Next Article in Journal
Dendroclimatic Analysis of Sierra Nevada Mixed Conifer Species between Different Diameter Size Classes
Next Article in Special Issue
Enhanced Photosynthetic Efficiency for Increased Carbon Assimilation and Woody Biomass Production in Engineered Hybrid Poplar
Previous Article in Journal
Ecological and Soil Data Applied to Conservation Management of an Urban Forest
Previous Article in Special Issue
Effects of Polyploidy on Physiological Performance of Acclimatized Solanum betaceum Cav. Plants under Water Deficit
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 14
Issue 3
10.3390/f14030488
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Efficient Virus-Induced Gene Silencing in Ilex dabieshanensis Using Tobacco Rattle Virus

by
Xinran Chong
1,
Yue Wang
2,
Xiaoyang Xu
1,
Fan Zhang
1,
Chuanyong Wang
1,
Yanwei Zhou
1,
Ting Zhou
1,
Yunlong Li
1,
Xiaoqing Lu
1 and
Hong Chen
1,*
1
Jiangsu Key Laboratory for the Research and Utilization of Plant Resources, Institute of Botany, Jiangsu Province and Chinese Academy of Sciences, Nanjing Botanical Garden Mem. Sun Yat-Sen, Nanjing 210014, China
2
College of Horticulture, Jinling Institute of Technology, Nanjing 210038, China
*
Author to whom correspondence should be addressed.
Forests 2023, 14(3), 488; https://doi.org/10.3390/f14030488
Submission received: 18 January 2023 / Revised: 18 February 2023 / Accepted: 22 February 2023 / Published: 28 February 2023
(This article belongs to the Special Issue Application of Biotechnology Techniques on Tree Species—Series II)
Browse Figures
Versions Notes

Abstract

:
Ilex dabieshanensis is not only an important ornamental plant, but can also be used to produce Kuding tea, owing to its lipid-lowering and anti-inflammatory medicinal properties. The genetic transformation of I. dabieshanensis is currently difficult, which restricts functional gene studies and molecular breeding research on this species. Virus-induced gene silencing (VIGS) is a powerful tool for determining gene functions in plants. The present study reports the first application of VIGS mediated by a tobacco rattle virus (TRV) vector in I. dabieshanensis. We tested the efficiency of the VIGS system to silence Mg-chelatase H subunit (ChlH) gene through agroinfiltration. The agroinfiltrated leaves of I. dabieshanensis exhibited a typical yellow-leaf phenotype of ChlH gene silencing at 21 days post infiltration. Endogenous ChlH expression levels in the leaves of yellow-leaf phenotype plants were all significantly lower than that in the leaves of mock-infected and control plants. Overall, our results indicated that the TRV-based VIGS system can efficiently silence genes in I. dabieshanensis, and this system will contribute to efficient functional genomics research in I. dabieshanensis.

1. Introduction

Ilex L. (Aquifoliaceae) is the largest woody dioecious angiosperm genus with approximately 700 species of forest trees and shrubs [1,2]. Most Ilex species have economic, ecological, and horticultural value [3]. The genus is widely distributed in mesic habitats, but the global diversity centers are in East Asia and South America, with only a few species growing in tropical Africa, northern Australia, and Europe [3,4]. About 200 Ilex species are known in China, mainly distributed in the humid and temperate regions of south and southwest China [5,6]. Among them, Ilex dabieshanensis K. Yao &M.B. Deng has been widely utilized as an ornamental tree because of its bright red drupes and dense evergreen foliage. Additionally, it can be used for making a bitter-tasting Kuding tea owing to its nutritional and medicinal value [7]. Recently, the next generation sequencing-based transcriptome sequencing has greatly facilitated the acquisition of abundant sequence data. However, due to the long childhood period of forest trees, such as Ilex dabieshanensis, and the inefficient and laborious genetic transformation procedures, research on Ilex gene functions is limited. Thus, to improve functional genomic studies and the molecular breeding of Ilex plants, developing appropriate genetic tools is necessary.
Virus-induced gene silencing (VIGS), a transcript suppression technique to identify the functions of plant genes, has been developed based on the defense mechanism of plants against viral infections [8]. When the virus infects plant tissues and spreads systemically, endogenous gene transcripts, which are homologous to the engineered sequence in the viral vector (VIGS vector), are degraded by post-transcriptional gene silencing [9]. Compared with traditional transgenic technology, VIGS has advantages of efficiency, simplicity, and short cycle time [10]. VIGS has been widely used to identify gene functions involved in plant development, secondary metabolism, stress response, and plant–pathogen interactions [11,12,13].
Since the last few years, many plant viruses have been developed into VIGS vectors to assess plant gene functions; particularly, among these viruses, the tobacco rattle virus (TRV) has been reported to have the broadest host range until now [11]. TRV consists of two positive-sense single-stranded RNA components: RNA1 and RNA2. RNA1 functions in viral replication and movement, whereas RNA2 encodes the viral coat protein and some unnecessary structural proteins that can be replaced by foreign sequences [14,15]. Previously, TRV-based VIGS vectors have been successfully used to silence genes in tomato [16], cotton [17], Arabidopsis [18], rose [19], petunia [20], etc. However, TRV-based VIGS has not yet been applied to unravel gene functions in I. dabieshanensis. The Mg-chelatase H subunit (ChlH) gene, which is involved in chlorophyll biosynthesis, has been widely and successfully used as a reporter gene because of its visual silencing phenotype in the VIGS tests of many species [13,21].
In this study, we developed a TRV-based VIGS system in I. dabieshanensis by silencing the ChlH gene. I. dabieshanensis leaves exhibited a yellow-leaf phenotype at 21 days after Agrobacterium tumefaciens infection, and the transcripts of the IdChlH gene in yellow leaves were significantly lower than those in the leaves of mock-infected and control plants. The results indicated that the TRV-based VIGS system could effectively silence genes in I. dabieshanensis. The VIGS system presented here will pave an important way for identifying gene functions in I. dabieshanensis.

2. Materials and Methods

2.1. Plant Materials and Growing Conditions

I. dabieshanensis was acquired from the Nanjing Botanical Garden, Mem. Sun Yat-sen (118°49′55″ E, 32°3′32″ N) (Figure S1), Nanjing, Jiangsu, China. Uniformly sized cuttings (current-year semi-lignified shoots, 5–8 cm in length) were rooted in a 1:2 mixture of perlite and peat, grown in a greenhouse under natural light, and then transferred into a 1:1 mixture of soil and vermiculite. The rooted cuttings were cultivated in a greenhouse under a 16 h light/8 h dark photoperiod, and a day/night temperature of 25/22 °C with a relative humidity of 70%. The plants were watered and fertilized throughout the experiment.

2.2. Sequence Analysis of IdChlH

According to the IdChlH gene sequence (GenBank accession number: OP820080), the deduced amino acid sequence was analyzed with that of other plant homologs using BLAST and DNAman software. Phylogenetic analysis was performed using the neighbor-joining method with 1000 bootstrap replicates implemented in MEGA 5.0 software [22]. The amino acid sequences of ChlH homologs were obtained from the NCBI database.

2.3. pTRV2-IdChlH Vector Construction

Total RNA was extracted from snap-frozen I. dabieshanensis leaves using the Quick RNA Isolation Kit (Huayueyang, Beijing, China) according to the manufacturer’s protocol. First-strand cDNA was synthesized using SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Based on the IdChlH sequence, the primer pair IdChlH-F/R was designed using Primer 5.0 software to amplify the partially conserved IdChlH fragment (Table 1). The upstream primers contained the BamHI restriction site, whereas the downstream primers contained the SacI restriction site. The PCR reactions were performed in a final 50 µL volume with 25 μL 2 × PCR buffer for KOD FX, 10 μL dNTPs (2 mM), 1.5 µL each of the forward and reverse primers (10 pM), 1 μL KOD FX DNA polymerase, 1 µL cDNA, and 10 µL ddH2O. Thermal cycling consisted of 94 °C for 2 min, followed by 35 cycles of 98 °C for 10 s, 55 °C for 30 s, and 68 °C for 30 s, and a final extension at 68 °C for 7 min. Further, TRV-VIGS vectors (pTRV1 and pTRV2) were used in this study as reported previously [16]. The IdChlH fragment was assembled into the pTRV2 vector (double-digested with BamH I and Sac I restriction enzymes) using the ClonExpress II One Step Cloning Kit (Vazyme, Nanjing, China) to generate a pTRV2-IdChlH vector.

2.4. Agroinfiltration of the Ilex Plant

pTRV1, pTRV2, and pTRV2-IdChlH were introduced into Agrobacterium strain GV3101 using the freeze-thaw method [23], separately. PCR-verified single Agrobacterium cells were independently inoculated into 2 mL LB medium containing 50 µg/mL kanamycin and 50 µg/mL rifampicin, and cultured overnight at 28 °C in a shaker. These overnight starters were subsequently inoculated into 50 mL cultures (containing 50 µg/mL kanamycin, 50 µg/mL rifampicin, 10 mM MES, and 20 µM acetosyringone), and shaken overnight at 28 °C. After that, Agrobacterium cultures were centrifuged at 6000 rpm for 10 min, resuspended in an infiltration buffer (10 mM MES, 10 mM MgCl2, and 200 µM acetosyringone, pH 5.6), adjusted to an OD600 of 1.8 and incubated at room temperature for 3–4 h in the dark. Agrobacterium cultures containing pTRV1 and pTRV2 or pTRV2-IdChlH were mixed in a 1:1 ratio before infiltration [10]. Ilex plants were inoculated using the leaf syringe-infiltration method [24]. The underside of the I. dabieshanensis leaves were pierced gently using a needle and then infiltrated with the mixed bacterial solution using a 1 mL needleless syringe. Subsequently, infiltrated and non-injected control plants were grown in a growth chamber under a 16 h light/8 h dark cycle at 25/23 °C and 70% relative humidity.

2.5. Expression Analysis by qRT-PCR

To determine the effect of the VIGS system on endogenous IdChlH gene expression in I. dabieshanensis, qRT-PCR was performed using the primer pair qIdChlH-F/R listed in Table 1. For the experiments, leaves from plants exhibiting the visible silencing phenotype were collected after three weeks of VIGS treatment; additionally, leaves were collected from the TRV2 empty vector-infected plants (mock plants) and untreated plants (control plants), separately. Four plant groups (exhibiting a significant yellow-leaf phenotype), one mock group, and one control group, were used for qRT-PCR analysis. Each group included three independent biological replicates of three different plants. Total RNA was extracted from the leaf samples using the Quick RNA Isolation Kit (Huayueyang, Beijing China), and treated with RNase-free DNase I to remove genomic DNA. A 1μg amount of total RNA was reverse transcribed into ss cDNA using SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Transcript abundance was assessed with an ABI 7500 Fast System using SYBR Premix Ex Taq™ (TaKaRa, Nojihigashi, Japan). To prevent interference with the inserted plant gene sequence, the specific primer pair IdChlH-qd-F/R was designed to amplify a region of the targeted transcript outside of the fragment cloned into the VIGS vector (Table 1). The actin gene was used as an endogenous control to normalize the results. All experiments were repeated three times. The relative transcript abundance was calculated using the 2-ΔΔCt method [25].

2.6. Statistical Analysis

The experimental data were analyzed by one-way analysis of variance and Duncan’s multiple range test (p < 0.01) using SPSS Statistics v. 25.0.

3. Results

3.1. IdChlH Sequence Characteristics

The amino acid sequence alignment showed that IdChlH was highly homologous to other known ChlH proteins, with a similarity of 92.62% to CsChlH (AEI83420.1) from Camellia sinensis, 92.25% to CiChlH (XP_042945153.1) from Carya illinoinensis, 92.11% to VvChlH (NP_001268078.1) from Vitis vinifera, and 85.9% to AtChlH (AT5G13630) from Arabidopsis thaliana (Figure 1). The phylogenetic analysis indicated that IdChlH was most closely related to CsChlH (Figure 2).

3.2. Construction of the pTRV2-IdChlH Vector

To generate the pTRV2-IdChlH vector, a 442 bp fragment of IdChlH with BamHI and SacI restriction sites was amplified (Figure 3) and subsequently ligated into the pTRV2 vector (Figure 4). PCR verification was performed using pTRV2-IdChlH as the template to investigate the accuracy of pTRV2-IdChlH construction (Figure S2A). In addition, the pTRV2-IdChlH plasmid was sequenced to further verify the result. Alignment of the sequencing result of pTRV2-IdChlH and the inserted IdChlH fragment showed that the two sequences shared 100% similarity (Figure S2B). Consequently, the results indicated that the pTRV2-IdChlH vectors were constructed accurately.

3.3. VIGS-Mediated Silencing of the IdChlH Gene in I. dabieshanensis

In this study, forty-six uniformly-sized I. dabieshanensis plants were inoculated with Agrobacterium strain GV3101 containing the pTRV2-ChlH vector. All treated plants survived, suggesting that this method was suitable for the tested plants. Approximately 14 days post infiltration (dpi), the yellow-leaf phenotype started appearing in the newly developed leaves of the plants partially treated with pTRV2-ChlH vector. At 21 dpi, 84.8% of the treated I. dabieshanensis plants showed a yellow-leaf phenotype in all newly developed leaves (Table 2; Figure 5A). Additionally, compared with the control plants, the plants infiltrated with pTRV1 and pTRV2 (Mock) showed no significant differences in leaf phenotype at 21 dpi (Figure 5B,C). Figure 5D shows the leaves collected from plants inoculated with the pTRV2-ChlH vector, empty vector-infected plant (Mock), and the control plant (CK), separately. These results suggest that yellow-leaf phenotypes might be induced by the silencing of the endogenous IdChlH gene.

3.4. qRT-PCR Analysis

To further investigate the efficiency of gene silencing, the transcript levels of IdChlH in plants inoculated with pTRV2-IdChlH were detected using qRT-PCR. The IdChlH transcript levels reduced by 77.2%–83.8% in the silenced plant leaves compared to control plant leaves (Figure 6). Furthermore, the IdChlH transcript levels in the control and mock-infected leaves were similar (Figure 6). The phenotypic characteristics were consistent with the expression profile of IdChlH. These results indicated that pTRV2-IdChlH could induce the yellow-leaf phenotype by silencing endogenous IdChlH in I. dabieshanensis.

4. Discussion

Gene function studies have promoted an in-depth understanding of the molecular mechanisms in plants. However, identifying gene functions in woody plants is challenging and time-consuming using traditional genetic transformation. VIGS is an effective tool for characterizing gene functions in plenty of herbaceous plant species [16,18,20,26]. Recently, the application of VIGS has been successfully extended to some woody plants, such as Vitis vinifera [27], Vernicia fordii [28], and Rosaceae fruit trees [29]. However, the VIGS has rarely been investigated in many other woody plants, due to the lack of a compatible VIGS vector [28,30]. To date, there are only a few VIGS-inducing virus vectors which have been tested in woody plants, including apple latent spherical virus (ALSV) [29], grapevine leafroll-associated virus-2 (GLRaV-2) [27], poplar mosaic virus (PopMV) [31], plum pox virus (PPV) [32], and TRV vector [28]. Among them, TRV is the most widely used VIGS vector because of its wide host range and relatively mild symptoms of infection [28,33]. However, it is unknown whether TRV-based VIGS can be used to dissect gene functions in I. dabieshanensis. The present study reported the first application of a TRV-based VIGS system in I. dabieshanensis. This tree species has a long growth cycle, and its genetic transformation process is laborious and technically challenging. Therefore, developing a rapid and effective transformation system is important for gene function analysis in I. dabieshanensis. We herein described a TRV-based VIGS system for efficient silencing of endogenous genes in I. dabieshanensis. In the future, this system has the potential to provide a powerful tool for the large-scale reverse-genetic analysis of gene functions in I. dabieshanensis.
The ChlH gene encodes the H subunit of magnesium chelatase, which is involved in chlorophyll biosynthesis, and has been widely used as an indicator gene of VIGS because its silencing generates a yellow-leaf phenotype [13,24,34]. In this study, multiple sequence alignment showed that IdChlH was considerably similar with the ChlH proteins of other plant species. Furthermore, a phylogenetic tree showed that IdChlH was highly similar to CsChlH acquired from Camellia sinensis. Here, we adapted a TRV-based VIGS system that could reveal the function of the ChlH gene in I. dabieshanensis. Our results showed that newly developed leaves exhibited the silencing phenotype after VIGS treatment, suggesting the establishment of systemic TRV viral infection in I. dabieshanensis.
Previous studies have shown that the most effective and cost-effective way to inoculate plants with viral vectors is agroinfection [35], but its efficiency varies among different plant species. In rice, 77% of plants agroinfected with pRTBV-MVIGS-PDS showed a white streak leaf phenotype; moreover, the silencing efficiency of RTBV-VIGS in Cynodon dactylon was compared with that of rice, wherein 65.8%–72.5% of the agroinoculated seedlings showed symptoms typical of PDS gene silencing, while the silencing efficiency in Zoysia japonica was much lower, with only 52.7%–55% agroinoculated seedlings showing white streak leaf symptoms [36]. Further, Jiang et al. [28] tested the feasibility of the TRV vector to directly infect woody plant species, and found that TRV-mediated VIGS was effectively elicited in Vernicia fordii, weakly in white poplar hybrid, but not in Camellia oleifera. Mustafa et al. [14] showed that TRV-mediated silencing was complete in Gossypium hirsutum and G. arboretum, but the silencing efficiency differed for each G. hirsutum variety. In our study, 84.8% of the agroinoculated plants developed a yellow-leaf phenotype, indicating that the silencing efficiency of TRV-based VIGS in the Ilex plant was high. Furthermore, qRT-PCR showed that the IdChlH transcripts were significantly decreased in the silenced plant leaves. However, the efficiency of TRV-based VIGS and the subsequent recovery varied between woody species [14,28]. Therefore, specific VIGS treatment conditions need to be screened and optimized for other holly species of interest in the future. Overall, our VIGS system described here will pave an important way for gene function studies in I. dabieshanensis.

5. Conclusions

In conclusion, we established a TRV-based VIGS system that could effectively silence genes in I. dabieshanensis, which increases the growing list of woody plant species that can be used for VIGS-mediated research. This established system provides a powerful tool for functional genomic studies on I. dabieshanensis. In future, the TRV-based VIGS system will be used to determine the functions of genes related to fruit development, synthesis of medicinal components, and stress resistance in I. dabieshanensis.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/f14030488/s1, Figure S1. Location of the I. dabieshanensis sample. Figure S2. Verification of the construction of the pTRV2-IdChlH vector. (A). Detection of pTRV2-IdChlH plasmid. M: 2000 DNA marker; 1–7: PCR verification of pTRV2-IdChlH monoclonal bacterial solution. (B) Alignment of the sequencing result of pTRV2-IdChlH and the inserted IdChlH fragment. C-A: sequencing result of pTRV2-IdChlH plasmid; C-B: sequencing result of insert IdChlH fragment.

Author Contributions

X.C. and H.C. conceived and designed the project. Y.W., X.X. and F.Z. performed the experiments. C.W., Y.Z. and T.Z. prepared the figures and/or tables. X.C. wrote the manuscript. Y.L., X.L. and H.C. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Jiangsu Institute of Botany Talent Fund [JIBTF202110], Jiangsu Agricultural Science and Technology Innovation Fund [CX(21)3020], Open Fund of Jiangsu Key Laboratory for the Research and Utilization of Plant Resources [JSPKLB202209].

Data Availability Statement

The data are available from the corresponding author upon request.

Conflicts of Interest

The authors declare no competing interests.

References

  1. Su, T.; Zhang, M.; Shan, Z.; Li, X.; Han, M. Comparative survey of morphological variations and plastid genome sequencing reveals phylogenetic divergence between four endemic Ilex species. Forests 2020, 11, 964. [Google Scholar] [CrossRef]
  2. Chong, X.; Li, Y.; Yan, M.; Wang, Y.; Li, M.; Zhou, Y.; Chen, H.; Lu, X.; Zhang, F. Comparative chloroplast genome analysis of 10 Ilex species and the development of species-specific identification markers. Ind. Crops Prod. 2022, 187, 115408. [Google Scholar] [CrossRef]
  3. Yao, X.; Zhang, F.; Corlett, R.T. Utilization of the Hollies (Ilex L. spp.): A Review. Forests 2022, 13, 94. [Google Scholar] [CrossRef]
  4. Manen, J.; Barriera, G.; Loizeau, P.; Naciri, Y. The history of extant Ilex species (Aquifoliaceae): Evidence of hybridization within a Miocene radiation. Mol. Phylogenet. Evol. 2010, 57, 961–977. [Google Scholar] [CrossRef] [PubMed]
  5. Yao, X.; Song, Y.; Yang, J.B.; Tan, Y.H.; Corlett, R.T. Phylogeny and biogeography of the hollies (Ilex L., Aquifoliaceae). J. Syst. Evol. 2020, 59, 73–82. [Google Scholar] [CrossRef] [Green Version]
  6. Shi, L.; Li, N.; Wang, S.; Zhou, Y.; Huang, W.; Yang, Y.; Ma, Y.; Zhou, R. Molecular evidence for the hybrid origin of Ilex dabieshanensis (Aquifoliaceae). PloS ONE 2016, 11, e0147825. [Google Scholar] [CrossRef] [PubMed]
  7. Zhou, T.; Ning, K.; Mo, Z.; Zhang, F.; Zhou, Y.; Chong, X.; Zhang, D.; El-Kassaby, Y.; Bian, J.; Chen, H. Complete chloroplast genome of Ilex dabieshanensis: Genome structure, comparative analyses with three traditional Ilex tea species, and its phylogenetic relationships within the family Aquifoliaceae. PloS ONE 2022, 17, e0268679. [Google Scholar] [CrossRef]
  8. Burch-Smith, T.; Anderson, J.; Martin, G.; Dinesh-Kumar, S. Applications and advantages of virus-induced gene silencing for gene function studies in plants. Plant J. 2004, 39, 734–746. [Google Scholar] [CrossRef]
  9. Baulcombe, D. Fast forward genetics based on virus-induced gene silencing. Curr. Opin. Plant Biol. 1999, 2, 109–113. [Google Scholar] [CrossRef]
  10. Zhou, P.; Peng, J.; Zeng, M.; Wu, L.; Fan, Y.; Zeng, L. Virus-induced gene silencing (VIGS) in Chinese narcissus and its use in functional analysis of NtMYB3. Hortic. Plant J. 2021, 7, 565–572. [Google Scholar] [CrossRef]
  11. Dommes, A.; Gross, T.; Herbert, D.; Kivivirta, K.; Becker, A. Virus-induced gene silencing: Empowering genetics in non-model organisms. J. Exp. Bot. 2019, 70, 757–770. [Google Scholar] [CrossRef] [PubMed]
  12. Senthil-Kumar, M.; Mysore, K. New dimensions for VIGS in plant functional genomics. Trends Plant Sci. 2011, 16, 656–665. [Google Scholar] [CrossRef] [PubMed]
  13. Tuo, D.; Yan, P.; Zhao, G.; Cui, H.; Zhu, G.; Liu, Y.; Yang, X.; Wang, H.; Li, X.; Shen, W.; et al. An efficient papaya leaf distortion mosaic potyvirus vector for virus-induced gene silencing in papaya. Hortic. Res. 2021, 8, 144. [Google Scholar] [CrossRef] [PubMed]
  14. Mustafa, R.; Shafiq, M.; Mansoor, S.; Briddon, R.; Scheffler, B.; Scheffler, J.; Amin, I. Virus-induced gene silencing in cultivated cotton (Gossypium spp.) using tobacco rattle virus. Mol. Biotechnol. 2016, 58, 65–72. [Google Scholar] [CrossRef]
  15. Ratcliff, F.; Martin-Hernandez, A.; Baulcombe, D. Tobacco rattle virus as a vector for analysis of gene function by silencing. Plant J. 2001, 25, 237–245. [Google Scholar] [CrossRef]
  16. Liu, Y.; Schiff, M.; Dinesh-Kumar, S. Virus-induced gene silencing in tomato. Plant J. 2002, 31, 777–786. [Google Scholar] [CrossRef]
  17. Andres, R.; Coneva, V.; Frank, M.; Tuttle, J.; Samayoa, L.; Han, S.; Kaur, B.; Zhu, L.; Fang, H.; Bowman, D.; et al. Modifications to a LATE MERISTEM IDENTITY1 gene are responsible for the major leaf shapes of Upland cotton (Gossypium hirsutum L.). Proc. Natl. Acad. Sci. USA 2017, 114, E57–E66. [Google Scholar] [CrossRef] [Green Version]
  18. Burch-Smith, T.; Schiff, M.; Liu, Y.; Dinesh-Kumar, S. Efficient virus-induced gene silencing in Arabidopsis. Plant Physiol. 2006, 142, 21–27. [Google Scholar] [CrossRef] [Green Version]
  19. Yan, H.; Shi, S.; Ma, N.; Cao, X.; Zhang, H.; Qiu, X.; Wang, Q.; Jian, H.; Zhou, N.; Zhang, Z.; et al. Graft-accelerated virus-induced gene silencing facilitates functional genomics in rose flowers. J. Integr. Plant Biol. 2018, 60, 34–44. [Google Scholar] [CrossRef]
  20. Chen, J.; Jiang, C.; Gookin, T.; Hunter, D.; Clark, D.; Reid, M. Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence. Plant Mol. Biol. 2004, 55, 521–530. [Google Scholar] [CrossRef]
  21. Yan, H.; Fu, D.; Zhu, B.; Liu, H.; Shen, X.; Luo, Y. Sprout vacuum-infiltration: A simple and efficient agroinoculation method for virus-induced gene silencing in diverse solanaceous species. Plant Cell Rep. 2012, 31, 1713–1722. [Google Scholar] [CrossRef] [PubMed]
  22. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [Green Version]
  23. Höfgen, R.; Willmitzer, L. Storage of competent cells for Agrobacterium transformation. Nucleic Acids Res. 1988, 16, 9877. [Google Scholar] [CrossRef] [Green Version]
  24. Xu, H.; Xu, L.; Yang, P.; Cao, Y.; Tang, Y.; He, G.; Yuan, S.; Ming, J. Tobacco rattle virus-induced PHYTOENE DESATURASE (PDS) and Mg-chelatase H subunit (ChlH) gene silencing in Solanum pseudocapsicum L. PeerJ 2018, 6, e4424. [Google Scholar] [CrossRef] [Green Version]
  25. Livak, K.; Schmittgen, T. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  26. Scofield, S.; Huang, L.; Brandt, A.; Gill, B. Development of a virus-induced gene-silencing system for hexaploid wheat and its use in functional analysis of the Lr21-mediated leaf rust resistance pathway. Plant Physiol. 2005, 138, 2165–2173. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Kurth, E.; Peremyslov, V.; Prokhnevsky, A.; Kasschau, K.; Miller, M.; Carrington, J.; Dolja, V. Virus-derived gene expression and RNA interference vector for grapevine. J. Virol. 2012, 86, 6002–6009. [Google Scholar] [CrossRef] [Green Version]
  28. Jiang, Y.; Ye, S.; Wang, L.; Duan, Y.; Lu, W.; Liu, H.; Fan, D.; Zhang, F.; Luo, K. Heterologous gene silencing induced by tobacco rattle virus (TRV) is efficient for pursuing functional genomics studies in woody plants. Plant Cell Tiss. Organ Cult. 2014, 116, 163–174. [Google Scholar] [CrossRef]
  29. Sasaki, S.; Yamagishi, N.; Yoshikawa, N. Efficient virus-induced gene silencing in apple, pear and Japanese pear using Apple latent spherical virus vectors. Plant Methods 2011, 7, 15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Robertson, D. VIGS vectors for gene silencing: Many targets, many tools. Annu. Rev. Plant Biol. 2004, 55, 495–519. [Google Scholar] [CrossRef]
  31. Naylor, M.; Reeves, J.; Cooper, J.; Edwards, M.; Wang, H. Construction and properties of a gene-silencing vector based on Poplar mosaic virus (genus Carlavirus). J. Virol. Methods 2005, 124, 27–36. [Google Scholar] [CrossRef] [PubMed]
  32. Lansac, M.; Eyquard, J.; Salvador, B.; Garcia, J.; Le Gall, O.; Decroocq, V.; Schurdi-Levraud Escalettes, V. Application of GFP-tagged Plum pox virus to study Prunus-PPV interactions at the whole plant and cellular levels. J. Virol. Methods 2005, 129, 125–133. [Google Scholar] [CrossRef] [PubMed]
  33. Shen, Z.; Sun, J.; Yao, J.; Wang, S.; Ding, M.; Zhang, H.; Qian, Z.; Zhao, N.; Sa, G.; Zhao, R.; et al. High rates of virus-induced gene silencing by tobacco rattle virus in Populus. Tree Physiol. 2015, 35, 1016–1029. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Liu, H.; Fu, D.; Zhu, B.; Yan, H.; Shen, X.; Zuo, J.; Zhu, Y.; Luo, Y. Virus-induced gene silencing in eggplant (Solanum melongena). J. Integr. Plant Biol. 2012, 54, 422–429. [Google Scholar] [CrossRef]
  35. Grimsley, N.; Hohn, B.; Hohn, T.; Walden, R. “Agroinfection,” an alternative route for viral infection of plants by using the Ti plasmid. Proc. Natl. Acad. Sci. USA 1986, 83, 3282–3286. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Zhang, B.; Shi, J.-A.; Chen, J.-B.; Li, D.-D.; Li, J.-J.; Guo, H.-L.; Zong, J.-Q.; Wang, Y.; Guo, A.-G.; Liu, J.-X. Efficient virus-induced gene silencing in Cynodon dactylon and Zoysia japonica using rice tungro bacilliform virus vectors. Sci. Hortic. 2016, 207, 97–103. [Google Scholar] [CrossRef]
Forests 14 00488 g001 550
Figure 1. Alignment of the putative amino acid sequence of IdChlH with homologous proteins.
Figure 1. Alignment of the putative amino acid sequence of IdChlH with homologous proteins.
Forests 14 00488 g001
Forests 14 00488 g002 550
Figure 2. Phylogenetic analysis of IdChlH (black triangle) and ChlH proteins from other species. The accession numbers of the proteins are CsChlH (AEI83420.1), CiChlH (XP_042945153.1), VvChlH (NP_001268078.1), PtChlH (XP_024459042.1), GmChlH (XP_003535922.1), JrChlH (XP_018816348.1), GhChlH (XP_040932511.1), QsChlH (XP_023922908.1), and AtChlH(AT5G13630).
Figure 2. Phylogenetic analysis of IdChlH (black triangle) and ChlH proteins from other species. The accession numbers of the proteins are CsChlH (AEI83420.1), CiChlH (XP_042945153.1), VvChlH (NP_001268078.1), PtChlH (XP_024459042.1), GmChlH (XP_003535922.1), JrChlH (XP_018816348.1), GhChlH (XP_040932511.1), QsChlH (XP_023922908.1), and AtChlH(AT5G13630).
Forests 14 00488 g002
Forests 14 00488 g003 550
Figure 3. Cloning of IdChlH gene specific fragment in I. dabieshanensis. M: 2000 DNA marker.
Figure 3. Cloning of IdChlH gene specific fragment in I. dabieshanensis. M: 2000 DNA marker.
Forests 14 00488 g003
Forests 14 00488 g004 550
Figure 4. TRV-based VIGS vectors and construction. pTRV2-IdChLH were constructed to analyze the ability of TRV vectors to silence endogenous IdChLH gene in I. dabieshanensis.
Figure 4. TRV-based VIGS vectors and construction. pTRV2-IdChLH were constructed to analyze the ability of TRV vectors to silence endogenous IdChLH gene in I. dabieshanensis.
Forests 14 00488 g004
Forests 14 00488 g005 550
Figure 5. TRV-mediated IdChlH gene silencing in I. dabieshanensis. (A) I. dabieshanensis plants infected with pTRV2-IdChlH exhibiting yellow-leaf phenotype in newly developed leaves at 21 days post infiltration (dpi). (B) Empty vector-infected plants (Mock) with the normal phenotype. (C) Control plants (CK). (D) Leaf phenotypes after various VIGS treatments. Photographs were taken at 21 dpi.
Figure 5. TRV-mediated IdChlH gene silencing in I. dabieshanensis. (A) I. dabieshanensis plants infected with pTRV2-IdChlH exhibiting yellow-leaf phenotype in newly developed leaves at 21 days post infiltration (dpi). (B) Empty vector-infected plants (Mock) with the normal phenotype. (C) Control plants (CK). (D) Leaf phenotypes after various VIGS treatments. Photographs were taken at 21 dpi.
Forests 14 00488 g005
Forests 14 00488 g006 550
Figure 6. Relative expression levels of IdChlH in the leaves of plants exhibiting the silenced phenotype (pTRV2-IdChlH), empty vector-infected plants (Mock), and control plants (CK). The error bars represent the ± standard error of three replicates. Asterisks indicate statistically significant differences according to Duncan’s multiple range test (** p < 0.01).
Figure 6. Relative expression levels of IdChlH in the leaves of plants exhibiting the silenced phenotype (pTRV2-IdChlH), empty vector-infected plants (Mock), and control plants (CK). The error bars represent the ± standard error of three replicates. Asterisks indicate statistically significant differences according to Duncan’s multiple range test (** p < 0.01).
Forests 14 00488 g006
Table
Table 1. List of primers used in this study.
Table 1. List of primers used in this study.
Prime NamePrimer Sequence (5′ to 3′)
IdChlH-FGAAGGCCTCCATGGGGATCCGCGCTGGATCCACAATCTATTC
IdChlH-RCGAGACGCGTGAGCTCCTCTAACCTCAACGCCAAGCGC
IdChlH-qd-FTTCTTCGTGGAATGATGAGA
IdChlH-qd-RCCGTGAGTGAGATTTCTGA
Actin-FCCACCTACAACTCCATCAT
Actin-RTTCCTTGCTCATACGATCA
Note: Underlines indicate restriction enzyme cleavage sites and partial homologous sequences of the pTRV2 vector used in this TRV-VIGS system.
Table
Table 2. Silencing efficiency of IdChlH in I. dabieshanensis using TRV-based VIGS system at 21 dpi.
Table 2. Silencing efficiency of IdChlH in I. dabieshanensis using TRV-based VIGS system at 21 dpi.
TableNumber of Treated PlantsSilencing Efficiency a
pTRV2-IdChlH4639/46 (84.8%)
Mock90/9 (0%)
Control90/9 (0%)
a Number of plants exhibiting silencing phenotypes/number of treated plants.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chong, X.; Wang, Y.; Xu, X.; Zhang, F.; Wang, C.; Zhou, Y.; Zhou, T.; Li, Y.; Lu, X.; Chen, H. Efficient Virus-Induced Gene Silencing in Ilex dabieshanensis Using Tobacco Rattle Virus. Forests 2023, 14, 488. https://doi.org/10.3390/f14030488

AMA Style

Chong X, Wang Y, Xu X, Zhang F, Wang C, Zhou Y, Zhou T, Li Y, Lu X, Chen H. Efficient Virus-Induced Gene Silencing in Ilex dabieshanensis Using Tobacco Rattle Virus. Forests. 2023; 14(3):488. https://doi.org/10.3390/f14030488

Chicago/Turabian Style

Chong, Xinran, Yue Wang, Xiaoyang Xu, Fan Zhang, Chuanyong Wang, Yanwei Zhou, Ting Zhou, Yunlong Li, Xiaoqing Lu, and Hong Chen. 2023. "Efficient Virus-Induced Gene Silencing in Ilex dabieshanensis Using Tobacco Rattle Virus" Forests 14, no. 3: 488. https://doi.org/10.3390/f14030488

APA Style

Chong, X., Wang, Y., Xu, X., Zhang, F., Wang, C., Zhou, Y., Zhou, T., Li, Y., Lu, X., & Chen, H. (2023). Efficient Virus-Induced Gene Silencing in Ilex dabieshanensis Using Tobacco Rattle Virus. Forests, 14(3), 488. https://doi.org/10.3390/f14030488

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop