Next Article in Journal
How Do the Young Perceive Urban Parks? A Study on Young Adults’ Landscape Preferences and Health Benefits in Urban Parks Based on the Landscape Perception Model
Next Article in Special Issue
Scrutinizing the Profile and Risk Factors of Suicide: A Perspective from a Case–Control Study Focused on a Northern Region of Spain
Previous Article in Journal
Semiconductor Work, Leukemia, and Cancer Risk: A Systematic Review and Meta-Analysis
Previous Article in Special Issue
The Meaning of Suicidal Behaviour for Portuguese Nursing Students
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJERPH
Volume 19
Issue 22
10.3390/ijerph192214735
ijerph-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

High Serum Levels of IL-6 Are Associated with Suicide Attempt but Not with High Lethality Suicide Attempts: A Preliminary Case–Control Study

by
Rosa Giannina Castillo-Avila
1,†,
Alma Delia Genis-Mendoza
2,†,
Isela Esther Juárez-Rojop
1,
María Lilia López-Narváez
3,
Diana María Dionisio-García
1,
Germán Alberto Nolasco-Rosales
1,
Miguel Ángel Ramos-Méndez
1,
Yazmín Hernández-Díaz
4,
Carlos Alfonso Tovilla-Zárate
5,
Thelma Beatriz González-Castro
4,* and
Humberto Nicolini
2,*
1
División Académica de Ciencias de la Salud, Universidad Juárez Autónoma de Tabasco, Villahermosa 86100, Mexico
2
Laboratorio de Genómica de Enfermedades Psiquiátricas y Neurodegenerativas, Instituto Nacional de Medicina Genómica, Ciudad de Mexico 14610, Mexico
3
Hospital Chiapas Nos Une “Dr. Gilberto Gómez Maza”, Secretaría de Salud, Tuxtla Gutierrez 29045, Mexico
4
División Académica Multidisciplinaria de Jalpa de Méndez, Universidad Juárez Autónoma de Tabasco, Jalpa de Mendez 86040, Mexico
5
División Académica Multidisciplinaria de Comalcalco, Universidad Juárez Autónoma de Tabasco, Comalcalco 86040, Mexico
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Environ. Res. Public Health 2022, 19(22), 14735; https://doi.org/10.3390/ijerph192214735
Submission received: 6 October 2022 / Revised: 5 November 2022 / Accepted: 7 November 2022 / Published: 9 November 2022
(This article belongs to the Special Issue Suicidal Behavior: Scientific Research to Guide Prevention)
Browse Figures
Versions Notes

Abstract

:
Suicide attempts are an emerging health problem around the world. Increased levels of IL-6 have been associated with suicidal behavior. Therefore, the aims of this study were to evaluate the serum levels of IL-6 in individuals with suicide attempts and a comparison group and to associate the IL-6 levels with the lethality of the suicide attempt. Additionally, we associated the rs2228145 polymorphism of the IL6R gene with suicide attempts or with the IL-6 serum levels. Suicide attempts and their lethality were evaluated using the Columbia Suicide Severity Rating Scale. The serum concentrations of IL-6 were measured by the ELISA technique in individuals with suicide attempts and then compared to a control group. The rs2228145 polymorphism of the IL6R gene was analyzed by real-time polymerase chain reaction. We found elevated serum levels of IL-6 in the suicide attempt group when compared to the control group (F = 10.37, p = 0.002). However, we found no differences of the IL-6 levels between high and low lethality. The IL6R gene polymorphism rs2479409 was not associated with suicide attempts. Our data suggest that IL-6 serum is increased in individuals with suicide attempts.

1. Introduction

Suicide attempts are defined as an act in which an individual harms himself or herself with the intent to die, but he or she survives [1]. This represents an important global public health problem, with a subgroup of people at high risk of dying [2].
Each year, approximately 700,000 people die by suicide [3]. It is estimated that, for every completed suicide, there are around 20 suicide attempts worldwide; nonetheless, some reports indicate that some countries have higher rates of suicide fatalities, as 8.5–13% of all suicide attempts are fatal [4,5,6].
In this sense, the personal history of suicide attempts and family history of suicides have been described as two of the main established and relevant risk factors for subsequent suicide attempts and suicide deaths [7], hence the importance of studying suicide attempts.
Additionally, the lethality of previous suicide attempts can predict and help to understand the risk of a future suicide in patients hospitalized for suicidal behavior and ideation [8]. Therefore, it is important to consider the degree of lethality to identify candidate biomarkers in suicide research, as well as genetic variants of reported genes, in order to elucidate the mechanisms involved in suicide attempts.
Various studies have contemplated the idea that lethality may be associated with some markers and the levels of interleukins. Nonetheless, no studies have evaluated the degree of lethality of suicide attempts and the level of IL-6 in the serum; therefore, this variable of interest opens up a possibility of study to better understand the pathophysiology of suicide attempts.
It is important to implement adequate prevention strategies with the aim to achieve early care and to improve the quality of life of individuals at risk. Prevention should be focused on reducing mortality by including universal interventions that involve pharmacological treatments; public health initiatives and social initiatives [9,10]; and the research of risk factors (for example, the degree of lethality), as well as a timely participation of an interdisciplinary team (doctor, psychiatrist, psychologist, and nurse) [11,12].
It has been described that the multiple interactions of biological, social, personal, environmental, cultural, psychological, and genetic factors favor the transition from ¿uicidal ideation to suicide attempts [2,11,13]. Some factors that influence suicide attempts include inflammatory processes in which interleukins could participate in the development of the entity [14]—in particular, IL-6.
Interleukin-6 (IL-6) belongs to the family of proinflammatory cytokines, and it induces the expression of various proteins involved in the processes of acute inflammation; it also has an important role in cell differentiation and proliferation in humans [15]. IL-6 triggers the responses of some cell types and also acts on target cells through the interleukin-6 receptor (IL-6R), which together induce dimerization of a second receptor subunit, gp130 [16].
It has been described that IL-6 plays an important role in the physiological homeostasis of neural tissue and in the pathogenesis of inflammatory disorders, including diseases where there are profound neuropathological changes; for instance, in Alzheimer’s, Parkinson’s, and multiple sclerosis, an increased expression of this cytokine has been observed in the brain [17]. Indeed, studies suggest that elevated levels of this cytokine may affect neuronal plasticity, neurogenesis, and neurotransmission by modulating behavioral output from the brain; however, the exact mechanism has not been elucidated [18,19,20].
IL-6 has also been related to mental disorders such as anxiety, depression, and suicidal behavior [21]. Some studies have reported that the plasma levels of IL-6 are decreased, while the levels of IL-6 in the serum and cerebrospinal fluid are increased in individuals with suicidal behavior [9]. It has been described that recent and old suicidal behavior could be associated with increased levels of IL-6 [22]; for instance, increased levels of this cytokine in children with suicidal tendencies prior to pharmacological treatment were associated with subsequent suicidal tendencies [23]. Although IL-6 is one of the most studied cytokines, there are discrepancies in the results, and to date, its role in suicidal behavior is not fully understood. Thus, more scientific studies are required.
On the other hand, various polymorphisms of the IL6R gene (interleukin 6 receptor) [24] have been associated with mental diseases. The rs2228145 polymorphism (IL6R A > C; Asp358Ala) of the IL6R gene [25] decreases the inflammatory process by affecting IL6R signaling [26]. Nonetheless, the participation of this genetic variant is not fully understood in suicide attempts [24].
Therefore, it is necessary to perform studies that include genetic variants of those genes of interest and inflammatory cytokines such as IL-6 that are involved in the pathogenesis of mental illnesses [27] in order to elucidate the role of these molecules and their possible participation in the pathways or mechanisms that lead to suicide attempts. In this sense, the objectives of our study were, first, to determine if suicide attempts are associated with elevated levels of IL-6 in the serum, second, to evaluate the differences in the IL-6 levels related to the lethality of the suicide attempts and, third, to analyze the association of the rs2228145 polymorphism of the IL6R gene in individuals with suicide attempts.

2. Materials and Methods

2.1. Study Design

This is an observational and cross-sectional study performed in Tabasco, Mexico. This study was performed from January to December 2020.

2.2. Participants

The participants were recruited from three hospitals: (a) the High Specialization Regional Hospital “Dr. Gustavo A. Rovirosa Pérez” (Villahermosa City), (b) the “High Specialty Regional Hospital of Mental Health” (Villahermosa City), and (c) the General Hospital of Comalcalco “Dr. Desiderio G. Rosado Carbajal” (Comalcalco City).
The total sample included 84 participants and was divided into two study groups: (a) the suicide attempt group and (b) the comparison group.

2.3. Inclusion Criteria for the Suicide Attempt Group

The suicide attempt group (n = 18 participants) included: (a) individuals ≥ 18 years of age, (b) of both sexes, (c) diagnosed with suicide attempt by a specialized psychiatrist, (d) the suicidal behavior was evaluated using the Columbia Suicide Severity Rating Scale (C-SSRS), and (e) individuals who arrived at the emergency services due to a suicide attempt.

2.4. Inclusion Criteria for the Comparison Group

The comparison group (n = 66 participants) included: (a) people without psychiatric illness evaluated by a psychiatrist, (b) without a history of suicide attempts, (c) volunteers, (d) both sexes, and (e) over 18 years of age. Individuals included in the comparison group were recruited from the blood banks of the hospitals previously mentioned when they attended as voluntary blood donors.

2.5. Exclusion Criteria for Both Study Groups

People who did not agree to participate in the study or did not agree to sign the informed consent and underage individuals were excluded (≤18 years).

2.6. Sociodemographic Characteristics

Sociodemographic information was obtained through face-to-face interviews. We gathered the following data: age, sex, marital status, occupation, years of schooling, and alcohol and cigarette consumption. In addition, the weight (kg) and height (m) were measured. Subsequently, the body mass index (BMI) was calculated using the formula Kg/m2.

2.7. Assessment of Suicide Attempted and Lethality

The Columbia Suicide Severity Rating Scale (C-SSRS) is a structured and reliable questionnaire that assesses suicidal behavior and suicidal ideation in research settings and in daily clinical practice [28]. In addition, this instrument has been validated in the Spanish language [29]. This scale has 4 subscales: (a) severity of ideation (severity subscale), (b) intensity of ideation subscale (intensity subscale), (c) behavior subscale, and (d) lethality subscale [30].
We used the specific lethality subscale included in the fourth section of the C-SSRS to assess the lethality of suicide attempts. There are other scales to measure suicide attempts (such as the Suicide Intention Scale or Patient Health Questionnaires) [31,32], and we used the Columbia-Suicide Severity Rating Scale (C-SSRS) as the instrument recommended by the US Food and Drug Administration for clinical trials, which has also been used by the Centers for Disease Control and Prevention to stratify and define suicidal behavior [28]. We also chose the C-SSRS to be consistent with previous studies that have evaluated suicidal ideation and intent [33,34].

2.8. Interleukins Levels

The levels of interleukin 6 were measured by the ELISA technique (Enzyme-Linked Immunosorbent Assay) using the IL-6 Human ELISA Kit from Invitrogen (96 Tests, Cat. No.-BMS213-2, Invitrogen) following the manufacturers’ protocols.

2.9. Genotyping

We extracted high-quality DNA from white blood cells following the modified Lahiri protocol [35]. Then, we analyzed the rs2228145 polymorphism (assay C__16170664_10) with context sequence (VIC/FAM): AATTTTTTTTTTAACCTAGTGCAAG[C/A]TTCTTCTTCAGTACCACTGCCCACA using exonuclease TaqMan genotyping assays on a QuantStudioTM 5 Real-Time PCR System equipment following the manufacturer’s instructions (Thermo Fisher Scientific).

2.10. Ethical Statement

The study was conducted in accordance with the Declaration of Helsinki. The study was also approved by the ethics committee of the High Specialty Regional Hospital of Mental Health with registration number HRAESM/DG/UWI/351/2022. All the participants were informed about the type of study, objectives, and procedures. Informed consent was obtained from every individual, and their participation was voluntary.
Due to the importance and sensitivity of the individuals under study, we explained in detail the confidentiality of the data and purposes of the research. Additionally, our working group fostered a respectful and safe environment, avoiding discrimination so that the participants could share their points of view and experiences, considering the psychological or emotional impact that remembering an event could imply.
Finally, the people identified as being at risk were directed to a specialized service to receive the appropriate support.

2.11. Statistical Analysis

Analyses were performed using IBM SPSS Statistics 20.0 (IBM, Armonk, NY, USA). Data are expressed as the frequencies and percentages for categorical variables and means ± SD for continuous variables. We also used the chi-square (x2) or t-test for comparing characteristics between individuals with suicide attempts and the comparison group.
We determined the association of the IL-6 levels and suicide attempt lethality. For this analysis, we considered the IL-6 level as the independent variable. We performed an analysis adjusted for age and sex. p < 0.05 was considered statistically significant. In multiple comparisons, the level of statistical significance was set at p < 0.016 (Pcorrection = 0.05/3) using Bonferroni correction.
The genotypic frequencies were tested for Hardy–Weinberg equilibrium using chi-square (x2). The differences in genotype and allele frequencies of the rs2228145 polymorphism of the IL-6 gene between the suicide attempt group and the comparison group was compared by chi-square (x2). For the calculations of the power, we use Quanto software version 1.2.4 (University of Southern California, Los Angeles, CA, USA) [36] with the minor allele frequency = 0.45, n = 84. Dominant model, effect size = 1.0. We obtained a power of 0.05.

3. Results

3.1. Sociodemographic Characteristics

The demographic characteristics of the study population are shown in Table 1. In the overall population, the majority of participants were men, n = 49 (58.3%), and the marital status was married, n = 42 (50%). Most of the participants were homemakers, n = 26 (31%), and had studied 9.79 ± 4.17 years. The median age was 42.19 ± 12.08. Regarding the clinical characteristics, the majority did not consume alcohol, n = 47 (56%), or smoke cigarettes, n = 74 (88.1%). As for anthropometric measurements, the average of weight was 80.01 ± 16.34 Kg, height 163.14 ± 9.78 cm, and the body mass index 29.93 ± 4.90 kg/m2.
In the comparison group, there were more men, n = 45 (68.2%). The majority were married, n = 34 (51.5%), and full-time employed n = 21 (31.8%). The median age was 43.71 ± 11.83, and they studied an average of 9.34 ± 3.83 years. Regarding the clinical characteristics, the majority did not consume alcohol, n = 36 (54.5%).
The suicide attempt group included more women, n = 14 (77.8%). The majority were single, n = 9 (50%), and homemakers, n = 7 (38.9%). The average age was 36.63 ± 11.64 years, and the schooling years were 11.16 ± 5.12. The majority did not consume alcohol, n = 11 (61.1%), or smoke cigarettes, n = 15 (83.3%). The mean weight was 74.72 ± 14.07 kg, height 164.37 ± 10.12 m, and body mass index 29.61 ± 5.03 kg/m2.

3.2. IL-6 Levels in Suicide Attempt and Comparison Groups

The levels of IL-6 in the serum of individuals with suicide attempts and the comparison group are shown in Figure 1. The suicide attempt group showed statistically significant increased levels of IL-6 (1.61 ± 0.55) when compared to the control group (1.17 ± 0.57). (F = 10.37, p = 0.002).

3.3. IL-6 Levels and the Lethality of Suicide Attempt

We measured the lethality of the attempted suicides and observed a lethality 0 in eleven participants and a lethality 2 in seven individuals with suicide attempts.
Additionally, the mean IL-6 levels in the serum per subgroup were: 1.56 ± 0.63 for lethality 0, 1.68 ± 0.43 for lethality 2, and 1.17 ± 0.57 for the comparison group.
Subsequently, to determine the association between the IL-6 levels and lethality, we performed comparisons adjusted for age and sex. We did not observe differences between these subgroups.
Finally, we performed multiple comparisons with a post-hoc analysis between lethality 0, lethality 2, and the comparison group; however, we did not observe statistically significant differences (F = 1.928, p = 0.152) (Figure 2).

3.4. Genotype and Allele Distributions of rs2228145 Polymorphism of the IL6R Gene

No deviation from the Hardy–Weinberg equilibrium was found in the suicide attempts or comparison groups (p > 0.05). In Table 2, we show the genotype and allele distributions of the IL6R rs2228145 in the suicide attempts and comparison groups. No statistically significant differences were observed by genotype or allele distributions. Finally, when we evaluated the association of the polymorphism rs2228145 of the IL6R gene with the levels of IL-6 in the suicide attempts and comparison groups in the multivariate analysis, no statistically significant difference was observed (F = 0.17, p = 0.35).

4. Discussion

Interleukin 6 has antiapoptotic and anti-inflammatory functions and various contrary effects that possibly depend on its local concentration, which itself varies, depending on the biological circumstances [37]. The deregulation or increased expression of the IL6R gene contributes significantly to the development and pathogenesis of various diseases in humans [38].
IL-6 has been linked with numerous biological functions in the central nervous system (CNS), such as stress response, neurogenesis, and other functions related to the control of behavioral traits, including suicidal behavior [26,39,40]. Therefore, our primary aim was to evaluate the serum levels of the IL-6 levels in the suicide attempts and comparison groups. Additionally, we addressed if the serum IL-6 levels are increased according to the level of lethality. Finally, we associated the polymorphism rs2228145 of the IL6R gene with suicide attempted and with the level of IL-6.
First, we observed that the suicide attempt group showed statistically significant higher levels of IL-6 in the serum than the comparison group. This result is in line with previous findings [22]. A meta-analysis reported that the serum IL-6 levels are elevated in individuals with suicidal behavior [9]. Specifically, sustained elevations of IL-6 in the CNS are a key contributor of depressive symptoms and resistance to medications. In fact, excessive IL-6 levels have been related to a poor prognosis and a worse outcome in these patients [39,41,42]. One possible explanation is that the high IL-6 concentrations in the brain block classical or trans-signaling pathways related to the release of neurotransmitters that regulate behavior [40]. Regarding suicidal behavior, evidence shows that elevated IL-6 concentrations are determinant in this conduct [40,41]. Therefore, we could assume that an adequate balance of pro and anti-inflammatory cytokines is essential for the brain homeostasis.
Second, we measured the lethality of attempted suicide using the C-SSRS. Previous studies have used the C-SSRS to assess the lethality in suicide attempts [43]. High lethality in suicide attempts can be considered a close indicator of future completed suicide, and it is essential to study its neurobiology to elucidate the pathophysiology of suicide [44]. We recognize the importance of determining the lethality in suicide attempts in order to identify and refer patients to specialized care areas early and in a timely manner [45]. In this study, we did not observe differences between the degree of lethality in individuals with suicide attempts. One previous study reported an association between suicide attempt lethality and other biomarkers suggesting the C-reactive protein as a peripheral biomarker; however, measuring the IL-6 levels was not within the study objectives [6]. Similarly, the total cholesterol, high LDL-c, HDL-c, and triglycerides have been associated with the lethality of suicide attempts [46]. In the same way, the ratio of platelets to lymphocytes and the mean platelet volume have been associated with high lethality in suicide attempts [47]. Our results, however, suggest that the IL-6 levels might not be modified according to the lethality of suicidal behavior in individuals at risk. It is necessary to replicate the study in other populations, including larger samples of participants.
Third, we analyzed the association between the rs2228145 polymorphism of the IL6R gene and individuals with suicide attempts, for the minor allele of the rs2228145 polymorphism (Ala) has been associated with elevated IL-6 levels in the serum and circulating/plasma levels in individuals with schizophrenia [48]. Then, we considered it important to evaluate the genotypic distribution of the IL6R gene in suicide attempts. This gene is known to regulate IL-6 bioactivity; one of the most implicated variants with a direct effect on the expression of the IL6R gene is the Asp358Ala, rs2228145 A > C (formerly known as rs8192284) [26,49]. Namely, the minor 358Ala allele (C allele) has been associated with a reduction of IL-6R on the surfaces of cells, with a decreased inflammatory activity as the consequence [26,50]. Nevertheless, our analysis did not reveal a statistical association. This could be due to the small number participants included in our study. We could hypothesize that the Asp358Ala variant of the IL6R gene may not be relevant in suicidal behavior; however, further studies are required to elucidate the whole participation of this gene or another hypothetic gene of the IL-6 pathway.
Previous studies have associated IL-6 with other mental disorders, particularly with depression [27]. Thus, IL-6 could participate in the morphological changes observed in the prefrontal cortex of individuals with an early stage of major depressive disorder [51]. Additionally, it has been described that increased levels of IL-6 predict depressive symptoms at 5 years of follow-up, regardless of BMI, sex, smoking, and age of the participants [52]. The variability and severity of depressive symptoms can predict suicide attempts in individuals at high risk [53,54]; however, due to the objectives of our study (to assess suicide attempts, lethality, and serum IL-6 level), we did not assess depression in our groups, so we consider this as a limitation of the study that should be considered when designing future studies.
Our study has some limitations: we observed a higher incidence of women attempting suicide than men. These results are consistent with previous reports in the literature and with the suicide paradox, where it has been described that women attempt suicide up to three times more than men; however, men die by suicide up to two times more than women [55,56,57,58]. It is important to emphasize that we focused on studying suicide attempts and not completed suicide.
The majority of individuals included in the comparison group were men recruited from the blood banks of the participating hospitals. Although it has been described that more women donate blood compared to men [59], it is possible that, in our sample, the type of study or the invitation to participate had a psychological impact on women, so men were more likely to accept the invitation.
The number of individuals included in the comparison group was higher than in the cases group; this because the number of individuals who attempted suicide was, fortunately, much smaller than the number of individuals who did not attempt suicide.
Additionally, the age of individuals in the suicide attempt group was younger than in the comparison group. It has been described that women have an earlier age of onset of suicide attempts compared to men [60]. Women being the majority in the suicide attempts group, it explains the differences of age in our study. Finally, the cross-sectional design of the study did not allow causality to be determined.
This study also has some strengths: it is the first study conducted on the Mexican population that evaluates the IL-6 levels in patients with suicidal behavior and that contemplates the level of lethality.
We believe that studies such as ours could open new areas of research with cytokines (such as IL-6) and some genetic variants. Or any other molecule that confers a predisposition to the development of mental disorders, particularly suicide attempts. Studying associated molecules/pathways in future studies could lead to the implementation of strategies focused on prevention, target treatments, and the search for future biomarkers.

5. Conclusions

We found increased levels of IL-6 serum in individuals who had just attempted suicide. Nonetheless, we did not observe an association between the IL-6 levels and the lethality of suicide attempts. Additionally, we observed no association between the rs2228145 polymorphism of the IL-6R gene and individuals with suicide attempts.
Therefore, we suggest that the serum levels of IL-6 in individuals with suicide attempts should be considered in future research aimed at finding biomarkers in these individuals in order to create fundamental prevention strategies and reduce suicide mortality.
Our results need to be replicated in other populations and larger samples.

Author Contributions

Conceptualization, A.D.G.-M., I.E.J.-R., M.L.L.-N., C.A.T.-Z., T.B.G.-C. and H.N.; methodology, A.D.G.-M., C.A.T.-Z., T.B.G.-C. and H.N.; software, R.G.C.-A., M.L.L.-N., D.M.D.-G., G.A.N.-R., M.Á.R.-M. and Y.H.-D. validation, R.G.C.-A., M.L.L.-N., D.M.D.-G., G.A.N.-R., M.Á.R.-M. and Y.H.-D. formal analysis, A.D.G.-M., I.E.J.-R., M.L.L.-N., C.A.T.-Z., T.B.G.-C. and H.N.; investigation, A.D.G.-M., C.A.T.-Z., T.B.G.-C. and H.N.; resources, A.D.G.-M., I.E.J.-R., M.L.L.-N., C.A.T.-Z., T.B.G.-C. and H.N.; data curation, R.G.C.-A., M.L.L.-N., D.M.D.-G., G.A.N.-R. and M.Á.R.-M., writing—original draft preparation, A.D.G.-M., I.E.J.-R., M.L.L.-N., Y.H.-D., C.A.T.-Z., T.B.G.-C. and H.N.; writing—review and editing, R.G.C.-A., D.M.D.-G., G.A.N.-R. and M.Á.R.-M.; visualization, R.G.C.-A., D.M.D.-G., G.A.N.-R. and M.Á.R.-M.; supervision, A.D.G.-M., I.E.J.-R., M.L.L.-N., Y.H.-D., C.A.T.-Z., T.B.G.-C. and H.N.; Project administration, A.D.G.-M., I.E.J.-R., M.L.L.-N., Y.H.-D., C.A.T.-Z., T.B.G.-C. and H.N.; and funding acquisition, A.D.G.-M., I.E.J.-R., M.L.L.-N., Y.H.-D., C.A.T.-Z., T.B.G.-C. and H.N. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the Institutional Review Board of High Specialty Regional Hospital of Mental Health in Villahermosa City (HRAESM/DG/UEI/1416/2020).

