variability could be attributed to differences in the quality of embryos from distinct clutches and breeding tanks [51]. It is also noted that the hatching times can vary significantly even within a single clutch and that earlier hatching does not invariably suggest faster development [52].
With regard to the analysis of tail-flicking rates at 24 hpf, the group injected with the 5 ng dose of gnas MOs exhibited the highest but most variable rates of tail flicking (Figure 4). Although this increase in the frequency of spontaneous tail flicks was statistically insignificant, it may reflect hyperactivity and epileptic-like movements, as described in a study by Basnet et al. (2017) [53]. This may be a direct consequence of gnas knockdown, as in humans with pseudohypoparathyroidism type 1A (PHP1A), where maternal Gsα expression or function is impaired, as hypocalcemia was reported in several studies to be associated with neuromuscular disorders and seizures [15,18,54].
In this study, zebrafish gnas morphants exhibited an obese phenotype characterized by a significant increase in neutral lipid content, enlarged yolk sacs, and diminished metabolic rates. These observations, including neutral lipid accumulation and yolk retention observed at 120 hpf, together with the elevated TG level determined by ELISA at 72 hpf, suggest impaired lipid metabolism due to gnas knockdown. Neutral lipids present in the yolk, such as triglycerides and cholesterol, serve as a critical energy source during embryonic and early larval stages of zebrafish development [55,56]. The yolk undergoes active lipid processing and remodeling before these lipids are absorbed by the developing embryo [45]. The yolk syncytial layer, which is found between the yolk and blastoderm, is implicated in the hydrolysis of complex lipids and synthesis of lipoproteins that transport lipids to the embryo [57]. Thus, knockdown of apoc2, the gene encoding apolipoprotein C-II in zebrafish, was demonstrated to result in yolk retention due to impaired lipid metabolism [58]. During normal development, yolk resorption becomes apparent at around 120 hpf when exogenous feeding begins, with complete depletion occurring at approximately 170 hpf [41,42].
The observed increase in lipid content and yolk size in the gnas morphants may be a result of Gαs deficiency, which, in humans, is associated with metabolic dysfunction [59]. Given the similarity between lipid metabolic pathways in humans and zebrafish, similar mechanisms may underly the lipid accumulation in gnas morphants and patients with PHP1A (which arises from maternal Gsα deficiency) [60]. Notably, consistent with our findings, leptin A and leptin receptor zebrafish morphants exhibited enlarged yolk sacs and body/tail curvature, indicating the role of leptin-melanocortin signaling in lipid metabolism and early development [61].
Moreover, the gnas morphant zebrafish larvae exhibited significantly lower metabolic rates, slight reductions in body lengths, a higher incidence of skeletal deformities, particularly abnormal spine and tail curvature, and reduced hatching rates compared to the controls. These phenotypic manifestations closely resemble the features of AHO in humans, characterized by decreased energy expenditure, short stature, skeletal defects, and developmental delay. This syndrome is caused by heterozygous, loss-of-function variations in the GNAS gene [62]. These phenotypic parallels underscore the validity of the developed zebrafish model in mimicking human genetic disorders.
In humans, these characteristics arise from impaired GPCR signaling due to Gsα deficiency, leading to hormone resistance [63,64]. For example, parathyroid hormone (PTH) resistance is linked to skeletal abnormalities and reduced growth in PHP1A patients, while growth hormone-releasing hormone (GHRH) resistance was associated with growth retardation and short stature [59,65]. Moreover, other studies showed that thyroid-stimulating hormone (TSH) resistance in PHP1A patients leading to hypothyroidism was linked to developmental delay, as normal thyroid function is critical for normal development [18,66]. Additionally, reduced energy expenditure in patients with Gsα deficiency may be attributed to the impaired signaling of different GPCRs, such as β2- and β3-adrenergic receptors, thyroid-stimulating hormone receptor (TSHR), MC4R, and corticotropin-releasing hormone receptor (CRHR) [67]. Because GPCR signaling pathways are highly similar in zebrafish and humans, it is plausible that comparable mechanisms underly the observed phenotypes in the zebrafish gnas morphants [68].
Importantly, the reduced metabolic rate and increased lipid accumulation in our gnas morphant larvae, as determined by the alamarBlueTM assay and ORO staining, respectively, were also observed in α-MSH mutant zebrafish larvae [49], demonstrating the importance of MC4R signaling in regulating energy expenditure and lipid metabolism. In addition, similar to gnas knockdown in zebrafish, mc4r knockout in medaka (Oryzias latipes) resulted in delayed hatching and reduced body length, suggesting a role of MC4R signaling in early development and growth [69].

3.1. Limitations

The present study faced a few methodological constraints. Firstly, the technique for measuring larval body mass at 120 hpf involved challenges that could have compromised measurement accuracy. The small size of the zebrafish larvae, coupled with the limited precision of the balance used and the difficulty in ensuring the complete removal of water droplets from the tube before weighing, might have contributed to the observed non-significant difference in mean wet larval mass across groups. This may also explain the apparent increase in body mass in the Std Ctrl morphants relative to the non-injected controls. Nevertheless, this method, which was developed after a thorough search of the literature, remains the most feasible one for weighing early zebrafish larvae based on our experience [70,71]. However, the results indicate that body mass may not be a reliable measure of adiposity at such an early larval stage. In contrast, neutral lipid staining, triglyceride level measurement by ELISA, and yolk sac size are more informative in this respect.
Additionally, the use of Morpholinos for gene knockdown had inherent limitations. Morpholinos do not achieve complete gene silencing, often produce off-target effects, and their efficacy diminishes over time as they are diluted through cellular processes [72]. Despite these issues, such limitations were not detrimental to the core objectives of our study. The goal was to establish a transient model of Gsα deficiency (given the focus on early-onset obesity), where 50% knockdown was sufficient to simulate the 50% decrease in Gsα activity in PHP1A [73]. To mitigate potential off-target effects, a standard control Morpholino was employed across all experiments, providing a baseline control to enhance the interpretability of the phenotypic changes observed [74].

3.2. Implications and Future Directions

Our study has successfully achieved its aims of developing and validating the first zebrafish model of Gsα deficiency-associated early-onset obesity. In doing so, we have determined the optimal MO dose for gnas knockdown, in addition to testing for the first time an existing antibody (Abcam, Cambridge, UK, catalog # ab97629) designed to react with human Gsα protein, proving that it reacts with the zebrafish GαsS protein. This will be of great use to researchers who wish to use this zebrafish model for further studies of Gsα deficiency, which occurs in different subtypes of PHP, like PHP1A and pseudopseudohypoparathyroidism (PPHP). With its known advantages, this model will facilitate the study of the mechanisms underlying the various consequences of impaired Gs-coupled receptor signaling, such as monogenic obesity, AHO, and hormone resistance, potentially accelerating the discovery of novel targeted therapies.
Looking ahead, future studies can utilize advanced techniques to delineate the effects of Gsα deficiency on lipid metabolism in the zebrafish model. For example, the yolk sac may be dissociated from the zebrafish body to analyze their lipid compositions separately using mass spectrometry, as the yolk is the source of lipids, whereas the body is their destination [45]. Thus, treating the yolk and body as two independent systems would provide further insights into the changes in the lipid profile of the gnas morphants. Similarly, ORO staining of the yolk and body separately would shed light on the processes that are impaired as a result of Gsα deficiency [75]. Moreover, fluorescent lipid analogs may be injected into the yolk to study any effect on lipid processing, and the expression of important genes involved in lipid metabolism during zebrafish development may be analyzed to elucidate the mechanisms responsible for lipid accumulation in the gnas morphants [45]. Further, transgenic fluorescent reporter zebrafish lines may be employed to better visualize specific organs, tissues, cells, or even molecules of interest, facilitating the study of disease pathophysiology [76].
In addition, different pharmacological treatments may be tested on this zebrafish model, including phosphodiesterase inhibitors (PDEIs) and receptor agonists (such as setmelanotide, a novel MC4R agonist recently approved for treating certain monogenic and syndromic obesity forms), expediting the development of novel therapies for use in humans. PDEIs, which inhibit the degradation of intracellular cAMP, thereby increasing its levels, may be promising for the treatment of Gsα-deficiency-associated disorders, including early-onset obesity [77,78].
Another valuable use of the zebrafish gnas knockdown model is the functional characterization of novel GNAS variants and those of uncertain significance. This involves rescue experiments in the zebrafish morphants conducted by co-injection, with gnas MO, of wild-type or mutant complementary RNA (cRNA), corresponding to the wild-type human GNAS mRNA transcript and the transcript with the variant of interest, respectively. Briefly, after co-injecting different doses of wild-type human GNAS cRNA along with the optimal gnas MO dose, the optimal wild-type cRNA dose which results in the most significant rescue of the morphant phenotype with minimal toxicity is determined. This is followed by the ‘mutant rescue’ experiments, where the optimal dose (as determined for the wild-type cRNA) of the human GNAS mutant cRNA is injected into the zebrafish embryos along with the optimal MO dose, and phenotypic analyses are conducted as in the present study. The results of the wild-type and mutant rescue experiments are compared, enabling the functional characterization of the variant as described by Niederriter et al. (2013) [79].

4. Materials and Methods

4.1. Zebrafish Husbandry and Ethical Compliance

Wild-type (AB strain) zebrafish (Danio rerio) embryos were obtained from our zebrafish facility at the Biomedical Research Center at Qatar University. Adult zebrafish were housed in a recirculating stand-alone aquatic rack system (Aquaneering, San Diego, CA, USA; catalog # ZD560). The system was maintained under standard conditions: water temperature of 28 °C, a photoperiod regime of 14 h light and 10 h dark, and optimum water quality parameters [52]. The embryos were incubated at 28.5 °C in egg water (5 mM NaCl, 0.17 mM KCl, 0.16 mM MgSO4-7H2O, 0.4 mM CaCl2-2H2O, and 0.1% (w/v) methylene blue), which was replenished daily. All experiments were performed in compliance with national and international guidelines and approved by the Qatar University Institutional Biohazard Committee (reference number: QU-IBC-2021/027; date: 14 June 2021). As all larvae were euthanized by 5 days post-fertilization (dpf), approval from the Institutional Animal Care and Use Committee (QU-IACUC) was not required. Euthanasia was conducted in accordance with the policy set by the Ministry of Public Health and the American Veterinary Medical Association (AVMA) guidelines.

4.2. Experimental Design

To achieve the aims of this study, this project was divided into two major phases outlined by the following technical objectives: (1) to knock down the zebrafish orthologous gene, gnas, to mimic the loss of GNAS function in humans; and (2) to characterize the effects of gnas knockdown on various metabolic and developmental parameters in early larval zebrafish.
The first phase consisted of determining the optimal Morpholino (synthetic antisense oligonucleotide) dose that resulted in sufficient gnas knockdown with minimal toxic effects. To achieve this, one-cell-stage zebrafish embryos were divided into 5 groups of ~30 embryos as follows: (1) non-injected control group; (2) negative control group, injected with standard control Morpholino; (3–5) gnas knockdown groups injected with different doses (1, 3, and 5 ng, respectively) of the gnas Morpholinos. Western blotting was performed to quantify gene knockdown at the protein level, while Morpholino toxicity was assessed by measuring survival, hatching, and tail-flicking rates.
The second phase involved the functional evaluation of the dose-dependent effects of Morpholino-mediated gnas knockdown on various obesity and metabolism-related parameters in early larval zebrafish. The effective and minimally toxic Morpholino doses (3 and 5 ng) were selected for the functional verification of the knockdown, and the two control groups (non-injected and negative controls) were included for comparison. Here, the embryos or larvae were assessed at different timepoints for their survival and hatching rates, body length, yolk sac area, wet body mass, neutral lipid content (as determined by Oil Red O staining), metabolic rate (measured by the alamarBlueTM assay), as well as levels of triglycerides, cyclic adenosine monophosphate (cAMP), and leptin using specialized enzyme-linked immunosorbent assay (ELISA) kits. All experiments were conducted with at least three replicates.

4.3. Morpholino Design and Preparation

Synthetic translation-blocking Morpholino antisense oligonucleotides (MOs) were designed by and purchased from Gene Tools, LLC (Philomath, OR, USA). The NCBI RefSeq accession numbers for the two target mRNA transcripts, encoded by the zebrafish orthologous gene, gnas, were submitted to Gene Tools via their online Morpholino design request form. The sequences of the obtained MO and the corresponding target mRNA accession numbers are listed in Table 1. Additionally, the Standard Control (Std Ctrl) MO was purchased as a negative control. This MO targets a specific β-thalassemia-causing intronic mutation in the human β-globin gene; thus, it has insignificant effects on phenotype in zebrafish and other model organisms. Prior to ordering, as per the recommendations of Gene Tools, the specificities of both experimental MOs were checked in silico using the NCBI Standard Nucleotide BLAST tool (BLASTN program), whereby the inverse complements of the MO sequences were entered as the nucleotide queries to identify any possible unintended targets in the zebrafish transcriptome.
The lyophilized MOs were each resuspended in autoclaved Milli-Q® water to make stock solutions of 1 mM [80]. These stock solutions were stored at room temperature in their original vials, with caps tightly sealed using parafilm. For experimental use, working solutions were prepared by diluting the MO stock solutions as required, and phenol red was added as a tracer dye to a final concentration of 0.1% (w/v) in a final volume of 10 µL [80]. The two experimental MOs (gnas-MO1 and gnas-MO2) were combined in equal proportions to yield a total dose of 1, 3, and 5 ng of both MOs in an injection volume of 4.6 nL of each working solution (Table 2). Similarly, the Std Ctrl MO working solution was prepared to yield a final dose of 5 ng in each 4.6 nL injection volume. All working solutions were made in microcentrifuge tubes and stored at room temperature for subsequent use.

4.4. Microinjection Procedure

One-eight-cell-stage zebrafish embryos were microinjected into the yolk using the DrummondTM Nanoject II Auto-Nanoliter Injector (Drummond Scientific Company, Broomall, PA, USA). Pulling of 3.5″ glass capillaries (Drummond Scientific Company, catalog # 3-000-203-G/X) was performed at 60 °C using a PC-100 Narishige puller (Narishige Group, Tokyo, Japan) to produce the micropipettes for injection. Under a stereomicroscope, the tips of the pulled micropipettes were broken to create narrow openings by lightly tapping them with the surface of a surgical blade [80]. The micropipettes were backfilled with mineral oil before drawing 1–2 µL of injection solution. Injection parameters were standardized across all experiments, with a volume set at 4.6 nL and an injection speed of 46 nL/s. The embryos were positioned in the grooves of a pre-prepared molded agarose block to stabilize them during injection [80]. The mold used for creating the grooves within the agarose substrate was purchased from World Precision Instruments (Z-MOLDS; WPI, Sarasota, FL, USA). Following injection, the embryos were transferred to a Petri dish with fresh egg water and incubated at 28.5 °C. Approximately two hours post-injection, the embryos were examined under the stereomicroscope to assess their viability. Any embryo found to be dead or exhibiting severe damage (e.g., dechorionated due to injection) was removed and excluded from the analysis.

4.5. Western Blotting

Zebrafish embryos or larvae were dechorionated (if unhatched) using pronase solution (2 mg/mL) and deyolked at the appropriate timepoint (48 h post-fertilization; hpf) for the verification of knockdown) as described in The Zebrafish Book [52]. The samples were then homogenized by sonication in Radioimmunoprecipitation Assay (RIPA) buffer (~3 µL/embryo) supplemented with protease and phosphatase inhibitors (Thermo Fisher Scientific, Waltham, MA, USA; catalog # 89900 and A32959). The homogenate was centrifuged at 15,000 RPM for 20 min at 4 °C, and the supernatant’s protein concentration was determined using the bicinchoninic acid (BCA) protein assay (Thermo Fisher Scientific, catalog # 23225). Equal amounts of protein (30–40 µg) were loaded onto 10% sodium dodecyl sulphate (SDS)-polyacrylamide gels and electrophoresis was performed. Subsequently, electrophoretic transfer of the proteins from the gels to polyvinylidene fluoride (PVDF) membranes (Thermo Fisher Scientific, catalog # LC2005) was conducted, after which the membranes were blocked for 1 h at room temperature in 5% non-fat dry milk in Tris-buffered saline (TBS) containing 0.05% Tween 20 (TBST; Glentham Life Sciences Ltd., Corsham, UK, catalog # GD9856). The blocked membranes were incubated overnight at 4 °C or for 2 h at room temperature with rabbit polyclonal anti-GNAS primary antibody (1:1000, Abcam, Cambridge, UK; catalog # ab97629). After washing thrice in TBST, the blots were incubated for 1 h at room temperature with horseradish peroxidase-conjugated anti-rabbit IgG secondary antibody (1:5000, Abcam, ab6721). The enhanced chemiluminescence (ECL) substrate (Thermo Fisher Scientific, catalog # 32106) and ChemiDoc MP Imaging System (Bio-Rad, Hercules, CA, USA; catalog # 12003154) were used to detect the protein bands. The blots were stripped with stripping buffer (Thermo Fisher Scientific, catalog # 21059), re-blocked, and re-incubated for 1 h at room temperature with anti-GAPDH antibody (1:5000, Abcam, ab210113) as the loading control, followed by secondary antibody incubation as described. SKB-F (human skeletal myoblasts, Zen-Bio, Durham, NC, USA) and A549 cell lysates were used as positive controls. Blot images were analyzed using ImageJ software (version 1.53t, Wayne Rasband, National Institute of Health, Bethesda, MD, USA) to quantify protein band densities.

4.6. Assessment of Survival, Hatching, and Tail-Flicking Rates

All experimental assessments were conducted using a ZEISS SterReo Disovery V12 stereomicroscope (ZEISS, Jena, Germany). The survival rates of zebrafish embryos or larvae were recorded daily from 24 hpf until the experimental endpoint. Survival was quantified as the percentage of embryos or larvae exhibiting a heartbeat, normalized to that of the non-injected control group. Hatching rates were recorded at 48 and 72 hpf, defined as the percentage of live embryos or larvae that had completely emerged from their chorion. The spontaneous tail-flicking rate was assessed at 24 hpf by recording 20 s videos (with a frame rate of 60 fps) of the embryos using the ORCA-Flash4.0 V3 camera (Hamamatsu Photonics K.K., Hamamatsu, Japan; catalog # C13440-20CU) mounted on a stereomicroscope along with the HCImage software (version 4.4.1.0, Hamamatsu Photonics K.K.), as described by Da’as et al. (2020) [39]. Subsequent analysis was performed using DanioScope software (version 1.1.110, Noldus Information Technology, Wageningen, The Netherlands), and the burst counts per minute (number of tail flicks per minute) were acquired.

4.7. Brightfield Imaging and Morphometric Measurements

Ten anesthetized larvae per group were assessed at 72 and 120 hpf for their body lengths and yolk sac areas. Brightfield images were captured using an ORCA-Flash4.0 V3 camera (Hamamatsu Photonics K.K., Hamamatsu, Japan) at 20X magnification under a ZEISS SteREO Discovery V12 stereomicroscope (ZEISS, Jena, Germany). Larvae were anesthetized by immersion in a solution of 2 µg/mL tricaine mesylate (MS-222). For imaging, a few drops of 3% (w/v) methylcellulose (Sigma-Aldrich, St. Louis, MO, USA; catalog # M0387) were placed in each cavity (~15 mm in diameter) of a triple cavity slide, and one or two larvae were laterally positioned with a probe in each cavity, straightened as much as possible, and the images were captured. After imaging, the larvae were transferred to fresh egg water and incubated at standard conditions to allow recovery.
ImageJ software (version 1.53t) was used to analyze the captured images. After setting the scale (pixels/mm), the body length was measured by drawing a straight line parallel to the larva’s full length (from the snout’s tip until the end of the caudal fin) using the ‘Straight Line’ selection tool. For yolk sac area measurement, the ‘Polygon’ area selection tool was used to trace the boundary of the entire yolk sac, including the yolk extension. The mean yolk sac area was normalized to that of the non-injected control group.

4.8. Larval Wet Body Mass Measurement

At 120 hpf, following imaging and prior to fixation, the wet masses of the larvae were measured using a precision scale with a resolution of 0.0001 g [70]. Larvae from each group were transferred to pre-weighed empty microcentrifuge tubes, and the egg water was removed as completely as possible. After weighing each tube with the larvae, the total mass of the larvae was calculated by subtracting the mass of the empty tube from each measurement. The average larval mass for each group was determined by dividing the total larval mass by the number of larvae in each tube.

4.9. Oil Red O Staining, Extraction, and Quantification in Zebrafish Larvae

Oil Red O (ORO) staining of zebrafish larvae was performed at 120 hpf to quantify the total amount of neutral lipids within the whole larval body, as described by Al-Jamal et al. (2020) and Yoganantharjah et al. (2017) [75,81]. Briefly, at 120 hpf, the larvae were fixed in 4% (w/v) paraformaldehyde in PBS (Thermo Fisher Scientific, Waltham, MA, USA; catalog # R37814) overnight at 4 °C. The fixed larvae were washed in 60% isopropanol before staining for 1.25 h in 0.25% (w/v) ORO (Abcam, Cambridge, UK; catalog # ab146295) solution. After washing the stained larvae in 60% isopropanol and 0.1% PBTw (PBS with 0.1% Tween 20), the larvae in each experimental or control group were divided into pools of 5–10 larvae per microcentrifuge tube, ensuring that the number was consistent across replicates and groups. Three to four replicates were analyzed per group. To extract the ORO stain from the zebrafish tissues, 250 µL of 4% (v/v) ethanol in 100% isopropanol was added to each microcentrifuge tube before incubation at room temperature for ~2 h or until the stain was completely extracted. To quantify the neutral lipid content, 200 µL of the solution in each tube was transferred to respective wells of a 96-well plate and the absorbance was measured at 495 nm using the Multiskan Sky Microplate Spectrophotometer (Thermo Fisher Scientific, catalog # 1530-800840). Fresh (unstained) 4% ethanol in isopropanol was used as a blank.

4.10. AlamarBlueTM Zebrafish Metabolic Rate Assay

The alamarBlueTM metabolic rate assay was conducted on zebrafish larvae as described in the literature [48,49]. Briefly, zebrafish larvae at 72 hpf from all experimental and control groups were rinsed once with sterile-filtered egg water before transferring to a 96-well plate. For each group, 3–5 wells, each containing 3 larvae, were included. The existing water in each occupied well was removed and replaced with 300 µL of assay buffer, composed of filtered egg water containing 1% alamarBlue™ HS Cell Viability Reagent (Thermo Fisher Scientific, Waltham, MA, USA; catalog # A50101), 0.1% dimethyl sulfoxide (DMSO), and 4 mM sodium bicarbonate. Two control wells containing only assay buffer were included as blank. The fluorescence of the plate was read promptly with excitation at 560 nm and emission at 590 nm, using the FLUOstar® Omega microplate reader (BMG LABTECH, Ortenberg, Germany). The following endpoint settings were used: 10 flashes per scan point, 3 × 3 matrix scan, and 4 mm scan width. The plate was incubated in the dark at 28.5 °C for 24 h before reading the fluorescence again. The change in fluorescence was calculated after correcting for background fluorescence, and the data were normalized by setting the value of the non-injected control group to 1.

4.11. Measurement of Triglyceride, cAMP, and Leptin Levels in Larval Zebrafish Using ELISA

At 72 hpf, 30 to 40 whole zebrafish larvae from each group were pooled and homogenized as previously described. ELISA kits were purchased from Shanghai BlueGene Biotech (Shanghai, China) to measure triglyceride (catalog # E17T0018), cAMP (catalog # E17C0027), and leptin (catalog # E17L0038) levels in fish. A volume of homogenate containing 100 µg of total protein was made up in PBS to 100 µL and added to the appropriate coated well. The assay was performed as per the manufacturer’s instructions. Briefly, 100 µL of the standards and samples, assayed in duplicate, were incubated with 50 µL of conjugate for 1 h at 37 °C, followed by five manual washes. After washing, 50 µL of substrate A and 50 µL of substrate B were subsequently added to each well, and the plate was incubated for 20 min at 37 °C. Finally, 50 µL of stop solution was added to each well and the optical density was measured at 450 nm using the Multiskan Sky Microplate Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA; catalog # 1530-800840). The assays were performed three times independently.

4.12. Statistical Analysis

Statistical analyses were performed using GraphPad Prism version 9.5.1 (GraphPad Software, San Diego, CA, USA). The results were analyzed using the one-way or two-way analysis of variance (ANOVA) tests with Tukey’s multiple comparisons test. All data were presented as mean ± standard error of the mean (SEM) of measurements from at least three independent experiments. A p value of <0.05 was considered statistically significant.

5. Conclusions

Inactivating genetic and epigenetic changes in GNAS, leading to Gsα deficiency, are known to be associated with several disorders, including different variants of pseudohypoparathyroidism, which may feature severe, early-onset obesity as part of their clinical manifestations. Moreover, non-syndromic, monogenic obesity may result from such GNAS alterations. To expand our knowledge of the pathophysiology of this form of monogenic obesity, we developed the first zebrafish model of Gsα deficiency. The zebrafish gnas morphants exhibited an obese phenotype characterized by significantly increased neutral lipid content, enlarged yolk sacs, and decreased metabolic rates, in addition to reduced body lengths and delayed hatching, mimicking the early-onset obesity, reduced energy expenditure, short stature, and developmental delay associated with PHP1A. This zebrafish model will facilitate future studies aiming to enhance our understanding of Gsα-deficiency-associated early-onset obesity and its underlying mechanisms, potentially accelerating the discovery of novel targeted therapies for this form of obesity. In addition, it paves the way for efficient functional analysis of VUS and novel GNAS variants, improving diagnosis and patient care.

Author Contributions

Conceptualization, M.A.-S., Z.Z.Z. and K.H.; methodology, M.A.-S., Z.Z.Z., A.S.H. and A.A.; validation, A.S.H.; formal analysis, A.S.H. and A.A.; investigation, A.A.; resources, M.A.-A. and K.H.; writing—original draft preparation, A.A.; writing—review and editing, M.A.-S., A.S.H. and Z.Z.Z.; supervision, M.A.-S., Z.Z.Z. and A.S.H.; project administration, M.A.-S.; funding acquisition, M.A.-S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Qatar National Research Fund’s Early Career Researcher Award, grant number ECRA02–008-3-007, and the Qatar University’s Student Grant, grant number QUST-2-CHS-2022-675. The APC was funded by Qatar University (grant number QUCG-CHS-23/24-201).

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Biohazard Committee of Qatar University (protocol code: QU-IBC-2021/027; date of approval: 14 June 2021).

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Acknowledgments

We would like to acknowledge the Zebrafish Facility at the Biomedical Research Center at Qatar University and Hüseyin Yalçın, Head of the Facility, for their kind cooperation in providing the zebrafish embryos and some equipment required for this study.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Raatz, S.; Gross, A.C. Clinical Assessment and Treatment of Early-Onset Severe Obesity. Curr. Obes. Rep. 2021, 10, 31–38. [Google Scholar] [CrossRef] [PubMed]
  2. WHO. Obesity and Overweight. 2021. Available online: https://www.who.int/news-room/fact-sheets/detail/obesity-and-overweight (accessed on 5 January 2023).
  3. Farrag, N.S.; Cheskin, L.J.; Farag, M.K. A systematic review of childhood obesity in the Middle East and North Africa (MENA) region: Prevalence and risk factors meta-analysis. Adv. Pediatr. Res. 2017, 4, 8. [Google Scholar] [PubMed]
  4. Al-Thani, M.; Al-Thani, A.; Alyafei, S.; Al-Chetachi, W.; Khalifa, S.; Ahmed, A.; Ahmad, A.; Vinodson, B.; Akram, H. The prevalence and characteristics of overweight and obesity among students in Qatar. Public Health 2018, 160, 143–149. [Google Scholar] [CrossRef]
  5. Morales Camacho, W.J.; Díaz, J.M.M.; Ortiz, S.P.; Ortiz, J.E.P.; Camacho, M.A.M.; Calderón, B.P. Childhood obesity: Aetiology, comorbidities, and treatment. Diabetes/Metab. Res. Rev. 2019, 35, e3203. [Google Scholar] [CrossRef]
  6. Choquet, H.; Meyre, D. Genomic insights into early-onset obesity. Genome Med. 2010, 2, 36. [Google Scholar] [CrossRef]
  7. Loos, R.J.F.; Yeo, G.S.H. The genetics of obesity: From discovery to biology. Nat. Rev. Genet. 2022, 23, 120–133. [Google Scholar] [CrossRef] [PubMed]
  8. Huvenne, H.; Dubern, B.; Clément, K.; Poitou, C. Rare Genetic Forms of Obesity: Clinical Approach and Current Treatments in 2016. Obes. Facts 2016, 9, 158–173. [Google Scholar] [CrossRef]
  9. Niazi, R.K.; Gjesing, A.P.; Hollensted, M.; Have, C.T.; Borisevich, D.; Grarup, N.; Pedersen, O.; Ullah, A.; Shahid, G.; Shafqat, I.; et al. Screening of 31 genes involved in monogenic forms of obesity in 23 Pakistani probands with early-onset childhood obesity: A case report. BMC Med. Genet. 2019, 20, 152. [Google Scholar] [CrossRef]
  10. El Goundali, K.; Chebabe, M.; Laamiri, F.Z.; Hilali, A. The Determinants of Consanguineous Marriages among the Arab Population: A Systematic Review. Iran J. Public Health 2022, 51, 253–265. [Google Scholar] [CrossRef]
  11. Saeed, S.; Arslan, M.; Froguel, P. Genetics of Obesity in Consanguineous Populations: Toward Precision Medicine and the Discovery of Novel Obesity Genes. Obesity 2018, 26, 474–484. [Google Scholar] [CrossRef]
  12. Mohammed, I.; Haris, B.; Al-Barazenji, T.; Vasudeva, D.; Tomei, S.; Al Azwani, I.; Dauleh, H.; Shehzad, S.; Chirayath, S.; Mohamadsalih, G.; et al. Understanding the Genetics of Early-Onset Obesity in a Cohort of Children From Qatar. J. Clin. Endocrinol. Metab. 2023, 108, 3201–3213. [Google Scholar] [CrossRef] [PubMed]
  13. Weinstein, L.S.; Liu, J.; Sakamoto, A.; Xie, T.; Chen, M. Minireview: GNAS: Normal and Abnormal Functions. Endocrinology 2004, 145, 5459–5464. [Google Scholar] [CrossRef] [PubMed]
  14. Turan, S.; Bastepe, M. The GNAS Complex Locus and Human Diseases Associated with Loss-of-Function Mutations or Epimutations within This Imprinted Gene. Horm. Res. Paediatr. 2013, 80, 229–241. [Google Scholar] [CrossRef] [PubMed]
  15. Lemos, M.C.; Thakker, R.V. GNAS mutations in Pseudohypoparathyroidism type 1a and related disorders. Hum. Mutat. 2015, 36, 11–19. [Google Scholar] [CrossRef] [PubMed]
  16. Mantovani, G.; de Sanctis, L.; Barbieri, A.M.; Elli, F.M.; Bollati, V.; Vaira, V.; Labarile, P.; Bondioni, S.; Peverelli, E.; Lania, A.G.; et al. Pseudohypoparathyroidism and GNAS epigenetic defects: Clinical evaluation of albright hereditary osteodystrophy and molecular analysis in 40 patients. J. Clin. Endocrinol. Metab. 2010, 95, 651–658. [Google Scholar] [CrossRef]
  17. Chang, G.; Li, Q.; Li, N.; Li, G.; Li, J.; Ding, Y.; Huang, X.; Shen, Y.; Wang, J.; Wang, X. Evaluating the variety of GNAS inactivation disorders and their clinical manifestations in 11 Chinese children. BMC Endocr. Disord. 2022, 22, 70. [Google Scholar] [CrossRef]
  18. Mendes de Oliveira, E.; Keogh, J.M.; Talbot, F.; Henning, E.; Ahmed, R.; Perdikari, A.; Bounds, R.; Wasiluk, N.; Ayinampudi, V.; Barroso, I.; et al. Obesity-Associated GNAS Mutations and the Melanocortin Pathway. N. Engl. J. Med. 2021, 385, 1581–1592. [Google Scholar] [CrossRef]
  19. Grüters-Kieslich, A.; Reyes, M.; Sharma, A.; Demirci, C.; DeClue, T.J.; Lankes, E.; Tiosano, D.; Schnabel, D.; Jüppner, H. Early-Onset Obesity: Unrecognized First Evidence for GNAS Mutations and Methylation Changes. J. Clin. Endocrinol. Metab. 2017, 102, 2670–2677. [Google Scholar] [CrossRef]
  20. Germain-Lee, E.L.; Schwindinger, W.; Crane, J.L.; Zewdu, R.; Zweifel, L.S.; Wand, G.; Huso, D.L.; Saji, M.; Ringel, M.D.; Levine, M.A. A Mouse Model of Albright Hereditary Osteodystrophy Generated by Targeted Disruption of Exon 1 of the Gnas Gene. Endocrinology 2005, 146, 4697–4709. [Google Scholar] [CrossRef]
  21. Chen, M.; Berger, A.; Kablan, A.; Zhang, J.; Gavrilova, O.; Weinstein, L.S. Gsα Deficiency in the Paraventricular Nucleus of the Hypothalamus Partially Contributes to Obesity Associated with Gsα Mutations. Endocrinology 2012, 153, 4256–4265. [Google Scholar] [CrossRef]
  22. Chen, M.; Shrestha, Y.B.; Podyma, B.; Cui, Z.; Naglieri, B.; Sun, H.; Ho, T.; Wilson, E.A.; Li, Y.-Q.; Gavrilova, O.; et al. Gsα deficiency in the dorsomedial hypothalamus underlies obesity associated with Gsα mutations. J. Clin. Investig. 2017, 127, 500–510. [Google Scholar] [CrossRef] [PubMed]
  23. Chen, M.; Wilson, E.A.; Cui, Z.; Sun, H.; Shrestha, Y.B.; Podyma, B.; Le, C.H.; Naglieri, B.; Pacak, K.; Gavrilova, O.; et al. Gsα deficiency in the dorsomedial hypothalamus leads to obesity, hyperphagia, and reduced thermogenesis associated with impaired leptin signaling. Mol. Metab. 2019, 25, 142–153. [Google Scholar] [CrossRef] [PubMed]
  24. Perlman, R.L. Mouse models of human disease: An evolutionary perspective. Evol. Med. Public Health 2016, 2016, 170–176. [Google Scholar] [CrossRef]
  25. Gurumurthy, C.B.; Saunders, T.L.; Ohtsuka, M. Designing and generating a mouse model: Frequently asked questions. J. Biomed. Res. 2021, 35, 76–90. [Google Scholar] [CrossRef]
  26. Zang, L.; Maddison, L.A.; Chen, W. Zebrafish as a Model for Obesity and Diabetes. Front. Cell Dev. Biol. 2018, 6, 91. [Google Scholar] [CrossRef] [PubMed]
  27. Faillaci, F.; Milosa, F.; Critelli, R.M.; Turola, E.; Schepis, F.; Villa, E. Obese zebrafish: A small fish for a major human health condition. Anim. Models Exp. Med. 2018, 1, 255–265. [Google Scholar] [CrossRef]
  28. Veldman, M.B.; Lin, S. Zebrafish as a Developmental Model Organism for Pediatric Research. Pediatr. Res. 2008, 64, 470–476. [Google Scholar] [CrossRef]
  29. Howe, K.; Clark, M.D.; Torroja, C.F.; Torrance, J.; Berthelot, C.; Muffato, M.; Collins, J.E.; Humphray, S.; McLaren, K.; Matthews, L.; et al. The zebrafish reference genome sequence and its relationship to the human genome. Nature 2013, 496, 498–503. [Google Scholar] [CrossRef]
  30. Bárbara do Carmo Rodrigues, V.; André Rodrigues da Cunha Barreto, V.; Luis David Solis, M. Zebrafish as an Experimental Model for the Study of Obesity. In Zebrafish in Biomedical Research; Yusuf, B., Ed.; IntechOpen: Rijeka, Croatia, 2019; Chapter 4. [Google Scholar]
  31. Choi, T.-Y.; Choi, T.-I.; Lee, Y.-R.; Choe, S.-K.; Kim, C.-H. Zebrafish as an animal model for biomedical research. Exp. Mol. Med. 2021, 53, 310–317. [Google Scholar] [CrossRef]
  32. Farmanur Rahman, K.; Saleh Sulaiman, A. Zebrafish (Danio rerio) as a Model Organism. In Current Trends in Cancer Management; Liliana, S., Ionut, G.D., Michael, S., Eds.; IntechOpen: Rijeka, Croatia, 2018; Chapter 1. [Google Scholar]
  33. Hippe, H.-J.; Wolf, N.M.; Abu-Taha, I.; Mehringer, R.; Just, S.; Lutz, S.; Niroomand, F.; Postel, E.H.; Katus, H.A.; Rottbauer, W.; et al. The interaction of nucleoside diphosphate kinase B with Gβγ dimers controls heterotrimeric G protein function. Proc. Natl. Acad. Sci. USA 2009, 106, 16269–16274. [Google Scholar] [CrossRef]
  34. Timme-Laragy, A.R.; SKarchner, I.; Hahn, M.E. Gene knockdown by morpholino-modified oligonucleotides in the zebrafish (Danio rerio) model: Applications for developmental toxicology. Methods Mol. Biol. 2012, 889, 51–71. [Google Scholar] [PubMed]
  35. Bill, B.R.; Petzold, A.M.; Clark, K.J.; Schimmenti, L.A.; Ekker, S.C. A primer for morpholino use in zebrafish. Zebrafish 2009, 6, 69–77. [Google Scholar] [CrossRef] [PubMed]
  36. Ekker, S.C. Nonconventional antisense in zebrafish for functional genomics applications. Methods Cell Biol. 2004, 77, 121–136. [Google Scholar]
  37. Ekker, S.C.; Larson, J.D. Morphant technology in model developmental systems. Genesis 2001, 30, 89–93. [Google Scholar] [CrossRef] [PubMed]
  38. Cheng, B.; Jiang, F.; Su, M.; Zhou, L.; Zhang, H.; Cao, Z.; Liao, X.; Xiong, G.; Xiao, J.; Liu, F.; et al. Effects of lincomycin hydrochloride on the neurotoxicity of zebrafish. Ecotoxicol. Environ. Saf. 2020, 201, 110725. [Google Scholar] [CrossRef]
  39. Da’as, S.I.; Aamer, W.; Hasan, W.; Al-Maraghi, A.; Al-Kurbi, A.; Kilani, H.; AlRayahi, J.; Zamel, K.; Stotland, M.A.; Fakhro, K.A. PGAP3 Associated with Hyperphosphatasia with Mental Retardation Plays a Novel Role in Brain Morphogenesis and Neuronal Wiring at Early Development. Cells 2020, 9, 1782. [Google Scholar] [CrossRef]
  40. Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of embryonic development of the zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef]
  41. Pickart, M.A.; Klee, E.W.; Nielsen, A.L.; Sivasubbu, S.; Mendenhall, E.M.; Bill, B.R.; Chen, E.; Eckfeldt, C.E.; Knowlton, M.; Robu, M.E.; et al. Genome-Wide Reverse Genetics Framework to Identify Novel Functions of the Vertebrate Secretome. PLoS ONE 2006, 1, e104. [Google Scholar] [CrossRef]
  42. Zoupa, M.; Machera, K. Zebrafish as an Alternative Vertebrate Model for Investigating Developmental Toxicity—The Triadimefon Example. Int. J. Mol. Sci. 2017, 18, 817. [Google Scholar] [CrossRef]
  43. Imrie, D.; Sadler, K.C. White adipose tissue development in zebrafish is regulated by both developmental time and fish size. Dev. Dyn. 2010, 239, 3013–3023. [Google Scholar] [CrossRef]
  44. Fukushima, H.; Bailone, R.L.; Corrêa, T.; Janke, H.; De Aguiar, L.K.; Setti, P.G.; Borra, R.C. Zebrafish toxicological screening could aid Leishmaniosis drug discovery. Lab. Anim. Res. 2021, 37, 27. [Google Scholar] [CrossRef] [PubMed]
  45. Fraher, D.; Sanigorski, A.; Mellett, N.A.; Meikle, P.J.; Sinclair, A.J.; Gibert, Y. Zebrafish Embryonic Lipidomic Analysis Reveals that the Yolk Cell Is Metabolically Active in Processing Lipid. Cell Rep. 2016, 14, 1317–1329. [Google Scholar] [CrossRef] [PubMed]
  46. Sant, K.E.; Timme-Laragy, A.R. Zebrafish as a Model for Toxicological Perturbation of Yolk and Nutrition in the Early Embryo. Curr. Environ. Health Rep. 2018, 5, 125–133. [Google Scholar] [CrossRef] [PubMed]
  47. Shah, S.M.; Wahba, M.; Yu, L.; Achari, G.; Habibi, H.R. Health Impact Assessment of Sulfolane on Embryonic Development of Zebrafish (Danio rerio). Toxics 2019, 7, 42. [Google Scholar] [CrossRef]
  48. Renquist, B.J.; Zhang, C.; Williams, S.Y.; Cone, R.D. Development of an assay for high-throughput energy expenditure monitoring in the zebrafish. Zebrafish 2013, 10, 343–352. [Google Scholar] [CrossRef]
  49. Hsieh, Y.W.; Tsai, Y.-W.; Lai, H.-H.; Lai, C.-Y.; Lin, C.-Y.; Her, G.M. Depletion of Alpha-Melanocyte-Stimulating Hormone Induces Insatiable Appetite and Gains in Energy Reserves and Body Weight in Zebrafish. Biomedicines 2021, 9, 941. [Google Scholar] [CrossRef]
  50. Nesan, D.; Vijayan, M.M. Maternal Cortisol Mediates Hypothalamus-Pituitary-Interrenal Axis Development in Zebrafish. Sci. Rep. 2016, 6, 22582. [Google Scholar] [CrossRef]
  51. Schubert, S.; Keddig, N.; Hanel, R.; Kammann, U. Microinjection into zebrafish embryos (Danio rerio)—A useful tool in aquatic toxicity testing? Environ. Sci. Eur. 2014, 26, 32. [Google Scholar] [CrossRef]
  52. Westerfield, M. The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio), 5th ed.; University of Oregon Press: Eugene, Oregon, 2007. [Google Scholar]
  53. Basnet, R.M.; Guarienti, M.; Memo, M. Zebrafish Embryo as an In Vivo Model for Behavioral and Pharmacological Characterization of Methylxanthine Drugs. Int. J. Mol. Sci. 2017, 18, 596. [Google Scholar] [CrossRef]
  54. Lu, D.; Dong, A.; Zhang, J.; Guo, X. A novel GNAS mutation in pseudohypoparathyroidism type 1a in a Chinese man presented with recurrent seizure: A case report. BMC Endocr. Disord. 2021, 21, 12. [Google Scholar] [CrossRef]
  55. Tocher, D.R. Metabolism and Functions of Lipids and Fatty Acids in Teleost Fish. Rev. Fish. Sci. 2003, 11, 107–184. [Google Scholar] [CrossRef]
  56. Rod-In, W.; Monmai, C.; Shin, I.-S.; You, S.; Park, W.J. Neutral Lipids, Glycolipids, and Phospholipids, Isolated from Sandfish (Arctoscopus japonicus) Eggs, Exhibit Anti-Inflammatory Activity in LPS-Stimulated RAW264.7 Cells through NF-κB and MAPKs Pathways. Mar. Drugs 2020, 18, 480. [Google Scholar] [CrossRef] [PubMed]
  57. Quinlivan, V.H.; Farber, S.A. Lipid Uptake, Metabolism, and Transport in the Larval Zebrafish. Front. Endocrinol. 2017, 8, 319. [Google Scholar] [CrossRef]
  58. Lucore, E.C.; Connaughton, V.P. Observational learning and irreversible starvation in first-feeding zebrafish larvae: Is it okay to copy from your friends? Zoology 2021, 145, 125896. [Google Scholar] [CrossRef]
  59. Shoemaker, A.H.; Jüppner, H. Nonclassic features of pseudohypoparathyroidism type 1A. Curr. Opin. Endocrinol. Diabetes Obes. 2017, 24, 33–38. [Google Scholar] [CrossRef]
  60. Miyares, R.L.; de Rezende, V.B.; Farber, S.A. Zebrafish yolk lipid processing: A tractable tool for the study of vertebrate lipid transport and metabolism. Dis. Models Mech. 2014, 7, 915–927. [Google Scholar] [CrossRef] [PubMed]
  61. Liu, Q.; Dalman, M.; Chen, Y.; Akhter, M.; Brahmandam, S.; Patel, Y.; Lowe, J.; Thakkar, M.; Gregory, A.-V.; Phelps, D.; et al. Knockdown of leptin A expression dramatically alters zebrafish development. Gen. Comp. Endocrinol. 2012, 178, 562–572. [Google Scholar] [CrossRef]
  62. Wilson, L.C.; Hall, C.M. Albright’s hereditary osteodystrophy and pseudohypoparathyroidism. Semin. Musculoskelet. Radiol. 2002, 6, 273–283. [Google Scholar] [CrossRef]
  63. Simon, A.; Koppeschaar, H.P.F.; Roijers, J.F.M.; Höppener, J.W.M.; Lips, C.J.M. Pseudohypoparathyroidism type Ia. Albright hereditary osteodystrophy: A model for research on G protein-coupled receptors and genomic imprinting. Neth. J. Med. 2000, 56, 100–109. [Google Scholar] [CrossRef]
  64. Levine, M.A.; Ahn, T.G.; Klupt, S.F.; Kaufman, K.D.; Smallwood, P.M.; Bourne, H.R.; A Sullivan, K.; Van Dop, C. Genetic deficiency of the alpha subunit of the guanine nucleotide-binding protein Gs as the molecular basis for Albright hereditary osteodystrophy. Proc. Natl. Acad. Sci. USA 1988, 85, 617–621. [Google Scholar] [CrossRef]
  65. Germain-Lee, E.L. Management of pseudohypoparathyroidism. Curr. Opin. Pediatr. 2019, 31, 537–549. [Google Scholar] [CrossRef] [PubMed]
  66. Miyakawa, Y.; Takasawa, K.; Matsubara, Y.; Ihara, K.; Ohtsu, Y.; Kamasaki, H.; Kitsuda, K.; Kobayashi, H.; Satoh, M.; Sano, S.; et al. Language delay and developmental catch-up would be a clinical feature of pseudohypoparathyroidism type 1A during childhood. Endocr. J. 2019, 66, 215–221. [Google Scholar] [CrossRef]
  67. Abbas, A.; Hammad, A.S.; Al-Shafai, M. The role of genetic and epigenetic GNAS alterations in the development of early-onset obesity. Mutat. Res. /Rev. Mutat. Res. 2024, 793, 108487. [Google Scholar] [CrossRef] [PubMed]
  68. Shibata, T.; Kawakami, K.; Kawana, H.; Aoki, J.; Inoue, A. Phenotypic evaluation of constitutive GPCR/G-protein signaling in zebrafish embryos and larvae. Biochem. Biophys. Res. Commun. 2022, 602, 70–76. [Google Scholar] [CrossRef]
  69. Liu, R.; Kinoshita, M.; Adolfi, M.C.; Schartl, M. Analysis of the Role of the Mc4r System in Development, Growth, and Puberty of Medaka. Front. Endocrinol. 2019, 10, 213. [Google Scholar] [CrossRef] [PubMed]
  70. Krejszeff, S.; Żarski, D.; Palińska-Żarska, K.; Trąbska, I.; Kupren, K.; Targońska, K.; Bowszys, M.; Kucharczyk, D. Procedure for Harmless Estimation of Fish Larvae Weight. Ital. J. Anim. Sci. 2013, 12, e44. [Google Scholar] [CrossRef]
  71. Avella, M.A.; Place, A.; Du, S.-J.; Williams, E.; Silvi, S.; Zohar, Y.; Carnevali, O. Lactobacillus rhamnosus accelerates zebrafish backbone calcification and gonadal differentiation through effects on the GnRH and IGF systems. PLoS ONE 2012, 7, e45572. [Google Scholar] [CrossRef]
  72. Czopka, T.; Lyons, D.A. Chapter 2—Dissecting Mechanisms of Myelinated Axon Formation Using Zebrafish. In Methods in Cell Biology; Detrich, H.W., Westerfield, M., Zon, L.I., Eds.; Academic Press: Cambridge, MA, USA, 2011; pp. 25–62. [Google Scholar]
  73. Linglart, A.; Levine, M.A.; Jüppner, H. Pseudohypoparathyroidism. Endocrinol. Metab. Clin. N. Am. 2018, 47, 865–888. [Google Scholar] [CrossRef]
  74. Moulton, J.D. Making a Morpholino Experiment Work: Controls, Favoring Specificity, Improving Efficacy, Storage, and Dose. In Morpholino Oligomers: Methods and Protocols; Moulton, H.M., Moulton, J.D., Eds.; Springer: New York, NY, USA, 2017; pp. 17–29. [Google Scholar]
  75. Yoganantharjah, P.; Byreddy, A.R.; Fraher, D.; Puri, M.; Gibert, Y. Rapid quantification of neutral lipids and triglycerides during zebrafish embryogenesis. Int. J. Dev. Biol. 2017, 61, 105–111. [Google Scholar] [CrossRef]
  76. Choe, C.P.; Choi, S.-Y.; Kee, Y.; Kim, M.J.; Kim, S.-H.; Lee, Y.; Park, H.-C. Transgenic fluorescent zebrafish lines that have revolutionized biomedical research. Lab. Anim. Res. 2021, 37, 26. [Google Scholar] [CrossRef]
  77. Gao, F.; Yang, S.; Wang, J.; Zhu, G. cAMP-PKA cascade: An outdated topic for depression? Biomed. Pharmacother. 2022, 150, 113030. [Google Scholar] [CrossRef] [PubMed]
  78. Jüppner, H. Obesity and Gαs Variants. N. Engl. J. Med. 2021, 385, 1619–1622. [Google Scholar] [CrossRef] [PubMed]
  79. Niederriter, A.R.; Davis, E.E.; Golzio, C.; Oh, E.C.; Tsai, I.C.; Katsanis, N. In vivo modeling of the morbid human genome using Danio rerio. J. Vis. Exp. 2013, e50338. [Google Scholar]
  80. Moulton, J.D.; Yan, Y.L. Using Morpholinos to control gene expression. Curr. Protoc. Mol. Biol. 2008, 83, 26.8.1–26.8.29. [Google Scholar] [CrossRef]
  81. Al-Jamal, O.; Al-Jighefee, H.; Younes, N.; Abdin, R.; Al-Asmakh, M.A.; Radwan, A.B.; Sliem, M.H.; Majdalawieh, A.F.; Pintus, G.; Yassine, H.M.; et al. Organ-specific toxicity evaluation of stearamidopropyl dimethylamine (SAPDMA) surfactant using zebrafish embryos. Sci. Total Environ. 2020, 741, 140450. [Google Scholar] [CrossRef]
Figure 1. Western blot analysis of the temporal expression pattern of the short Gαs isoform (GαsS) in whole wild-type zebrafish from 24 to 96 h post-fertilization (hpf). (a) Representative blot of the GαsS expression level using GAPDH as a loading control. Whole zebrafish tissue lysates were used to extract total protein (~40 µg loaded per well). (b) The band intensities were quantified using ImageJ software, followed by normalization of the GαsS band intensity to that of GAPDH, yielding the relative GαsS expression level in arbitrary units. One-way ANOVA followed by Tukey’s multiple comparisons test were performed (* p < 0.05). Each bar represents the mean ± SEM (n = 3).
Figure 1. Western blot analysis of the temporal expression pattern of the short Gαs isoform (GαsS) in whole wild-type zebrafish from 24 to 96 h post-fertilization (hpf). (a) Representative blot of the GαsS expression level using GAPDH as a loading control. Whole zebrafish tissue lysates were used to extract total protein (~40 µg loaded per well). (b) The band intensities were quantified using ImageJ software, followed by normalization of the GαsS band intensity to that of GAPDH, yielding the relative GαsS expression level in arbitrary units. One-way ANOVA followed by Tukey’s multiple comparisons test were performed (* p < 0.05). Each bar represents the mean ± SEM (n = 3).
Ijms 25 12674 g001
Figure 2. Western blot analysis of the knockdown efficiency of the three gnas Morpholino (MO) doses at 48 hpf. (a) Representative blot of the GαsS expression level in non-injected control (UI Ctrl) and standard control (Std Ctrl) embryos compared to those injected with 1, 3, and 5 ng of gnas MOs. The Std Ctrl embryos were injected with 5 ng of Std Ctrl MO. Whole zebrafish tissue lysates were used to extract total protein (~40 µg loaded per well) and GAPDH served as a loading control. (b) The band intensities were quantified using ImageJ software, followed by normalization of the GαsS band intensity to that of GAPDH. The GαsS expression level was expressed as a percentage of that in the UI Ctrl embryos. One-way ANOVA followed by Tukey’s multiple comparisons test were performed (**** p < 0.0001). Each bar represents the mean ± SEM (n = 4).
Figure 2. Western blot analysis of the knockdown efficiency of the three gnas Morpholino (MO) doses at 48 hpf. (a) Representative blot of the GαsS expression level in non-injected control (UI Ctrl) and standard control (Std Ctrl) embryos compared to those injected with 1, 3, and 5 ng of gnas MOs. The Std Ctrl embryos were injected with 5 ng of Std Ctrl MO. Whole zebrafish tissue lysates were used to extract total protein (~40 µg loaded per well) and GAPDH served as a loading control. (b) The band intensities were quantified using ImageJ software, followed by normalization of the GαsS band intensity to that of GAPDH. The GαsS expression level was expressed as a percentage of that in the UI Ctrl embryos. One-way ANOVA followed by Tukey’s multiple comparisons test were performed (**** p < 0.0001). Each bar represents the mean ± SEM (n = 4).
Ijms 25 12674 g002
Figure 3. The survival rates at 24 and 48 hpf of the zebrafish embryos (n ≈ 20 per group) injected with 5 ng of Std Ctrl MO or different doses (1, 3, or 5 ng) of gnas MOs. The survival rates were normalized to those of the non-injected controls (UI Ctrl). Two-way ANOVA and Tukey’s post hoc test were performed, indicating no significant differences between the survival rates at either timepoints. Each bar represents the mean ± SEM (n = 4).
Figure 3. The survival rates at 24 and 48 hpf of the zebrafish embryos (n ≈ 20 per group) injected with 5 ng of Std Ctrl MO or different doses (1, 3, or 5 ng) of gnas MOs. The survival rates were normalized to those of the non-injected controls (UI Ctrl). Two-way ANOVA and Tukey’s post hoc test were performed, indicating no significant differences between the survival rates at either timepoints. Each bar represents the mean ± SEM (n = 4).
Ijms 25 12674 g003
Figure 4. The rate of tail flicks at 24 hpf of the zebrafish embryos (n ≈ 10 per group) injected with 5 ng of Std Ctrl MO or different doses (1, 3, or 5 ng) of gnas MOs, compared to non-injected controls (UI Ctrl). The frequency of this spontaneous movement was measured by the DanioScope software as the mean burst count per minute. One-way ANOVA and Tukey’s multiple comparisons test were performed, indicating no significant differences between the mean tail-flicking rates. Each bar represents the mean ± SEM (n = 4).
Figure 4. The rate of tail flicks at 24 hpf of the zebrafish embryos (n ≈ 10 per group) injected with 5 ng of Std Ctrl MO or different doses (1, 3, or 5 ng) of gnas MOs, compared to non-injected controls (UI Ctrl). The frequency of this spontaneous movement was measured by the DanioScope software as the mean burst count per minute. One-way ANOVA and Tukey’s multiple comparisons test were performed, indicating no significant differences between the mean tail-flicking rates. Each bar represents the mean ± SEM (n = 4).
Ijms 25 12674 g004
Figure 5. The hatching rates at 48 hpf of the zebrafish embryos (n ≈ 20 per group) injected with 5 ng of Std Ctrl MO or different doses (1, 3, or 5 ng) of gnas MOs, compared to non-injected controls (UI Ctrl). One-way ANOVA and Tukey’s multiple comparisons test were performed, indicating no significant differences between the mean hatching rates. Each bar represents the mean ± SEM (n = 4).
Figure 5. The hatching rates at 48 hpf of the zebrafish embryos (n ≈ 20 per group) injected with 5 ng of Std Ctrl MO or different doses (1, 3, or 5 ng) of gnas MOs, compared to non-injected controls (UI Ctrl). One-way ANOVA and Tukey’s multiple comparisons test were performed, indicating no significant differences between the mean hatching rates. Each bar represents the mean ± SEM (n = 4).
Ijms 25 12674 g005
Figure 6. Quantification of the Oil Red O staining at 120 hpf of whole zebrafish larvae (n ≈ 20 per group) injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs. Staining was quantified by the absorbance of the extracted stain at 495 nm and normalized to that of non-injected controls (UI Ctrl). One-way ANOVA and Tukey’s multiple comparisons test were performed (* p < 0.05 and ** p < 0.01). Each bar represents the mean ± SEM (n = 5).
Figure 6. Quantification of the Oil Red O staining at 120 hpf of whole zebrafish larvae (n ≈ 20 per group) injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs. Staining was quantified by the absorbance of the extracted stain at 495 nm and normalized to that of non-injected controls (UI Ctrl). One-way ANOVA and Tukey’s multiple comparisons test were performed (* p < 0.05 and ** p < 0.01). Each bar represents the mean ± SEM (n = 5).
Ijms 25 12674 g006
Figure 7. Yolk sac areas of zebrafish larvae (n = 10 per group), at 72 and 120 hpf, injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs, compared to those of non-injected controls (UI Ctrl). Two-way ANOVA and Tukey’s multiple comparisons test were performed, indicating significant increases in yolk size of gnas morphants at 120 hpf compared to non-injected controls (* p < 0.05). Each bar represents the mean ± SEM (n = 3).
Figure 7. Yolk sac areas of zebrafish larvae (n = 10 per group), at 72 and 120 hpf, injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs, compared to those of non-injected controls (UI Ctrl). Two-way ANOVA and Tukey’s multiple comparisons test were performed, indicating significant increases in yolk size of gnas morphants at 120 hpf compared to non-injected controls (* p < 0.05). Each bar represents the mean ± SEM (n = 3).
Ijms 25 12674 g007
Figure 8. Relative change in fluorescence after incubation in alamarBlueTM assay buffer of zebrafish larvae injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs, normalized to that of non-injected controls (UI Ctrl). The larvae (n ≈ 12 per group) were incubated from 72 to 96 hpf. One-way ANOVA and Tukey’s multiple comparisons test were performed (** p < 0.01). Each bar represents the mean ± SEM (n = 4).
Figure 8. Relative change in fluorescence after incubation in alamarBlueTM assay buffer of zebrafish larvae injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs, normalized to that of non-injected controls (UI Ctrl). The larvae (n ≈ 12 per group) were incubated from 72 to 96 hpf. One-way ANOVA and Tukey’s multiple comparisons test were performed (** p < 0.01). Each bar represents the mean ± SEM (n = 4).
Ijms 25 12674 g008
Figure 9. The mean body lengths of zebrafish larvae (n = 10 per group), at 72 and 120 hpf, injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs, compared to those of non-injected controls (UI Ctrl). Two-way ANOVA and Tukey’s multiple comparisons test were performed, indicating no significant differences. Each bar represents the mean ± SEM (n = 3).
Figure 9. The mean body lengths of zebrafish larvae (n = 10 per group), at 72 and 120 hpf, injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs, compared to those of non-injected controls (UI Ctrl). Two-way ANOVA and Tukey’s multiple comparisons test were performed, indicating no significant differences. Each bar represents the mean ± SEM (n = 3).
Ijms 25 12674 g009
Figure 10. Representative images of the lateral views of standard control and gnas (3 and 5 ng) morphants at 120 hpf. Spine curvature and yolk sac enlargement of the gnas morphants are indicated by arrows and arrowheads, respectively. The images were captured at 20× magnification following straightening of the larvae in methylcellulose as much as possible.
Figure 10. Representative images of the lateral views of standard control and gnas (3 and 5 ng) morphants at 120 hpf. Spine curvature and yolk sac enlargement of the gnas morphants are indicated by arrows and arrowheads, respectively. The images were captured at 20× magnification following straightening of the larvae in methylcellulose as much as possible.
Ijms 25 12674 g010
Figure 11. The mean larval masses of zebrafish larvae (n ≈ 20 per group), at 120 hpf, injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs, compared to those of non-injected controls (UI Ctrl). One-way ANOVA and Tukey’s multiple comparisons test were performed, indicating no significant differences. Each bar represents the mean ± SEM (n = 3).
Figure 11. The mean larval masses of zebrafish larvae (n ≈ 20 per group), at 120 hpf, injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs, compared to those of non-injected controls (UI Ctrl). One-way ANOVA and Tukey’s multiple comparisons test were performed, indicating no significant differences. Each bar represents the mean ± SEM (n = 3).
Ijms 25 12674 g011
Figure 12. Hatching rates at 72 hpf of zebrafish larvae (n ≈ 25 per group) injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs, compared to those of non-injected controls (UI Ctrl). One-way ANOVA and Tukey’s multiple comparisons test were performed, indicating no significant differences. Each bar represents the mean ± SEM (n = 3).
Figure 12. Hatching rates at 72 hpf of zebrafish larvae (n ≈ 25 per group) injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs, compared to those of non-injected controls (UI Ctrl). One-way ANOVA and Tukey’s multiple comparisons test were performed, indicating no significant differences. Each bar represents the mean ± SEM (n = 3).
Ijms 25 12674 g012
Figure 13. Concentrations of different molecules in whole zebrafish larvae at 72 hpf, determined by ELISA. (a) Triglyceride, (b) leptin, and (c) cAMP levels in larvae (n ≈ 35 per group) injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs, relative to those of non-injected controls (UI Ctrl). One-way ANOVA and Tukey’s multiple comparisons test were performed, indicating no significant differences. Each bar represents the mean ± SEM (n = 3).
Figure 13. Concentrations of different molecules in whole zebrafish larvae at 72 hpf, determined by ELISA. (a) Triglyceride, (b) leptin, and (c) cAMP levels in larvae (n ≈ 35 per group) injected with 5 ng of Std Ctrl MO or two doses (3 or 5 ng) of gnas MOs, relative to those of non-injected controls (UI Ctrl). One-way ANOVA and Tukey’s multiple comparisons test were performed, indicating no significant differences. Each bar represents the mean ± SEM (n = 3).
Ijms 25 12674 g013
Table 1. Morpholino oligomer (MO) sequences and their target mRNA transcripts in zebrafish.
Table 1. Morpholino oligomer (MO) sequences and their target mRNA transcripts in zebrafish.
MO NameMO SequenceTarget mRNA Transcript 1
gnas-MO1ACCAATGCTTGCTGTTTAACATCCGXM_001335696.6
gnas-MO2TCTTACTGTTGCCCAAACAACCCATXM_005172124.4
Standard ControlCCTCTTACCTCAGTTACAATTTATAN/A
1 The NCBI RefSeq accession numbers for the mRNA transcripts are provided.
Table 2. Compositions of the MO working solutions.
Table 2. Compositions of the MO working solutions.
Working SolutionFinal MO Concentration in Injection Volume (mM) *Volume of MO Stock Solution
(µL)
Volume of Sterile MQ Water (µL)Volume of 0.5% (w/v) Phenol Red (µL)
Expt MOs
(1 ng)
0.0260.13 (gnas-MO1)7.742
0.13 (gnas-MO2)
Expt MOs
(3 ng)
0.0780.39 (gnas-MO1)7.222
0.39 (gnas-MO2)
Expt MOs
(5 ng)
0.130.65 (gnas-MO1)6.702
0.65 (gnas-MO2)
Std Ctrl MO
(5 ng)
0.131.31 (Std Ctrl)6.692
* The molar masses of gnas-MO1, gnas-MO2, and Std Ctrl MOs (as indicated by Gene Tools) were 8394.04, 8323.01, and 8328 g/mol, respectively. The average molar masses of gnas-MO1 and gnas-MO2 were used for the calculations. Expt, experimental.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Abbas, A.; Hammad, A.S.; Zakaria, Z.Z.; Al-Asmakh, M.; Hussain, K.; Al-Shafai, M. gnas Knockdown Induces Obesity and AHO Features in Early Zebrafish Larvae. Int. J. Mol. Sci. 2024, 25, 12674. https://doi.org/10.3390/ijms252312674

AMA Style

Abbas A, Hammad AS, Zakaria ZZ, Al-Asmakh M, Hussain K, Al-Shafai M. gnas Knockdown Induces Obesity and AHO Features in Early Zebrafish Larvae. International Journal of Molecular Sciences. 2024; 25(23):12674. https://doi.org/10.3390/ijms252312674

Chicago/Turabian Style

Abbas, Alaa, Ayat S Hammad, Zain Z. Zakaria, Maha Al-Asmakh, Khalid Hussain, and Mashael Al-Shafai. 2024. "gnas Knockdown Induces Obesity and AHO Features in Early Zebrafish Larvae" International Journal of Molecular Sciences 25, no. 23: 12674. https://doi.org/10.3390/ijms252312674

APA Style

Abbas, A., Hammad, A. S., Zakaria, Z. Z., Al-Asmakh, M., Hussain, K., & Al-Shafai, M. (2024). gnas Knockdown Induces Obesity and AHO Features in Early Zebrafish Larvae. International Journal of Molecular Sciences, 25(23), 12674. https://doi.org/10.3390/ijms252312674

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop