Irisin and Metastatic Melanoma: Selective Anti-Invasiveness Activity in BRAF Wild-Type Cells
Abstract
:1. Introduction
2. Results
2.1. Effect of Irisin on Metastatic Melanoma Cell Viability
2.2. Irisin Reduced Invasion in LND1wt/wt Melanoma Cells
2.3. Alpha-V Integrin Expression in Metastatic Melanoma Cells
2.4. Irisin Impairs the Expression of uPA/uPAR System
2.5. Irisin Modulates the Expression of the Gelatinase System
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Irisin Treatment
4.2. MTT-Assay
4.3. Chemio-Invasion Assay
4.4. Quantitative Reverse Transcription–Polymerase Chain Reaction (RT-PCR) Analysis
4.5. Gelatin Zymography
4.6. Western Blot
4.7. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ohtaki, H. Chapter 37—Irisin. In Handbook of Hormones; Academic Press: Cambridge, MA, USA, 2016; pp. 329–330. [Google Scholar] [CrossRef]
- Kim, H.; Wrann, C.D.; Jedrychowski, M.; Rosen, C.J.; Bonewald, L.F.; Spiegelman, B.M.; Kim, H.; Wrann, C.D.; Jedrychowski, M.; Vidoni, S.; et al. Irisin Mediates Effects on Bone and Fat via a V Integrin Receptors Article Irisin Mediates Effects on Bone and Fat via a V Integrin Receptors. Cell 2018, 175, 1756–1768.e17. [Google Scholar] [CrossRef]
- Wei, S.; Bi, J.; Yang, L.; Zhang, J.; Wan, Y.; Chen, X.; Wang, Y.; Wu, Z.; Lv, Y.; Wu, R. Serum irisin levels are decreased in patients with sepsis, and exogenous irisin suppresses ferroptosis in the liver of septic mice. Clin. Transl. Med. 2020, 10, e173. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.; Carman, C.V.; Springer, T.A. Bidirectional transmembrane signaling by cytoplasmic domain separation in integrins. Science 2003, 301, 1720–1725. [Google Scholar] [CrossRef] [PubMed]
- Pedersen, B.K.; Brandt, C. The role of exercise-induced myokines in muscle homeostasis and the defense against chronic diseases. J. Biomed. Biotechnol. 2010, 2010, 520258. [Google Scholar] [CrossRef]
- Boström, P.; Wu, J.; Jedrychowski, M.P.; Korde, A.; Ye, L.; Lo, J.C.; Rasbach, K.A.; Boström, E.A.; Choi, J.H.; Long, J.Z.; et al. A PGC1-α-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature 2012, 481, 463–468. [Google Scholar] [CrossRef]
- Do, D.V.; Park, S.Y.; Nguyen, G.T.; Choi, D.H.; Cho, E.H. The Effects of Irisin on the Interaction between Hepatic Stellate Cell and Macrophage in Liver Fibrosis. Endocrinol. Metab. 2022, 37, 620–629. [Google Scholar] [CrossRef] [PubMed]
- Delezie, J.; Handschin, C. Endocrine crosstalk between Skeletal muscle and the brain. Front. Neurol. 2018, 9, 968. [Google Scholar] [CrossRef] [PubMed]
- Severinsen, M.C.K.; Pedersen, B.K. Muscle–Organ Crosstalk: The Emerging Roles of Myokines. Endocr. Rev. 2020, 41, 594–609. [Google Scholar] [CrossRef] [PubMed]
- Ma, C.; Ding, H.; Deng, Y.; Liu, H.; Xiong, X.; Yang, Y. Irisin: A New Code Uncover the Relationship of Skeletal Muscle and Cardiovascular Health During Exercise. Front. Physiol. 2021, 12, 620608. [Google Scholar] [CrossRef]
- Perakakis, N.; Triantafyllou, G.A.; Fernández-Real, J.M.; Huh, J.Y.; Park, K.H.; Seufert, J.; Mantzoros, C.S. Physiology and role of irisin in glucose homeostasis. Nat. Rev. Endocrinol. 2017, 13, 324–337. [Google Scholar] [CrossRef] [PubMed]
- Gannon, N.P.; Vaughan, R.A.; Garcia-Smith, R.; Bisoffi, M.; Trujillo, K.A. Effects of the exercise-inducible myokine irisin on malignant and non-malignant breast epithelial cell behavior in vitro. Int. J. Cancer 2015, 136, E197–E202. [Google Scholar] [CrossRef] [PubMed]
- Shao, L.; Li, H.; Chen, J.; Song, H.; Zhang, Y.; Wu, F.; Wang, W.; Zhang, W.; Wang, F.; Li, H.; et al. Irisin suppresses the migration, proliferation, and invasion of lung cancer cells via inhibition of epithelial-to-mesenchymal transition. Biochem. Biophys. Res. Commun. 2017, 485, 598–605. [Google Scholar] [CrossRef]
- Saeedi Sadr, A.; Ehteram, H.; Seyed Hosseini, E.; Alizadeh Zarei, M.; Hassani Bafrani, H.; Haddad Kashani, H. The Effect of Irisin on Proliferation, Apoptosis, and Expression of Metastasis Markers in Prostate Cancer Cell Lines. Oncol. Ther. 2022, 10, 377–388. [Google Scholar] [CrossRef] [PubMed]
- Kong, G.; Jiang, Y.; Sun, X.; Cao, Z.; Zhang, G.; Zhao, Z.; Zhao, Y.; Yu, Q.; Cheng, G. Irisin reverses the IL-6 induced epithelial-mesenchymal transition in osteosarcoma cell migration and invasion through the STAT3/Snail signaling pathway. Oncol. Rep. 2017, 38, 2647–2656. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Song, N.; Huang, Y.; Chen, Y. Irisin inhibits pancreatic cancer cell growth via the AMPK-mTOR pathway. Sci. Rep. 2018, 8, 15247. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Zhang, P.; Li, L.; Tang, N.; Huang, F.; Kong, X.; Tan, X.; Shi, G. Irisin functions to inhibit malignant growth of human pancreatic cancer cells via downregulation of the PI3K/AKT signaling pathway. Onco. Targets. Ther. 2019, 12, 7243–7249. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.W.; Chang, Y.H.; Lee, H.H.; Wu, J.Y.; Huang, J.X.; Chung, Y.H.; Hsu, S.T.; Chow, L.P.; Wei, K.C.; Huang, F.T. Irisin, an exercise myokine, potently suppresses tumor proliferation, invasion, and growth in glioma. FASEB J. 2020, 34, 9678–9693. [Google Scholar] [CrossRef] [PubMed]
- Moon, H.S.; Mantzoros, C.S. Regulation of cell proliferation and malignant potential by irisin in endometrial, colon, thyroid and esophageal cancer cell lines. Metabolism 2014, 63, 188–193. [Google Scholar] [CrossRef]
- Tsiani, E.; Tsakiridis, N.; Kouvelioti, R.; Jaglanian, A.; Klentrou, P. Current evidence of the role of the myokine irisin in cancer. Cancers 2021, 13, 2628. [Google Scholar] [CrossRef]
- Scatena, C.; Murtas, D.; Tomei, S. Cutaneous Melanoma Classification: The Importance of High-Throughput Genomic Technologies. Front. Oncol. 2021, 11, 635488. [Google Scholar] [CrossRef]
- Garnett, M.J.; Marais, R. Guilty as charged: B-RAF is a human oncogene. Cancer Cell 2004, 6, 313–319. [Google Scholar] [CrossRef] [PubMed]
- Long, G.V.; Menzies, A.M.; Nagrial, A.M.; Haydu, L.E.; Hamilton, A.L.; Mann, G.J.; Hughes, T.M.; Thompson, J.F.; Scolyer, R.A.; Kefford, R.F. Prognostic and clinicopathologic associations of oncogenic BRAF in metastatic melanoma. J. Clin. Oncol. 2011, 29, 1239–1246. [Google Scholar] [CrossRef]
- Falletta, P.; Sanchez-del-Campo, L.; Chauhan, J.; Effern, M.; Kenyon, A.; Kershaw, C.J.; Siddaway, R.; Lisle, R.; Freter, R.; Daniels, M.J.; et al. Translation reprogramming is an evolutionarily conserved driver of phenotypic plasticity and therapeutic resistance in melanoma. Genes Dev. 2017, 31, 18–33. [Google Scholar] [CrossRef]
- Ferretta, A.; Maida, I.; Guida, S.; Azzariti, A.; Porcelli, L.; Tommasi, S.; Zanna, P.; Cocco, T.; Guida, M.; Guida, G. New insight into the role of metabolic reprogramming in melanoma cells harboring BRAF mutations. Biochim. Biophys. Acta Mol. Cell Res. 2016, 1863, 2710–2718. [Google Scholar] [CrossRef] [PubMed]
- Fischer, G.M.; Vashisht Gopal, Y.N.; McQuade, J.L.; Peng, W.; DeBerardinis, R.J.; Davies, M.A. Metabolic strategies of melanoma cells: Mechanisms, interactions with the tumor microenvironment, and therapeutic implications. Pigment Cell Melanoma Res. 2018, 31, 11–30. [Google Scholar] [CrossRef]
- Poltavets, V.; Kochetkova, M.; Pitson, S.M.; Samuel, M.S. The role of the extracellular matrix and its molecular and cellular regulators in cancer cell plasticity. Front. Oncol. 2018, 8, 431. [Google Scholar] [CrossRef]
- Watt, F.M.; Fujiwara, H. Cell-extracellular matrix interactions in normal and diseased skin. Cold Spring Harb. Perspect. Biol. 2011, 3, a005124. [Google Scholar] [CrossRef]
- Xue, M.; Jackson, C.J. Extracellular Matrix Reorganization During Wound Healing and Its Impact on Abnormal Scarring. Adv. Wound Care 2015, 4, 119–136. [Google Scholar] [CrossRef] [PubMed]
- Gkretsi, V.; Stylianopoulos, T. Cell adhesion and matrix stiffness: Coordinating cancer cell invasion and metastasis. Front. Oncol. 2018, 8, 145. [Google Scholar] [CrossRef] [PubMed]
- Jinka, R.; Kapoor, R.; Sistla, P.G.; Raj, T.A.; Pande, G. Alterations in cell-extracellular matrix interactions during progression of cancers. Int. J. Cell Biol. 2012, 2012, 219196. [Google Scholar] [CrossRef] [PubMed]
- Napoli, S.; Scuderi, C.; Gattuso, G.; Di Bella, V.; Candido, S.; Basile, M.S.; Libra, M.; Falzone, L. Functional Roles of Matrix Metalloproteinases and Their Inhibitors in Melanoma. Cells 2020, 9, 1151. [Google Scholar] [CrossRef] [PubMed]
- O’Halloran, T.V.; Ahn, R.; Hankins, P.; Swindell, E.; Mazar, A.P. The many spaces of uPAR: Delivery of theranostic agents and nanobins to multiple tumor compartments through a single target. Theranostics 2013, 3, 496–506. [Google Scholar] [CrossRef] [PubMed]
- Roth, D.; Piekarek, M.; Paulsson, M.; Christ, H.; Krieg, T.; Bloch, W.; Davidson, J.M.; Eming, S.A. Plasmin modulates vascular endothelial growth factor-A-mediated angiogenesis during wound repair. Am. J. Pathol. 2006, 168, 670–684. [Google Scholar] [CrossRef] [PubMed]
- Salemi, R.; Falzone, L.; Madonna, G.; Polesel, J.; Cinà, D.; Mallardo, D.; Ascierto, P.A.; Libra, M.; Candido, S. MMP-9 as a candidate marker of response to BRAF inhibitors in melanoma patients with BRAFV600E mutation detected in circulating-free DNA. Front. Pharmacol. 2018, 9, 856. [Google Scholar] [CrossRef] [PubMed]
- Leonardi, G.C.; Falzone, L.; Salemi, R.; Zanghì, A.; Spandidos, D.A.; Mccubrey, J.A.; Candido, S.; Libra, M. Cutaneous melanoma: From pathogenesis to therapy (Review). Int. J. Oncol. 2018, 52, 1071–1080. [Google Scholar] [CrossRef] [PubMed]
- Colaianni, G.; Mongelli, T.; Cuscito, C.; Pignataro, P.; Lippo, L.; Spiro, G.; Notarnicola, A.; Severi, I.; Passeri, G.; Mori, G.; et al. Irisin prevents and restores bone loss and muscle atrophy in hind-limb suspended mice. Sci. Rep. 2017, 7, 2811. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, R.; Meng, Y.; Li, S.; Donelan, W.; Zhao, Y.; Qi, L.; Zhang, M.; Wang, X.; Cui, T.; et al. Irisin stimulates browning of white adipocytes through mitogen-activated protein kinase p38 MAP kinase and ERK MAP kinase signaling. Diabetes 2014, 63, 514–525. [Google Scholar] [CrossRef] [PubMed]
- Singhal, V.; Lawson, E.A.; Ackerman, K.E.; Fazeli, P.K.; Clarke, H.; Lee, H.; Eddy, K.; Marengi, D.A.; Derrico, N.P.; Bouxsein, M.L.; et al. Irisin levels are lower in young amenorrheic athletes compared with eumenorrheic athletes and non-athletes and are associated with bone density and strength estimates. PLoS ONE 2014, 9, e100218. [Google Scholar] [CrossRef]
- Colaianni, G.; Cuscito, C.; Mongelli, T.; Oranger, A.; Mori, G.; Brunetti, G.; Colucci, S.; Cinti, S.; Grano, M. Irisin enhances osteoblast differentiation in vitro. Int. J. Endocrinol. 2014, 2014, 902186. [Google Scholar] [CrossRef] [PubMed]
- Colaianni, G.; Cuscito, C.; Mongelli, T.; Pignataro, P.; Buccoliero, C.; Liu, P.; Lu, P.; Sartini, L.; Comite, M.D.; Mori, G.; et al. The myokine irisin increases cortical bone mass. Proc. Natl. Acad. Sci. USA 2015, 112, 12157–12162. [Google Scholar] [CrossRef]
- Gladson, C.L.; Cheresh, D.A. Glioblastoma expression of vitronectin and the αvβ3 integrin: Adhesion mechanism for transformed glial cells. J. Clin. Investig. 1991, 88, 1924–1932. [Google Scholar] [CrossRef] [PubMed]
- Arias-Mejias, S.M.; Warda, K.Y.; Quattrocchi, E.; Alonso-Quinones, H.; Sominidi-Damodaran, S.; Meves, A. The role of integrins in melanoma: A review. Int. J. Dermatol. 2020, 59, 525–534. [Google Scholar] [CrossRef] [PubMed]
- Geiger, B.; Bershadsky, A.; Pankov, R.; Yamada, K.M. Transmembrane crosstalk between the extracellular matrix and the cytoskeleton. Nat. Rev. Mol. Cell Biol. 2001, 2, 793–805. [Google Scholar] [CrossRef] [PubMed]
- Kechagia, J.Z.; Ivaska, J.; Roca-Cusachs, P. Integrins as biomechanical sensors of the microenvironment. Nat. Rev. Mol. Cell Biol. 2019, 20, 457–473. [Google Scholar] [CrossRef]
- Nip, J.; Shibata, H.; Loskutoff, D.J.; Cheresh, D.A.; Brodt, P. Human melanoma cells derived from lymphatic metastases use integrin αvβ3 to adhere to lymph node vitronectin. J. Clin. Investig. 1992, 90, 1406–1413. [Google Scholar] [CrossRef] [PubMed]
- Nip, J.; Rabbani, S.A.; Shibata, H.R.; Brodt, P. Coordinated expression of the vitronectin receptor and the urokinase-type plasminogen activator receptor in metastatic melanoma cells. J. Clin. Investig. 1995, 95, 2096–2103. [Google Scholar] [CrossRef]
- Stojanovic, N.; Dekanic, A.; Paradžik, M.; Majhen, D.; Ferenčak, K.; Ruščic, J.; Bardak, I.; Supina, C.; Tomicic, M.T.; Christmann, M.; et al. Differential effects of integrin av knockdown and cilengitide on sensitization of triple-negative breast cancer and melanoma cells to microtubule poisons. Mol. Pharmacol. 2018, 94, 1334–1351. [Google Scholar] [CrossRef] [PubMed]
- Albelda, S.M.; Mette, S.A.; Elder, D.E.; Stewart, R.M.; Damjanovich, L.; Herlyn, M.; Buck, C.A. Integrin Distribution in Malignant Melanoma: Association of the β3 Subunit with Tumor Progression. Cancer Res. 1990, 50, 6757–6764. [Google Scholar] [PubMed]
- Guo, D.Y.; Chen, Z.H.; Fu, Y.F.; Li, Y.Y.; Chen, M.N.; Wu, J.J.; Yuan, Z.D.; Ye, J.X.; Li, X.; Yuan, F.L. Cilengitide inhibits osteoclast adhesion through blocking the αvβ3-mediated FAK/Src signaling pathway. Heliyon 2023, 9, e17841. [Google Scholar] [CrossRef] [PubMed]
- Ruffini, F.; Graziani, G.; Levati, L.; Tentori, L.; D’Atri, S.; Lacal, P.M. Cilengitide downmodulates invasiveness and vasculogenic mimicry of neuropilin 1 expressing melanoma cells through the inhibition of αvβ5 integrin. Int. J. Cancer 2015, 136, E545–E558. [Google Scholar] [CrossRef] [PubMed]
- Novelle, M.G.; Contreras, C.; Romero-Picó, A.; López, M.; Diéguez, C. Irisin, two years later. Int. J. Endocrinol. 2013, 2013, 746281. [Google Scholar] [CrossRef]
- Zanna, P.; Maida, I.; Grieco, C.; Guida, S.; Turpin Sevilla, M.C.; De Summa, S.; Tommasi, S.; Vena, G.A.; Filotico, R.; Guida, G. Three novel human sporadic melanoma cell lines: Signaling pathways controlled by MC1R, BRAF and β-catenins. J. Biol. Regul. Homeost. Agents 2013, 27, 131–141. [Google Scholar] [PubMed]
- Zanna, P.; Maida, I.; Turpin Sevilla, M.C.; Susca, F.C.; Filotico, R.; Arciuli, M.; Cassano, N.; Vena, G.A.; Cicero, R.; Guida, G. Molecular characterization of novel melanoma cell lines. J. Biol. Regul. Homeost. Agents 2011, 25, 239–247. [Google Scholar] [PubMed]
- Ciavarella, S.; Laurenzana, A.; De Summa, S.; Pilato, B.; Chillà, A.; Lacalamita, R.; Minoia, C.; Margheri, F.; Iacobazzi, A.; Rana, A.; et al. u-PAR expression in cancer associated fibroblast: New acquisitions in multiple myeloma progression. BMC Cancer 2017, 17, 215. [Google Scholar] [CrossRef] [PubMed]
- Serratì, S.; Porcelli, L.; Fragassi, F.; Garofoli, M.; Di Fonte, R.; Fucci, L.; Iacobazzi, R.M.; Palazzo, A.; Margheri, F.; Cristiani, G.; et al. The interaction between reactive peritoneal mesothelial cells and tumor cells via extracellular vesicles facilitates colorectal cancer dissemination. Cancers 2021, 13, 2505. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Cell Line | Origin | BRAF Exon 15 |
---|---|---|
HBL | Metastasis | WT/WT |
LND1 | Metastasis | WT/WT |
Hmel1 | Metastasis | V600K/WT |
M3 | Metastasis | V600E/V600E |
Target | Primer Sequence | 5′ → 3′ |
---|---|---|
uPA | forward | AGTGTCAGCAGCCCCACT |
reverse | CCCCCTGAGTCTCCCTGG | |
uPAR | forward | GCCCAATCCTGGAGCTTGA |
reverse | TCCCCTTGCAGCTGTAACACT | |
PAI1 | forward | CTCCTGGTTCTGCCCAAGT |
reverse | GAGAGGCTCTTGGTCTGAAAG | |
MMP-2 | forward | AGCACCGCGACAAGAAGTAT |
reverse | ATTTGTTGCCCAGGAAAGTG | |
MMP-9 | forward | GACAAGCTCTTCGGCTTCTG |
reverse | TCGCTGGTACAGGTCGAGTA | |
TIMP-1 | forward | GGGACACCAGAACTCAACCA |
reverse | GGCTTGGAACCCTTTATACATC | |
TIMP-2 | forward | AAGCGGTCAGTGAGAAGGAA |
reverse | TCTCAGGCCCTTTGAACATC | |
αV | forward | AATCTTCCAATTGAGGATATCAC |
reverse | AAAACAGCCAGTAGCAACAAT | |
18S | forward | CGGCTACCACATCCAAGGAA |
reverse | GCTGGAATTACCGCGGCT | |
β-actin | forward | GCCGCCAGCTCACCAT |
reverse | AATCCTTCTGACCCATGCCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Serratì, S.; Zerlotin, R.; Manganelli, M.; Di Fonte, R.; Dicarlo, M.; Oranger, A.; Colaianni, G.; Porcelli, L.; Azzariti, A.; Guida, S.; et al. Irisin and Metastatic Melanoma: Selective Anti-Invasiveness Activity in BRAF Wild-Type Cells. Int. J. Mol. Sci. 2025, 26, 652. https://doi.org/10.3390/ijms26020652
Serratì S, Zerlotin R, Manganelli M, Di Fonte R, Dicarlo M, Oranger A, Colaianni G, Porcelli L, Azzariti A, Guida S, et al. Irisin and Metastatic Melanoma: Selective Anti-Invasiveness Activity in BRAF Wild-Type Cells. International Journal of Molecular Sciences. 2025; 26(2):652. https://doi.org/10.3390/ijms26020652
Chicago/Turabian StyleSerratì, Simona, Roberta Zerlotin, Michele Manganelli, Roberta Di Fonte, Manuela Dicarlo, Angela Oranger, Graziana Colaianni, Letizia Porcelli, Amalia Azzariti, Stefania Guida, and et al. 2025. "Irisin and Metastatic Melanoma: Selective Anti-Invasiveness Activity in BRAF Wild-Type Cells" International Journal of Molecular Sciences 26, no. 2: 652. https://doi.org/10.3390/ijms26020652
APA StyleSerratì, S., Zerlotin, R., Manganelli, M., Di Fonte, R., Dicarlo, M., Oranger, A., Colaianni, G., Porcelli, L., Azzariti, A., Guida, S., Grano, M., Colucci, S. C., & Guida, G. (2025). Irisin and Metastatic Melanoma: Selective Anti-Invasiveness Activity in BRAF Wild-Type Cells. International Journal of Molecular Sciences, 26(2), 652. https://doi.org/10.3390/ijms26020652