Informed Consent Statement

Informed consent was obtained from every participant involved in the study.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. De Leo, D.; Goodfellow, B.; Silverman, M.; Berman, A.; Mann, J.; Arensman, E.; Hawton, K.; Phillips, M.R.; Vijayakumar, L.; Andriessen, K.; et al. International study of definitions of English-language terms for suicidal behaviours: A survey exploring preferred terminology. BMJ Open 2021, 11, e043409. [Google Scholar] [CrossRef] [PubMed]
  2. Menon, V.; Vijayakumar, L. Interventions for attempted suicide. Curr. Opin. Psychiatry 2022, 35, 317–323. [Google Scholar] [CrossRef] [PubMed]
  3. Ilic, M.; Ilic, I. Worldwide suicide mortality trends (2000–2019): A joinpoint regression analysis. World J. Psychiatry 2022, 12, 1044–1060. [Google Scholar] [CrossRef] [PubMed]
  4. De la Garza, Á.G.; Blanco, C.; Olfson, M.; Wall, M.M. Identification of Suicide Attempt Risk Factors in a National US Survey Using Machine Learning. JAMA Psychiatry 2021, 78, 398–406. [Google Scholar] [CrossRef] [PubMed]
  5. Mullins, N.; Kang, J.; Campos, A.I.; Coleman, J.R.I.; Edwards, A.C.; Galfalvy, H.; Levey, D.F.; Lori, A.; Shabalin, A.; Starnawska, A.; et al. Dissecting the Shared Genetic Architecture of Suicide Attempt, Psychiatric Disorders, and Known Risk Factors. Biol. Psychiatry 2022, 91, 313–327. [Google Scholar] [CrossRef]
  6. Aguglia, A.; Natale, A.; Fusar-Poli, L.; Gnecco, G.B.; Lechiara, A.; Marino, M.; Meinero, M.; Pastorino, F.; Costanza, A.; Spedicato, G.A.; et al. C-Reactive Protein as a Potential Peripheral Biomarker for High-Lethality Suicide Attempts. Life 2022, 12, 1557. [Google Scholar] [CrossRef]
  7. Turecki, G. The molecular bases of the suicidal brain. Nat. Rev. Neurosci. 2014, 15, 802–816. [Google Scholar] [CrossRef] [Green Version]
  8. Rojas, S.M.; Skinner, K.D.; Feldner, M.T.; Rodante, D.E.; Puppo, S.; Vidjen, P.; Portela, A.; Grendas, L.N.; Daray, F.M. Lethality of Previous Suicidal Behavior among Patients Hospitalized for Suicide Risk Predicts Lethality of Future Suicide Attempts. Suicide Life-Threat. Behav. 2019, 49, 1431–1438. [Google Scholar] [CrossRef]
  9. González-Castro, T.B.; Tovilla-Zárate, C.A.; López-Narváez, M.L.; Genis-Mendoza, A.D.; Juárez-Rojop, I.E. Interleukin-6 Levels in Serum, Plasma, and Cerebral Spinal Fluid in Individuals with Suicide Behavior: Systematic Review and Meta-Analysis with Meta-Regression. J. Interferon Cytokine Res. 2021, 41, 258–267. [Google Scholar] [CrossRef]
  10. Turecki, G.; Brent, D.A.; Gunnell, D.; O’Connor, R.C.; Oquendo, M.A.; Pirkis, J.; Stanley, B.H. Suicide and suicide risk. Nat. Rev. Dis. Primers 2019, 5, 74. [Google Scholar] [CrossRef]
  11. Mejías-Martín, Y.; Del Castillo, J.D.L.; Rodríguez-Mejías, C.; Martí-García, C.; Valencia-Quintero, J.P.; García-Caro, M.P. Factors Associated with Suicide Attempts and Suicides in the General Population of Andalusia (Spain). Int. J. Environ. Res. Public Health 2019, 16, 4496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Grigoroglou, C.; van der Feltz-Cornelis, C.; Hodkinson, A.; Coventry, P.A.; Zghebi, S.S.; Kontopantelis, E.; Bower, P.; Lovell, K.; Gilbody, S.; Waheed, W.; et al. Effectiveness of collaborative care in reducing suicidal ideation: An individual participant data meta-analysis. Gen. Hosp. Psychiatry 2021, 71, 27–35. [Google Scholar] [CrossRef] [PubMed]
  13. González-Castro, T.B.; Martínez-Magaña, J.J.; Tovilla-Zárate, C.A.; Juárez-Rojop, I.E.; Sarmiento, E.; Genis-Mendoza, A.D.; Nicolini, H. Gene-level genome-wide association analysis of suicide attempt, a preliminary study in a psychiatric Mexican population. Mol. Genet. Genom. Med. 2019, 7, e983. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Gananca, L.; Oquendo, M.A.; Tyrka, A.R.; Cisneros-Trujillo, S.; Mann, J.J.; Sublette, M.E. The role of cytokines in the pathophysiology of suicidal behavior. Psychoneuroendocrinology 2016, 63, 296–310. [Google Scholar] [CrossRef] [Green Version]
  15. Uciechowski, P.; Dempke, W.C.M. Interleukin-6: A Masterplayer in the Cytokine Network. Oncology 2020, 98, 131–137. [Google Scholar] [CrossRef] [PubMed]
  16. Rose-John, S. Local and systemic effects of interleukin-6 (IL-6) in inflammation and cancer. FEBS Lett. 2022, 596, 557–566. [Google Scholar] [CrossRef] [PubMed]
  17. Rothaug, M.; Becker-Pauly, C.; Rose-John, S. The role of interleukin-6 signaling in nervous tissue. Biochim Biophys. Acta 2016, 1863, 1218–1227. [Google Scholar] [CrossRef]
  18. Monje, M.L.; Toda, H.; Palmer, T.D. Inflammatory blockade restores adult hippocampal neurogenesis. Science (N.Y.) 2003, 302, 1760–1765. [Google Scholar] [CrossRef]
  19. Khairova, R.A.; Machado-Vieira, R.; Du, J.; Manji, H.K. A potential role for pro-inflammatory cytokines in regulating synaptic plasticity in major depressive disorder. Int. J. Neuropsychopharmacol. 2009, 12, 561–578. [Google Scholar] [CrossRef]
  20. Roohi, E.; Jaafari, N.; Hashemian, F. On inflammatory hypothesis of depression: What is the role of IL-6 in the middle of the chaos? J. Neuroinflamm. 2021, 18, 45. [Google Scholar] [CrossRef]
  21. Hodes, G.E.; Ménard, C.; Russo, S.J. Integrating Interleukin-6 into depression diagnosis and treatment. Neurobiol. Stress 2016, 4, 15–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Fernández-Sevillano, J.; González-Ortega, I.; MacDowell, K.; Zorrilla, I.; López, M.P.; Courtet, P.; Gabilondo, A.; Martínez-Cengotitabengoa, M.; Leza, J.C.; Sáiz, P.; et al. Inflammation biomarkers in suicide attempts and their relation to abuse, global functioning and cognition. World J. Biol. Psychiatry 2021, 23, 307–317. [Google Scholar] [CrossRef] [PubMed]
  23. Amitai, M.; Taler, M.; Lebow, M.; Ben-Baruch, R.; Apter, A.; Fennig, S.; Weizman, A.; Chen, A. An increase in IL-6 levels at 6-month follow-up visit is associated with SSRI-emergent suicidality in high-risk children and adolescents treated with fluoxetine. J. Eur. Coll. Neuropsychopharmacol. 2020, 40, 61–69. [Google Scholar] [CrossRef] [PubMed]
  24. Batur, L.K.; Savaş, S.; Girgin, E.; Hekim, N. Association of the IL-6R gene polymorphic variant rs2228145(C>A) with IL-6 gene polymorphisms in a healthy cohort of Turkish population. Genes Immun. 2022, 23, 118–122. [Google Scholar] [CrossRef] [PubMed]
  25. Sundaresh, A.; Oliveira, J.; Chinnadurai, R.K.; Rajkumar, R.P.; Hani, L.; Krishnamoorthy, R.; Leboyer, M.; Negi, V.S.; Tamouza, R. IL6/IL6R genetic diversity and plasma IL6 levels in bipolar disorder: An Indo-French study. Heliyon 2019, 5, e01124. [Google Scholar] [CrossRef] [Green Version]
  26. Khandaker, G.M.; Zammit, S.; Burgess, S.; Lewis, G.; Jones, P.B. Association between a functional interleukin 6 receptor genetic variant and risk of depression and psychosis in a population-based birth cohort. Brain Behav. Immun. 2018, 69, 264–272. [Google Scholar] [CrossRef]
  27. Ting, E.Y.; Yang, A.C.; Tsai, S.J. Role of Interleukin-6 in Depressive Disorder. Int. J. Mol. Sci. 2020, 21, 2194. [Google Scholar] [CrossRef] [Green Version]
  28. Salvi, J. Calculated Decisions: Columbia-Suicide Severity Rating Scale (C-SSRS). Emerg. Med. Pract. 2019, 21, Cd3-4. [Google Scholar]
  29. Al-Halabí, S.; Sáiz, P.A.; Burón, P.; Garrido, M.; Benabarre, A.; Jiménez, E.; Cervilla, J.; Navarrete, M.I.; Díaz-Mesa, E.M.; García-Álvarez, L.; et al. Validation of a Spanish version of the Columbia-Suicide Severity Rating Scale (C-SSRS). Rev. Psiquiatr. Y Salud Ment. 2016, 9, 134–142. [Google Scholar] [CrossRef]
  30. Posner, K.; Brown, G.K.; Stanley, B.; Brent, D.A.; Yershova, K.V.; Oquendo, M.A.; Currier, G.W.; Melvin, G.A.; Greenhill, L.; Shen, S.; et al. The Columbia-Suicide Severity Rating Scale: Initial validity and internal consistency findings from three multisite studies with adolescents and adults. Am. J. Psychiatry 2011, 168, 1266–1277. [Google Scholar] [CrossRef] [Green Version]
  31. Beck, A.T.; Schuyler, D.; Herman, I. Development of Suicidal Intent Scales; Charles Press Publishers: Philadelphia, PA, USA, 1974. [Google Scholar]
  32. Chung, T.H.; Hanley, K.; Le, Y.C.; Merchant, A.; Nascimento, F.; De Figueiredo, J.M.; Wilcox, H.C.; Coryell, W.H.; Soares, J.C.; Selvaraj, S. A validation study of PHQ-9 suicide item with the Columbia Suicide Severity Rating Scale in outpatients with mood disorders at National Network of Depression Centers. J. Affect. Disord. 2022, 320, 590–594. [Google Scholar] [CrossRef] [PubMed]
  33. Wolf, J.; Padberg, F.; Nenov-Matt, T.; Amann, B.L.; Barton, B.B.; Tang, J.; Glessner, G.; Brakemeier, E.L.; Jobst, A.; Musil, R.; et al. Suicidal behaviors are associated with loneliness and decrease during inpatient CBASP treatment for persistent depressive disorder. J. Psychiatr. Res. 2022, 154, 139–144. [Google Scholar] [CrossRef] [PubMed]
  34. Ahmadi, N.; Pynoos, R.; Leuchter, A.; Kopelowicz, A. Reminder-Focused Positive Psychiatry: Suicide Prevention Among Youths with Comorbid Posttraumatic Stress Disorder and Suicidality. Am. J. Psychother. 2022, 75, 114–121. [Google Scholar] [CrossRef] [PubMed]
  35. Lahiri, D.K.; Nurnberger, J.I., Jr. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res. 1991, 19, 5444. [Google Scholar] [CrossRef]
  36. Gauderman, W.J. Sample size requirements for matched case-control studies of gene-environment interaction. Stat. Med. 2002, 21, 35–50. [Google Scholar] [CrossRef]
  37. Trautz, F.; Franke, H.; Bohnert, S.; Hammer, N.; Müller, W.; Stassart, R.; Tse, R.; Zwirner, J.; Dreßler, J.; Ondruschka, B. Survival-time dependent increase in neuronal IL-6 and astroglial GFAP expression in fatally injured human brain tissue. Sci. Rep. 2019, 9, 11771. [Google Scholar] [CrossRef] [Green Version]
  38. Yao, X.; Huang, J.; Zhong, H.; Shen, N.; Faggioni, R.; Fung, M.; Yao, Y. Targeting interleukin-6 in inflammatory autoimmune diseases and cancers. Pharmacol. Ther. 2014, 141, 125–139. [Google Scholar] [CrossRef]
  39. Eftekharian, M.M.; Noroozi, R.; Omrani, M.D.; Sharifi, Z.; Komaki, A.; Taheri, M.; Ghafouri-Fard, S. Single-Nucleotide Polymorphisms in Interleukin 6 (IL-6) Gene Are Associated with Suicide Behavior in an Iranian Population. J. Mol. Neurosci. 2018, 66, 414–419. [Google Scholar] [CrossRef]
  40. Voorhees, J.L.; Tarr, A.J.; Wohleb, E.S.; Godbout, J.P.; Mo, X.; Sheridan, J.F.; Eubank, T.D.; Marsh, C.B. Prolonged restraint stress increases IL-6, reduces IL-10, and causes persistent depressive-like behavior that is reversed by recombinant IL-10. PLoS ONE 2013, 8, e58488. [Google Scholar] [CrossRef] [Green Version]
  41. Erta, M.; Giralt, M.; Esposito, F.L.; Fernandez-Gayol, O.; Hidalgo, J. Astrocytic IL-6 mediates locomotor activity, exploration, anxiety, learning and social behavior. Horm. Behav. 2015, 73, 64–74. [Google Scholar] [CrossRef]
  42. Choi, W.; Kang, H.J.; Kim, J.W.; Kim, H.K.; Kang, H.C.; Lee, J.Y.; Kim, S.W.; Stewart, R.; Kim, J.M. Interaction effect of the serum interleukin-6 level and anxiety on the 12-week pharmacotherapeutic responses of patients with depressive disorders. J. Affect. Disord. 2022, 308, 166–171. [Google Scholar] [CrossRef] [PubMed]
  43. Kim, B.; Kim, Y.; Park, C.H.K.; Rhee, S.J.; Kim, Y.S.; Leventhal, B.L.; Ahn, Y.M.; Paik, H. Identifying the Medical Lethality of Suicide Attempts Using Network Analysis and Deep Learning: Nationwide Study. JMIR Med. Inform. 2020, 8, e14500. [Google Scholar] [CrossRef] [PubMed]
  44. Sher, L. The pathophysiology of high-lethality suicide attempts: A vital area of suicide research. Rev. Bras. Psiquiatr. 2022, 44, 237–238. [Google Scholar] [CrossRef] [PubMed]
  45. Prabhakar, D.; Peterson, E.L.; Hu, Y.; Chawa, S.; Rossom, R.C.; Lynch, F.L.; Lu, C.Y.; Waitzfelder, B.E.; Owen-Smith, A.A.; Williams, L.K.; et al. Serious Suicide Attempts and Risk of Suicide Death. Crisis 2021, 42, 343–350. [Google Scholar] [CrossRef]
  46. Aguglia, A.; Solano, P.; Giacomini, G.; Caprino, M.; Conigliaro, C.; Romano, M.; Aguglia, E.; Serafini, G.; Amore, M. The Association Between Dyslipidemia and Lethality of Suicide Attempts: A Case-Control Study. Front. Psychiatry 2019, 10, 70. [Google Scholar] [CrossRef] [Green Version]
  47. Aguglia, A.; Amerio, A.; Asaro, P.; Caprino, M.; Conigliaro, C.; Giacomini, G.; Parisi, V.M.; Trabucco, A.; Amore, M.; Serafini, G. High-lethality of suicide attempts associated with platelet to lymphocyte ratio and mean platelet volume in psychiatric inpatient setting. World J. Biol. Psychiatry 2021, 22, 119–127. [Google Scholar] [CrossRef]
  48. Cavieres, A.; Campos-Estrada, C.; Moya, Y.; Maldonado, R.; González-Vargas, R.; Bustamante, M.L.; Moya, P.R. Lack of Association between the IL6R Gene Asp358Ala Variant (rs2228145), IL-6 Plasma Levels, and Treatment Resistance in Chilean Schizophrenic Patients Treated with Clozapine. Schizophr. Res. Treat. 2019, 2019, 5601249. [Google Scholar] [CrossRef] [Green Version]
  49. Strafella, C.; Caputo, V.; Termine, A.; Barati, S.; Caltagirone, C.; Giardina, E.; Cascella, R. Investigation of Genetic Variations of IL6 and IL6R as Potential Prognostic and Pharmacogenetics Biomarkers: Implications for COVID-19 and Neuroinflammatory Disorders. Life 2020, 10, 351. [Google Scholar] [CrossRef]
  50. Ferreira, R.C.; Freitag, D.F.; Cutler, A.J.; Howson, J.M.; Rainbow, D.B.; Smyth, D.J.; Kaptoge, S.; Clarke, P.; Boreham, C.; Coulson, R.M.; et al. Functional IL6R 358Ala allele impairs classical IL-6 receptor signaling and influences risk of diverse inflammatory diseases. PLoS Genet. 2013, 9, e1003444. [Google Scholar] [CrossRef]
  51. Kakeda, S.; Watanabe, K.; Katsuki, A.; Sugimoto, K.; Igata, N.; Ueda, I.; Igata, R.; Abe, O.; Yoshimura, R.; Korogi, Y. Relationship between interleukin (IL)-6 and brain morphology in drug-naïve, first-episode major depressive disorder using surface-based morphometry. Sci. Rep. 2018, 8, 10054. [Google Scholar] [CrossRef] [Green Version]
  52. Zalli, A.; Jovanova, O.; Hoogendijk, W.J.; Tiemeier, H.; Carvalho, L.A. Low-grade inflammation predicts persistence of depressive symptoms. Psychopharmacology 2016, 233, 1669–1678. [Google Scholar] [CrossRef] [PubMed]
  53. Melhem, N.M.; Porta, G.; Oquendo, M.A.; Zelazny, J.; Keilp, J.G.; Iyengar, S.; Burke, A.; Birmaher, B.; Stanley, B.; Mann, J.J.; et al. Severity and Variability of Depression Symptoms Predicting Suicide Attempt in High-Risk Individuals. JAMA Psychiatry 2019, 76, 603–613. [Google Scholar] [CrossRef] [PubMed]
  54. Indu, P.S.; Anilkumar, T.V.; Pisharody, R.; Russell, P.S.S.; Raju, D.; Sarma, P.S.; Remadevi, S.; Amma, K.; Sheelamoni, A.; Andrade, C. Prevalence of depression and past suicide attempt in primary care. Asian J. Psychiatry 2017, 27, 48–52. [Google Scholar] [CrossRef] [PubMed]
  55. Bachmann, S. Epidemiology of Suicide and the Psychiatric Perspective. Int. J. Environ. Res. Public Health 2018, 15, 1425. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Michaud, L.; Brovelli, S.; Bourquin, C. The gender paradox in suicide: Some explanations and much uncertainty. Rev. Med. Suisse 2021, 17, 1265–1267. [Google Scholar]
  57. Weiss, S.J.; Simeonova, D.I.; Koleva, H.; Muzik, M.; Clark, K.D.; Ozerdem, A.; Cooper, B.; Ammerman, R.T. Potential paths to suicidal ideation and suicide attempts among high-risk women. J. Psychiatr. Res. 2022, 155, 493–500. [Google Scholar] [CrossRef]
  58. Bommersbach, T.J.; Rosenheck, R.A.; Petrakis, I.L.; Rhee, T.G. Why are women more likely to attempt suicide than men? Analysis of lifetime suicide attempts among US adults in a nationally representative sample. J. Affect. Disord. 2022, 311, 157–164. [Google Scholar] [CrossRef]
  59. Öhrner, C.; Kvist, M.; Wiberg, K.B.; Diedrich, B. Why do young men lapse from blood donation? Vox Sang. 2019, 114, 566–575. [Google Scholar] [CrossRef]
  60. Menon, V.; Kattimani, S.; Sarkar, S.; Sathyanarayanan, G.; Subramanian, K.; Velusamy, S.K. Age at onset of first suicide attempt: Exploring the utility of a potential candidate variable to subgroup attempters. Asian J. Psychiatry 2018, 37, 40–45. [Google Scholar] [CrossRef]
Ijerph 19 14735 g001 550
Figure 1. IL-6 levels in suicide attempts and comparison groups. * Statistical significance; ● Participants.
Figure 1. IL-6 levels in suicide attempts and comparison groups. * Statistical significance; ● Participants.
Ijerph 19 14735 g001
Ijerph 19 14735 g002 550
Figure 2. IL-6 levels in lethality of suicide attempts. ns: no statistical significance. The square triangle represents the comparison between groups.
Figure 2. IL-6 levels in lethality of suicide attempts. ns: no statistical significance. The square triangle represents the comparison between groups.
Ijerph 19 14735 g002
Table
Table 1. Demographic characteristics of individuals with suicide attempts and the control group.
Table 1. Demographic characteristics of individuals with suicide attempts and the control group.
CharacteristicTotal Sample
n (%)
n = 84		Comparison Group n (%)
n = 66		Suicide Attempt Group n (%)
n = 18		Statistics
Sociodemographic characteristics
Sex
 Men49 (58.3)45 (68.2)4 (22.2)x2 = 12.29, p = 0.001
 Women35 (41.7)21 (31.8)14 (77.8)
Marital Status
 Single36 (42.9)27 (40.9)9 (50)x2 = 0.49, p = 0.78
 Married42 (50.0)34 (51.5) 8 (44.4)
 Widower6 (7.1)5 (7.6)1 (5.6)
Occupation
 Unemployed17 (20.2)14 (21.2)3 (16.7)x2 = 2.01, p = 0.73
 Homemaker26 (31.0)19 (28.8)7 (38.9)
 Student2 (2.3)1 (1.5)1 (5.5)
 Part-time employed14 (16.7)11 (16.7)3 (16.7)
 Full time employed25 (29.8)21 (31.8)4 (22.2)
Age42.19 ± 12.0843.71 ± 11.8336.63 ± 11.64t = 2.25, p = 0.02
Years of schooling9.79 ± 4.179.34 ± 3.8311.16 ± 5.12t = −1.65, p = 0.10
Clinical characteristics
Alcohol consumption
 Yes37 (44.0)30 (45.5)7 (38.9)x2 = 0.24, p = 0.79
 No47 (56.0)36 (54.5)11 (61.1)
Cigarette Smoking
 Yes10 (11.9)7 (10.6)3 (16.7)x2 = 0.49, p = 0.36
 No74 (88.1)59 (89.4)15 (83.3)
Anthropometric Measurements
Weight (Kg)80.01 ± 16.3481.45 ± 16.7174.72 ± 14.07t = −1.72, p = 0.09
Height (cm)163.14 ± 9.78158.61 ± 6.92164.37 ± 10.12t = −2.81, p = 0.008
Body Mass Index (kg/m2)29.93 ± 4.9030.02 ± 4.8929.61 ± 5.03t = −0.30, p = 0.76
Data are expressed as the mean ± standard deviation or n and percentage. Numbers in bold show significant statistical difference.
Table
Table 2. Genotype and allele distribution of IL-6R rs2228145 in the suicide attempts and the comparison group.
Table 2. Genotype and allele distribution of IL-6R rs2228145 in the suicide attempts and the comparison group.
rs2228145 Polymorphism
Genotype/AlleleComparison Group
(n = 66)		Suicide Attempt
(n = 18)		x2p
Genotypen%n%
AA1421.2527.83.6380.16
AC4466.7844.4
CC812.1527.8
Allele
A7254.518500.230.62
C6045.51850
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Castillo-Avila, R.G.; Genis-Mendoza, A.D.; Juárez-Rojop, I.E.; López-Narváez, M.L.; Dionisio-García, D.M.; Nolasco-Rosales, G.A.; Ramos-Méndez, M.Á.; Hernández-Díaz, Y.; Tovilla-Zárate, C.A.; González-Castro, T.B.; et al. High Serum Levels of IL-6 Are Associated with Suicide Attempt but Not with High Lethality Suicide Attempts: A Preliminary Case–Control Study. Int. J. Environ. Res. Public Health 2022, 19, 14735. https://doi.org/10.3390/ijerph192214735

AMA Style

Castillo-Avila RG, Genis-Mendoza AD, Juárez-Rojop IE, López-Narváez ML, Dionisio-García DM, Nolasco-Rosales GA, Ramos-Méndez MÁ, Hernández-Díaz Y, Tovilla-Zárate CA, González-Castro TB, et al. High Serum Levels of IL-6 Are Associated with Suicide Attempt but Not with High Lethality Suicide Attempts: A Preliminary Case–Control Study. International Journal of Environmental Research and Public Health. 2022; 19(22):14735. https://doi.org/10.3390/ijerph192214735

Chicago/Turabian Style

Castillo-Avila, Rosa Giannina, Alma Delia Genis-Mendoza, Isela Esther Juárez-Rojop, María Lilia López-Narváez, Diana María Dionisio-García, Germán Alberto Nolasco-Rosales, Miguel Ángel Ramos-Méndez, Yazmín Hernández-Díaz, Carlos Alfonso Tovilla-Zárate, Thelma Beatriz González-Castro, and et al. 2022. "High Serum Levels of IL-6 Are Associated with Suicide Attempt but Not with High Lethality Suicide Attempts: A Preliminary Case–Control Study" International Journal of Environmental Research and Public Health 19, no. 22: 14735. https://doi.org/10.3390/ijerph192214735

APA Style

Castillo-Avila, R. G., Genis-Mendoza, A. D., Juárez-Rojop, I. E., López-Narváez, M. L., Dionisio-García, D. M., Nolasco-Rosales, G. A., Ramos-Méndez, M. Á., Hernández-Díaz, Y., Tovilla-Zárate, C. A., González-Castro, T. B., & Nicolini, H. (2022). High Serum Levels of IL-6 Are Associated with Suicide Attempt but Not with High Lethality Suicide Attempts: A Preliminary Case–Control Study. International Journal of Environmental Research and Public Health, 19(22), 14735. https://doi.org/10.3390/ijerph192214735

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop