Next Article in Journal
Effect of Solubilizing Group on the Antibacterial Activity of Heptamethine Cyanine Photosensitizers
Next Article in Special Issue
Recent Progress of Rational Modified Nanocarriers for Cytosolic Protein Delivery
Previous Article in Journal
Novel Nanoparticle-Based Treatment and Imaging Modalities
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pharmaceutics
Volume 15
Issue 1
10.3390/pharmaceutics15010245
pharmaceutics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Fe3O4 Nanoparticles in Combination with 5-FU Exert Antitumor Effects Superior to Those of the Active Drug in a Colon Cancer Cell Model

by
Sidika Genc
1,
Ali Taghizadehghalehjoughi
1,*,
Yesim Yeni
2,
Abbas Jafarizad
3,
Ahmet Hacimuftuoglu
2,
Dragana Nikitovic
4,
Anca Oana Docea
5,*,
Yaroslav Mezhuev
6 and
Aristidis Tsatsakis
7
1
Department of Medical Pharmacology, Faculty of Medicine, Bilecik Seyh Edebali University, Bilecik 11230, Turkey
2
Department of Pharmacology, Faculty of Medicine, Ataturk University, Erzurum 25240, Turkey
3
Faculty of Chemical Engineering, Sahand University of Technology, Tabriz 51335-1996, Iran
4
Laboratory of Histology-Embryology, Medical School, University of Crete, 71003 Heraklion, Greece
5
Department of Toxicology, University of Medicine and Pharmacy of Craiova, 200349 Craiova, Romania
6
Center of Biomaterials, D. Mendeleev University of Chemical Technology of Russia, 125047 Moscow, Russia
7
Department of Forensic Sciences and Toxicology, Faculty of Medicine, University of Crete, 71003 Heraklion, Greece
*
Authors to whom correspondence should be addressed.
Pharmaceutics 2023, 15(1), 245; https://doi.org/10.3390/pharmaceutics15010245
Submission received: 27 November 2022 / Revised: 5 January 2023 / Accepted: 7 January 2023 / Published: 11 January 2023
(This article belongs to the Special Issue Combination Therapeutic Delivery Systems)
Browse Figures
Versions Notes

Abstract

:
(1) Background: Colon cancer is one of the most common cancer types, and treatment options, unfortunately, do not continually improve the survival rate of patients. With the unprecedented development of nanotechnologies, nanomedicine has become a significant direction in cancer research. Indeed, chemotherapeutics with nanoparticles (NPs) in cancer treatment is an outstanding new treatment principle. (2) Methods: Fe3O4 NPs were synthesized and characterized. Caco-2 colon cancer cells were treated during two different periods (24 and 72 h) with Fe3O4 NPs (6 μg/mL), various concentrations of 5-FU (4–16 μg/mL), and Fe3O4 NPs in combination with 5-FU (4–16 μg/mL) (Fe3O4 NPs + 5-FU). (3) Results: The MTT assay showed that treating the cells with Fe3O4 NPs + 5-FU at 16 µg/mL for 24 or 72 h decreased cell viability and increased their LDH release (p < 0.05 and p < 0.01, respectively). Furthermore, at the same treatment concentrations, total antioxidant capacity (TAC) was decreased (p < 0.05 and p < 0.01, respectively), and total oxidant status (TOS) increased (p < 0.05 and p < 0.01, respectively). Moreover, after treatment with Fe3O4-NPs + 5-FU, the IL-10 gene was downregulated and PTEN gene expression was upregulated (p < 0.05 and p < 0.01, respectively) compared with those of the control. (4) Conclusions: Fe3O4 NPs exert a synergistic cytotoxic effect with 5-FU on Caco-2 cells at concentrations below the active drug threshold levels.

1. Introduction

Colon cancer is the third most common malignancy and represents the second most common cause of cancer death despite advances in diagnosis and treatment [1]. One of the key distinguishing features of colon cancer is the loss of cellular organization and the increased ability to invade near and distant sites. The standard treatment principle encompasses chemotherapy, surgery, and radiotherapy according to the type and stage of the disease. However, the gene-type signature of the cancer tissue alters the neoplasm response to therapy regimens [2]. Thus, the 5-year survival of colon cancer patients remains at 64%, and efficient therapy, with attenuated side effects, remains a significant unmet health need [3].
5-Fluorouracil (5-FU), an antineoplastic agent, is used to treat colon cancer by inhibiting the S phase of the cell cycle, thereby blocking DNA synthesis and triggering cell death [4,5]. However, due to its short half-life (5–14 min), poor membrane permeability, and rapid metabolism, high doses must be continuously administered to maintain a minimum therapeutic serum concentration, which often entails numerous side effects and severe toxicity [6,7,8]. Indeed, chemotherapeutics that prevent DNA synthesis can incur lethal side effects in rapidly dividing healthy tissues, including intestinal epithelium and blood cells [9].
Numerous studies have demonstrated that NPs significantly increase the drug uptake of cancer cells, thus improving the limitations of current chemotherapeutic agents [10]. Different metal NPs, including AU, TiO, Fe3O4, Pt, ZnO, and Mg NPs, were previously tested in various cancer models [11,12]. In addition, Fe3O4 nanoparticles (Fe3O4-NPs), or magnetite NPs, exhibit magnetic properties and have lately received approval from the Food and Drug Administration (FDA) for utilization in magnetic resonance imaging (MRI) [13].
Notably, metal NPs can enhance the accumulation of active drugs in a passive and active manner. For example, cancer tissues exhibit leaky vasculature with pore sizes reaching hundreds of nanometers, which enables the passive accumulation of inert metal NPs [14]. This mechanism is called the increased permeability and retention (EPR) effect. Furthermore, introducing functional modifications on the metal NP’s surface will result in specific tissue targeting [15]. Indeed, incorporating specific ligands for tumor targeting, including peptides, antibodies, glycans, or folic acid, can increase drug release to tumor cells [16].
Notably, in some models, Fe3O4 metal oxides and their various composites [17,18] exhibit cytotoxic and genotoxic properties, resulting in DNA fragmentation, disturbance in the integrity of the mitochondrial membrane, and cell necrosis, as well as alterations in oncogene expression.
Furthermore, Fe3O4/composite nanomaterials enhanced reactive oxygen species (ROS) production and oxidative stress-inducing cell apoptosis [19]. Another exciting aspect of iron oxide action is its immunomodulatory effects. Thus, the inflammatory response of neutrophils in a vascular mimetic model is attenuated upon the uptake of iron oxide NPs [20]. Cytokines play a critical role in regulating the host cell’s immune response to cancer and the mechanism of tumorigenesis [21]. Interleukin-10 (IL-10), an important cytokine secreted by various cell types, including macrophages, monocytes, neutrophils, and endothelial cells [22], was shown to affect the homeostasis of the intestinal epithelium. Notably, IL-10 is a crucial inhibitor of the immune response harnessed by various tumors to evade the immune system [19,23,24].
Phosphatase and tensin homolog (PTEN) is a protein tyrosine phosphatase expressed in humans [25]. PTEN has been characterized as a key tumor suppressor gene due to its ability to downregulate phosphatidylinositol 3-kinase (PI3K) and downstream Akt/mTOR signaling crucial to the modulation of cell growth [26,27]. Furthermore, both loss and partial/complete inactivation of PTEN expression have been identified in many cancers, allowing its characterization as an oncogene [27]. Indeed, PTEN inactivation/loss is one of the most frequent genetic alterations in sporadic cancer [27]. Heterogeneous PTEN hamartoma tumor syndrome (PHTS), due to pathogenic variants in the PTEN onco-suppressor gene, strongly correlates with colon cancer incidence [28]. Notably, in vivo colon cancer models demonstrated that efficient anticancer therapy increased PTEN expression [29].
In the current study, we evaluated the effects of the Fe3O4-NPs + 5-FU combination on cell viability, oxidative stress, cytokine, and oncogene expression in a Caco-2 colon cancer cell model. Our data demonstrated that the Fe3O4-NPs + 5-FU combination exerts anticancer effects at concentrations at which the active drug, 5-FU, is ineffective. Furthermore, this article shows that the combined administration of Fe3O4 nanoparticles with 5-FU without its prior immobilization significantly increased the antitumor activity and reduced the therapeutic dose of 5-FU.

2. Materials and Methods

2.1. Chemicals and Reagents

5-FU was obtained from Deva A.S (Istanbul, Turkey). Fe (acac)3, phosphate-buffered solution (PBS), Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), trypsin (with EDTA), antibiotic, oleyl amine, and dibenzyl ether were supplied by Sigma-Aldrich (St. Louis, MO, USA).

2.2. Fe3O4 Nanoparticles Synthesis

Iron (III) acetylacetonate (Fe (acac)3, 1.06 g) was dissolved in a mixture of oleyl amine (15 mL) and dibenzyl ether (15 mL) under continuous stirring in a four-necked round-bottom glass reactor. The mixture was heated to 120 °C and held at the same temperature for 1 h to remove moisture under a stream of nitrogen gas. The mixing process continued throughout all stages. After one hour, the mixture temperature was rapidly increased to 300 °C, and the reaction was continued at this temperature for an 1 h. Finally, ethanol (3 × 40 mL) was added to the mixture, which was centrifuged at 8500 rpm for 12 min. After purification, Fe3O4 NPs were dispersed in hexane (10 mL). Figure 1B shows a representative SEM image of the prepared Fe3O4 NPs [30,31].

2.3. Fe3O4 Nanoparticles Characterization

The scanning electron microscope (SEM) images were obtained using an FEI Quanta 450 (USA). Dynamic light scattering (DLS) experiments were performed utilizing a Zetasizer Quinta Nano ZS90 (Malvern Instruments, Malvern, UK) at room temperature. Samples were prepared as 0.5% (w/v) solutions in DDW.
The Fourier transform infrared (FTIR) spectrum of the Fe3O4 NPs was obtained with a Shimadzu 8101 M FTIR (Kyoto, Japan) using the potassium bromide (KBr) pellet technique. The powder X-ray diffraction (XRD) pattern of the Fe3O4 NPs was obtained using a Siemens D5000 diffractometer (Aubrey, TX, USA) and an X-ray generator (CuKα radiation with λ = 1.5406 Å) at room temperature [31].

2.4. Cell Cultures

2.4.1. Caco-2 Cell Culture

Caco-2 (HTB-37™) cells were obtained from ATCC. The cells were cultured in DMEM (1% antibiotic (amphotericin B, penicillin, and streptomycin) and 10% FBS), and held at the optimum conditions (5% CO2; 37 °C).

2.4.2. Cell Treatments

After the cells reached 85% confluency, they were harvested and seeded in 96-well plates (Corning, Corning, NY, USA) [32]. Treatments were determined as control, Fe3O4 NPs 6 μg/mL, 5-FU (4, 8, and 16 μg/mL), and a combination (Fe3O4 NPs + 5-FU). The cells were exposed to the various treatments for 24 or 72 h.

2.5. MTT Assay

At the end of the experiment (after 24 and 72 h of treatment), MTT solution (10 μL) was added to each well, and the cell number was determined. In short, the plates were incubated for 4 h in a CO2 incubator, to which 100 µL of DMSO solution was added to all wells. The spectrophotometer read the density at 570 nm [31].

2.6. Total Oxidant Status (TOS) and Total Antioxidant Capacity (TAC) Determination

Total oxidant status (TOS) and total antioxidant capacity (TAC) evaluations were performed spectrophotometrically (Multiskan ™ GO Microplate Spectrophotometer reader) as previously described [26]. The color density is correlated to the oxidant levels in a sample [33].

2.7. Lactate Dehydrogenase (LDH) Measurement

According to the manufacturer’s instructions, the lactate dehydrogenase (LDH) was determined with an LDH detection kit. In summary, Caco-2 cells were seeded in a 96-well plate at a density of 103–106 cells/well in 200 μL of the medium. Six wells were prepared for each concentration. Triton X-100 (10%) and the assay buffer were added, and the wells were incubated at room temperature for one hour. After centrifugation, the cell supernatant was transferred to a new 96-well assay plate. The LDH reaction solution was added to each well, and the plate was incubated with gentle shaking on an orbital shaker for 30 min at 37 °C. A microplate reader measured the absorbance OD value at 490 nm [34]. ((experimental value A490) − (spontaneous release A490))/((maximum release A490) − (spontaneous release A490)) × 100.
Maximum release: 100% dead cells by adding Triton X-100.
Spontaneous release: nontoxic materials (cell medium) control group.
Experiment value: application groups.

2.8. Gene Expression Determination

The total RNA from Caco-2 cells was used to synthesize complementary DNA (cDNA) using a high-capacity cDNA Reverse Transcription Kit. The sequences of the gene-specific PCR primers are listed below (forward and reverse). Results were compared with the control group and are expressed as relative fold. Gene expressions were normalized to beta actin using the ΔΔCt method.
Beat actin: CCAACCGCGAGAAGATGA′; CCAGAGGCGTACAGGGATAG′
PTEN: TGAGTTCCCTCAGCCGTTACCT′; GAGGTTTCCTCTGGTCCTGGTA′
IL-1β: TCTCAGATTCACAACTGTTCGTG′; AGAAAATGAGGTCGGTCTCACTA′
IL-10: GGCATGCTTGGCTCAGCACTG-3′; GCCCTGCAGTCCAGTAGACG′

2.9. Statistical Analyses

Statistical comparisons between the groups were calculated using one-way ANOVA and Tukey’s HSD method. All calculations were performed using SPSS 20 software for statistical analysis, and a p < 0.05 was considered a statistically significant difference in all tests. Results are presented as mean and standard deviation (mean ± SD).

3. Results

3.1. Characterization of Fe3O4 NPs

The synthesized Fe3O4 NPs were characterized using SEM and DLS analysis, as presented in Figure 1. The SEM image showed that the shape of the synthesized Fe3O4 NPs was spherical with an average diameter of 35 ± 5 nm. The DLS analysis revealed that the Fe3O4 NPs had an average size of ~32 nm. In addition, the polydispersity index (PDI) of the synthesized NPs was found to be 0.24, which indicated their relatively monodisperse synthesis.
The FTIR spectrum and XRD pattern of the Fe3O4 NPs are shown in Figure 2. The most prominent absorption bands in the FTIR spectrum are the stretching vibration of the metal–oxygen (Fe–O) group at 576 cm−1 and the stretching and bending vibrations of the surface hydroxyl groups at 3420 and 1608 cm−1, respectively (Figure 2a).
The crystallographic analysis of the synthesized Fe3O4 NPs was performed by XRD analysis, as depicted in Figure 2b. In the XRD model of Fe3O4 NPs, the characteristic peaks belonging to the XRD spectrum at 2θ = 30.6°, 36.1°, 43.1°, 52.6°, 57.7°, and 63.1° can be indexed at (220), (311), (400), (422), (511), and (440), respectively. This FTIR spectrum and XRD pattern confirm the successful synthesis of Fe3O4-NPs.

3.2. Evaluation of Caco-2 Cell Viability by MTT and LDH Assay

The effect of various treatments on Caco-2 cell viability was determined by the MTT assay after 24 and 72 h of treatment (Figure 3). Cell viability was considered as 100% in the control (negative control) and is expressed as a percentage of that of the control for all other treatments. Notably, DMSO and the nonloaded Fe3O4 NPs at 6 µg/mL did not affect the viability of Caco-2 cells. Treating the cells for 24 h with 5-FU 16 µg/mL exerted a nonsignificant 10% decrease in viability (p = NS), and the reduction (34%) was statistically significant after 72 h of treatment (p < 0.05). The effects of the Fe3O4-NPs + 5-FU combination on cell viability were more prominent. Thus, treating cells for 24 h with Fe3O4 NPs + 5-FU (16 µg/mL) decreased their viability to 31% (p < 0.05), whereas treating Caco-2 cells with Fe3O4 NPs + 5-FU (16 µg/mL) for 72 h resulted in a substantial decrease in their viability (41%) (p < 0.01).
Because LDH is released by necrotic cells, it is an excellent metabolic marker of cell viability. The effect of various treatments on Caco-2 cell LDH activity was determined by utilizing an LDH kit (Figure 3). The measured LDH activity of treated cells expressed as a percent of the standard (designated as 100%) is presented in Figure 4. Treating the cells with only Fe3O4-NPs and different concentrations of 5-FU did not affect their LDH activity. However, an increase in LDH activity, correlated with cell death, was demonstrated in cells treated with a combination of Fe3O4-NPs + 5-FU (8 µg/mL) for 72 h (p < 0.05) and cells treated with Fe3O4-NPs + 5FU (16 µg/mL) for 24 and 72 h, (p < 0.05 and p < 0.01), respectively. These data demonstrate that combining 5FU with Fe3O4-NPs significantly increased the active drug cytotoxic effect, even at concentrations below the active drug range.

3.3. The Effect of Fe3O4-NPs, 5-FU and Fe3O4-NPs + 5-FU on Caco-2 Cells Redox State

The Caco-2 cell TAC values, determined spectrophotometrically, were 12.01 and 13.84 mmol Trolox equiv/L, respectively (Figure 5). Treatment with Fe3O4, NPs, and different concentrations of 5-FU did not affect these cells’ TAC. However, treatment with the loaded Fe3O4-NPs + 5-FU significantly decreased the Caco-2 cell antioxidant status in a time- and concentration-dependent manner (Figure 5).
In correlation with the TAC results, the combined Fe3O4-NPs + 5-FU treatments (Figure 6) was found to increase Caco-2 cell TOS levels, dependent on time and concentration. The most pronounced effects were obtained after 72 h of treatment with Fe3O4-NPs + 5U 8 µg/mL/5-FU 16 µg/mL (p < 0.01).

3.4. The Effect of Fe3O4-NPs, 5-FU and Fe3O4-5-FU NPs on PTEN and IL-10 Gene Expression

PTEN and IL-10 gene expression levels were measured with real-time PCR analysis at the 72 h point of various treatments. This approach demonstrated that the Fe3O4-NPs + 5-FU (8 µg/mL) and Fe3O4-5-NPs + FU (16 µg/mL) treatments significantly upregulated PTEN expression (p < 0.05 and p < 0.01, respectively). A 1.34-fold increase for the Fe3O4-NPs + 5-FU (8 µg/mL) and a 1.57-fold for the Fe3O4-NPs + 5-FU (16 µg/mL) treatments were determined (Figure 7a).
On the other hand, the expression of the immunosuppressive IL-10 gene level was significantly downregulated in Caco-2 cells exposed to Fe3O4-NPs + 5-FU (16 µg/mL), with a 0.59 decrease (p < 0.05) (Figure 7b).

4. Discussion

Over the past decades, remarkable advances have occurred in nanotechnology, particularly nanomedicine, focusing, among others, on novel cancer therapeutics [35]. NPs can accumulate in cells without being recognized by p-glycoproteins, one of the primary mediators of multidrug resistance, resulting in increased intracellular concentrations of drugs [36]. Notably, NP carriers exhibit intrinsic abilities affecting cancer and immune cell biological functions [37]. Therefore, our study examined the synergistic effect of Fe3O4-NPs and 5-FU on Caco-2 colon cancer cell viability, oxidative stress, and oncogene expression.
Previous studies have shown an ambiguous effect of iron oxide NPs on cell biological functions, dependent on cell type and concentration utilized. Thus, it was shown that iron oxide NPs could induce the cellular inflammatory response and increase the secretion of proinflammatory cytokines in human or mouse cells [37,38]. Lately, they have been approved by the FDA, and their beneficial effects on cell physiology have been suggested [13]. However, Fe3O4/composites were also shown to facilitate various active drugs’ cytotoxic and immunomodulatory properties [39]. Thus, the peroxidase-like activity of Fe3O4 and carbon NPs was found to facilitate ascorbic-acid-induced oxidative stress and to incur specific damage to PC-3 prostate cancer cells [40]. Furthermore, increased ROS production generates oxidative stress within the cells and cell apoptosis, resulting in PC-3 tumor cell growth inhibition [40]. Moreover, composite NPs can induce mitochondrial membrane alteration, DNA damage, cytokine production associated with oxidative stress, and apoptosis-correlated cell death [41].
A separate research direction is the regulation of magnetic fields, as various studies have shown that the discrete modulation of these fields can inhibit the proliferation of cancer cells and tumor growth [42,43]. Furthermore, due to the promoting effect of iron metabolism on ROS production, increased concentrations of iron-based NPs in cancer cells enhance their exposure to the local magnetic field and cellular death [44,45].
Our study showed that Fe3O4 NPs did not negatively affect Caco-2 cell viability, oxidative stress, or oncogene expression. However, together with 5-FU, Fe3O4 NPs acted synergistically, and the combination exerted cytotoxic, immunomodulatory, and oxidative-stress-promoting effects at a concentration at which the active drug does not affect these cell functions. Notably, LDH is a cytotoxic marker as its release is enhanced due to cell necrosis. In this study, combined Fe3O4_NPs + 5-FU strongly increased LDH activity, correlated with the upregulation of cell death. Furthermore, TOS increase and TAC attenuation were evident after combined Fe3O4_NPs + 5-FU treatment. Notably, the effects were exerted only after combined Fe3O4_NPs + 5-FU treatment, as treating cells with only 5-FU at the same concentrations did not affect these parameters of cell homeostasis.
PTEN is a well-established tumor suppressor, and alterations in its expression/activity are correlated with tumorigenesis [46]. Moreover, as PTEN controls polarity in normal epithelial cells, loss of this protein plays a critical role in the invasion and metastasis of various cancer types, including colon cancer [47,48]. Several studies have established a negative correlation of PTEN expression with colon cancer progression due to its vital role in inhibiting the malignant transformation of intestinal epithelial cells [49]. A similar association was determined with the dysregulation of PTEN-binding partners [50,51,52]. In the present study, the combined Fe3O4_NPs + 5-FU significantly increased this gene expression. Notably, PTEN acts as a negative regulator of the PI3K/Akt signaling pathway and was shown to affect many processes deregulated in tumorigenesis, such as cell survival, proliferation, migration, and invasion [53]. Indeed, inhibition of the PI3K/Akt pathway induces programmed cell death in different cell lines [54]. Recently, patients presenting PTEN hamartoma tumor syndrome were advised to employ earlier surveillance for colon cancer due to an increased risk of early onset [55]. In the present study, Fe3O4-NPs in combination with 5-FU increased PTEN gene expression. Moreover, in an in vivo prostate cancer model, a NP-mediated increase in PTEN led to disease remission, highlighting the importance of this gene in tumorigenesis and defining it as a promising therapeutic target and progression marker [56].
IL-10 is a versatile immunosuppressive cytokine with immunomodulatory functions [20]. Thus, IL-10 increases tumor cell survival, proliferation, and metastasis by controlling antitumor immunity. Indeed, IL-10 exerts suppressive effects on effector immune cells, including potent antitumor cytotoxic NK and CD8 T cells [21]. The immunosuppressive functions of IL-10 are exercised through the Jak1/STAT3 pathway. Moreover, IL-10 suppresses the level of proinflammatory cytokines, including IL-1β [57]. IL-10 exhibits a role in colon cancer progression as increased levels of IL-10 facilitated liver metastasis in a mouse model [55]. Reprogramming the colon cancer tumor environment by silencing IL-10 expression resulted in dendritic-cell-dependent activation of the antitumor response [56]. This is a significant achievement, especially as dendritic cells (DCs) have a key role in triggering antitumor immune responses [58]. Madhubala et al. [59], in their study on titanium dioxide NPs’ effects in a leukemia cell line, observed that the expression of IL-10 significantly decreased. In the present study, Fe3O4-NPs + 5-FU treatment significantly reduced the IL-10 release of colon cancer cells.
Thus, this study shows that the combined administration of Fe3O4 and 5-FU NPs will reduce the dose of the drug required to achieve pronounced antitumor activity. The latter effect is a significant result since 5-FU has a pronounced toxicity, which can be reduced due to its immobilization, for example, using metal–organic frameworks [60,61,62]. Therefore, the role of NPs is not only to provide suitable dynamics for 5-FU release in the event of its immobilization but also to eliminate the barrier associated with penetration through the cell membrane. A similar synergistic effect was described when platinum NPs were administered together with nonimmobilized doxorubicin to U2OS osteosarcoma cells. In this model, cotreatment significantly increased the drug’s effectiveness compared with pure doxorubicin at a similar dose [63]. This was explained by an increase in oxidative stress in the presence of platinum NPs [63], which we also noted with the combined introduction of Fe3O4 and 5-FU nanoparticles in the present study. On the other hand, NP treatment promotes the activation of endocytosis [64], which can also promote the penetration of 5-FU through cell membranes. Therefore, administering anticancer drugs, even without their preliminary immobilization, together with NPs, can significantly increase their cytostatic activity. Furthermore, in vivo and in vitro experiments for the characterization of Fe3O4 nanoparticles/active drug effects on specific cells/tissues are in order.

5. Conclusions

Magnetite NPs penetrate (passive delivery) due to increased vascular permeability and weakened lymphatic drainage of cancer tissues. Moreover, magnetite NPs are easily uptaken and accumulate in cancer cells due to their small size. Our study showed that the combined Fe3O4_NPs + 5-FU, through a synergistic effect, significantly reduced Caco-2 cell viability at a concentration at which the active drug did not induce an effect. Likewise, the combined treatment, but not the solitary components, facilitated oxidative stress correlated with the decreased viability of Caco-2 cells. Moreover, we determined that combined Fe3O4_NPs + 5-FU treatment decreased IL-10 levels and enhanced the expression of the oncogene-suppressor PTEN. Our data show that Fe3O4_NPs + 5-FU exhibit significant antitumor effects at low concentrations of the active drug. Further studies are needed to fully elucidate the molecular mechanisms involved.

Author Contributions

S.G., A.T. (Ali Taghizadehghalehjoughi), Y.Y., A.H., A.O.D. and A.T. (Aristidis Tsatsakis): conceptualization, methodology, supervision, investigation, writing—review and editing. A.J., D.N. and Y.M.: software, validation, formal analysis, investigation, data curation, writing—original draft preparation. A.J., S.G. and Y.Y.: resources. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Raw data is available on request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2018. CA Cancer J. Clin. 2018, 68, 7–30. [Google Scholar] [CrossRef]
  2. Alfaro, A.E.A.; Castillo, B.M.; Garcia, E.C.; Tascon, J.; Morales, A.I. Colon Cancer Pharmacogenetics: A Narrative Review. Pharmacy 2022, 10, 95. [Google Scholar] [CrossRef]
  3. Li, Y.; Gao, Y.; Gong, C.N.; Wang, Z.; Xia, Q.M.; Gu, F.F.; Hu, C.L.; Zhang, L.J.; Guo, H.L.; Gao, S. A33 antibody-functionalized exosomes for targeted delivery of doxorubicin against colorectal cancer. Nanomed. Nanotechnol. Biol. Med. 2018, 14, 1973–1985. [Google Scholar] [CrossRef]
  4. Krishna, R.; Mayer, L.D. Multidrug resistance (MDR) in cancer—Mechanisms, reversal using modulators of MDR and the role of MDR modulators in influencing the pharmacokinetics of anticancer drugs. Eur. J. Pharm. Sci. 2000, 11, 265–283. [Google Scholar] [CrossRef]
  5. Anitha, A.; Deepa, N.; Chennazhi, K.P.; Lakshmanan, V.K.; Jayakumar, R. Combinatorial anticancer effects of curcumin and 5-fluorouracil loaded thiolated chitosan nanoparticles towards colon cancer treatment (vol 1840, pg 2730, 2014). Biochim. Biophys. Acta-Gen. Subj. 2019, 1863, 992. [Google Scholar] [CrossRef]
  6. Zhang, J.X.; Yang, Z.R.; Wu, D.D.; Song, J.; Guo, X.F.; Wang, J.; Dong, W.G. Suppressive Effect of Sinomenine Combined with 5-Fluorouracil on Colon Carcinoma Cell Growth. Asian Pac. J. Cancer Prev. 2014, 15, 6737–6743. [Google Scholar] [CrossRef] [Green Version]
  7. Baker, E.K.; El-Osta, A. The rise of DNA methylation and the importance of chromatin on multidrug resistance in cancer. Exp. Cell Res. 2003, 290, 177–194. [Google Scholar] [CrossRef]
  8. Comella, P.; Casaretti, R.; Sandomenico, C.; Avallone, A.; Franco, L. Capecitabine, alone and in combination, in the management of patients with colorectal cancer—A review of the evidence. Drugs 2008, 68, 949–961. [Google Scholar] [CrossRef]
  9. Hossen, S.; Hossain, M.K.; Basher, M.K.; Mia, M.N.H.; Rahman, M.T.; Uddin, M.J. Smart nanocarrier-based drug delivery systems for cancer therapy and toxicity studies: A review. J. Adv. Res. 2019, 15, 1–18. [Google Scholar] [CrossRef]
  10. Tang, Q.C.; Wang, Y.H.; Huang, R.; You, Q.; Wang, G.Y.; Chen, Y.G.; Jiang, Z.; Liu, Z.; Yu, L.; Muhammad, S.; et al. Preparation of Anti-Tumor Nanoparticle and Its Inhibition to Peritoneal Dissemination of Colon Cancer. PLoS ONE 2014, 9, e98455. [Google Scholar] [CrossRef]
  11. Chaturvedi, V.K.; Singh, A.; Singh, V.K.; Singh, M.P. Cancer Nanotechnology: A New Revolution for Cancer Diagnosis and Therapy. Curr. Drug Metab. 2019, 20, 416–429. [Google Scholar] [CrossRef]
  12. Mioc, M.; Pavel, I.Z.; Ghiulai, R.; Coricovac, D.E.; Farcas, C.; Mihali, C.V.; Oprean, C.; Serafim, V.; Popovici, R.A.; Dehelean, C.A.; et al. The Cytotoxic Effects of Betulin-Conjugated Gold Nanoparticles as Stable Formulations in Normal and Melanoma Cells. Front. Pharmacol. 2018, 9, 429. [Google Scholar] [CrossRef] [Green Version]
  13. Chen, Y.L.; Hou, S.K. Application of magnetic nanoparticles in cell therapy. Stem Cell Res. Ther. 2022, 13, 135. [Google Scholar] [CrossRef]
  14. Lok, C.N.; Zou, T.T.; Zhang, J.J.; Lin, I.W.S.; Che, C.M. Controlled-Release Systems for Metal-Based Nanomedicine: Encapsulated/Self-Assembled Nanoparticles of Anticancer Gold(III)/Platinum(II) Complexes and Antimicrobial Silver Nanoparticles. Adv. Mater. 2014, 26, 5550–5557. [Google Scholar] [CrossRef]
  15. Darroudi, M.; Gholami, M.; Rezayi, M.; Khazaei, M. An overview and bibliometric analysis on the colorectal cancer therapy by magnetic functionalized nanoparticles for the responsive and targeted drug delivery. J. Nanobiotechnol. 2021, 19, 399. [Google Scholar] [CrossRef]
  16. Perez-Herrero, E.; Fernandez-Medarde, A. Advanced targeted therapies in cancer: Drug nanocarriers, the future of chemotherapy. Eur. J. Pharm. Biopharm. 2015, 93, 52–79. [Google Scholar] [CrossRef] [Green Version]
  17. Kaplan, A.; Kutlu, H.M.; Ciftci, G.A. Fe3O4 Nanopowders: Genomic and Apoptotic Evaluations on A549 Lung Adenocarcinoma Cell Line. Nutr. Cancer 2020, 72, 708–721. [Google Scholar] [CrossRef]
  18. Li, D.; Deng, M.W.; Yu, Z.Y.; Liu, W.; Zhou, G.D.; Wang, X.S.; Yang, D.P.; Zhang, W.J. Biocompatible and Stable GO-Coated Fe3O4 Nanocomposite: A Robust Drug Delivery Carrier for Simultaneous Tumor MR Imaging and Targeted Therapy. ACS Biomater. Sci. Eng. 2018, 4, 2143–2154. [Google Scholar] [CrossRef]
  19. Zhang, Y.L.; Zhang, Y.T.; Yang, Z.J.; Fan, Y.; Chen, M.Y.; Zhao, M.T.; Dai, B.; Zheng, L.L.; Zhang, D.W. Cytotoxicity Effect of Iron Oxide (Fe3O4)/Graphene Oxide (GO) Nanosheets in Cultured HBE Cells. Front. Chem. 2022, 10, 888033. [Google Scholar] [CrossRef]
  20. Garcia, G.; Kim, M.H.; Morikis, V.A.; Simon, S.I. Neutrophil Inflammatory Response Is Downregulated by Uptake of Superparamagnetic Iron Oxide Nanoparticle Therapeutics. Front. Immunol. 2020, 11, 571489. [Google Scholar] [CrossRef]
  21. Propper, D.J.; Balkwill, F.R. Harnessing cytokines and chemokines for cancer therapy. Nat. Rev. Clin. Oncol. 2022, 19, 237–253. [Google Scholar] [CrossRef]
  22. Germano, G.; Allavena, P.; Mantovani, A. Cytokines as a key component of cancer-related inflammation. Cytokine 2008, 43, 374–379. [Google Scholar] [CrossRef]
  23. Zhang, H.Y.; Li, R.C.; Cao, Y.F.; Gu, Y.; Lin, C.; Liu, X.; Lv, K.P.; He, X.D.; Fang, H.J.; Jin, K.F.; et al. Poor Clinical Outcomes and Immunoevasive Contexture in Intratumoral IL-10-Producing Macrophages Enriched Gastric Cancer Patients. Ann. Surg. 2022, 275, E626–E635. [Google Scholar] [CrossRef]
  24. Ye, L.S.; Zhang, Q.; Cheng, Y.S.; Chen, X.L.; Wang, G.Y.; Shi, M.C.; Zhang, T.; Cao, Y.J.; Pan, H.; Zhang, L.T.; et al. Tumor-derived exosomal HMGB1 fosters hepatocellular carcinoma immune evasion by promoting TIM-1+ regulatory B cell expansion. J. Immunother. Cancer 2018, 6, 145. [Google Scholar] [CrossRef] [Green Version]
  25. Steck, P.A.; Pershouse, M.A.; Jasser, S.A.; Yung, W.K.; Lin, H.; Ligon, A.H.; Langford, L.A.; Baumgard, M.L.; Hattier, T.; Davis, T.; et al. Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 1997, 15, 356–362. [Google Scholar] [CrossRef]
  26. Fedorova, O.; Parfenyev, S.; Daks, A.; Shuvalov, O.; Barlev, N.A. The Role of PTEN in Epithelial-Mesenchymal Transition. Cancers 2022, 14, 3786. [Google Scholar] [CrossRef]
  27. Papa, A.; Pandolfi, P.P. The PTEN(-)PI3K Axis in Cancer. Biomolecules 2019, 9, 153. [Google Scholar] [CrossRef] [Green Version]
  28. D’Ermo, G.; Genuardi, M. Gastrointestinal manifestations in PTEN hamartoma tumor syndrome. Best Pr. Res. Clin. Gastroenterol. 2022, 58–59, 101792. [Google Scholar] [CrossRef]
  29. Almaimani, R.A.; Aslam, A.; Ahmad, J.; El-Readi, M.Z.; El-Boshy, M.E.; Abdelghany, A.H.; Idris, S.; Alhadrami, M.; Althubiti, M.; Almasmoum, H.A.; et al. In Vivo and In Vitro Enhanced Tumoricidal Effects of Metformin, Active Vitamin D3, and 5-Fluorouracil Triple Therapy against Colon Cancer by Modulating the PI3K/Akt/PTEN/mTOR Network. Cancers 2022, 14, 1538. [Google Scholar] [CrossRef]
  30. Oh, G.W.; Kim, S.C.; Kim, T.H.; Jung, W.K. Characterization of an oxidized alginate-gelatin hydrogel incorporating a COS-salicylic acid conjugate for wound healing. Carbohydr. Polym. 2021, 252, 117145. [Google Scholar] [CrossRef]
  31. Nalci, O.B.; Nadaroglu, H.; Genc, S.; Hacimuftuoglu, A.; Alayli, A. The effects of MgS nanoparticles-Cisplatin-bio-conjugate on SH-SY5Y neuroblastoma cell line. Mol. Biol. Rep. 2020, 47, 9715–9723. [Google Scholar] [CrossRef]
  32. Kamalak, H.; Kamalak, A.; Taghizadehghalehjoughi, A.; Hacimuftuoglu, A.; Nalci, K.A. Cytotoxic and biological effects of bulk fill composites on rat cortical neuron cells. Odontology 2018, 106, 377–388. [Google Scholar] [CrossRef] [Green Version]
  33. Cicek, B.; Genc, S.; Yeni, Y.; Kuzucu, M.; Cetin, A.; Yildirim, S.; Bolat, I.; Kantarci, M.; Hacimuftuoglu, A.; Lazopoulos, G.; et al. Artichoke (Cynara Scolymus) Methanolic Leaf Extract Alleviates Diethylnitrosamine-Induced Toxicity in BALB/c Mouse Brain: Involvement of Oxidative Stress and Apoptotically Related Klotho/PPARgamma Signaling. J. Pers. Med. 2022, 12, 2012. [Google Scholar] [CrossRef]
  34. Yeni, Y.; Cakir, Z.; Hacimuftuoglu, A.; Taghizadehghalehjoughi, A.; Okkay, U.; Genc, S.; Yildirim, S.; Saglam, Y.S.; Calina, D.; Tsatsakis, A.; et al. A Selective Histamine H4 Receptor Antagonist, JNJ7777120, Role on glutamate Transporter Activity in Chronic Depression. J. Pers. Med. 2022, 12, 246. [Google Scholar] [CrossRef]
  35. Mundekkad, D.; Cho, W.L.C. Nanoparticles in Clinical Translation for Cancer Therapy. Int. J. Mol. Sci. 2022, 23, 1685. [Google Scholar] [CrossRef]
  36. Mills, H.; Acquah, R.; Tang, N.V.; Cheung, L.; Klenk, S.; Glassen, R.; Pirson, M.; Albert, A.; Hoang, D.T.; Van, T.N. Preparation of PCL Electrospun Fibers Loaded with Cisplatin and Their Potential Application for the Treatment of Prostate Cancer. Emerg. Med. Int. 2022, 2022, 6449607. [Google Scholar] [CrossRef]
  37. Zhu, M.T.; Wang, B.; Wang, Y.; Yuan, L.; Wang, H.J.; Wang, M.; Ouyang, H.; Chai, Z.F.; Feng, W.Y.; Zhao, Y.L. Endothelial dysfunction and inflammation induced by iron oxide nanoparticle exposure: Risk factors for early atherosclerosis. Toxicol. Lett. 2011, 203, 162–171. [Google Scholar] [CrossRef]
  38. Park, E.J.; Choi, D.H.; Kim, Y.; Lee, E.W.; Song, J.; Cho, M.H.; Kim, J.H.; Kim, S.W. Magnetic iron oxide nanoparticles induce autophagy preceding apoptosis through mitochondrial damage and ER stress in RAW264.7 cells. Toxicol. Vitr. 2014, 28, 1402–1412. [Google Scholar] [CrossRef]
  39. Zhao, S.Z.; Yu, X.J.; Qian, Y.N.; Chen, W.; Shen, J.L. Multifunctional magnetic iron oxide nanoparticles: An advanced platform for cancer theranostics. Theranostics 2020, 10, 6278–6309. [Google Scholar] [CrossRef]
  40. An, Q.; Sun, C.Y.; Li, D.; Xu, K.; Guo, J.; Wang, C.C. Peroxidase-Like Activity of Fe3O4@Carbon Nanoparticles Enhances Ascorbic Acid-Induced Oxidative Stress and Selective Damage to PC-3 Prostate Cancer Cells. ACS Appl. Mater. Interfaces 2013, 5, 13248–13257. [Google Scholar] [CrossRef]
  41. Alarifi, S.; Ali, D.; Alakhtani, S.; Al Suhaibani, E.S.; Al-Qahtani, A.A. Reactive Oxygen Species-Mediated DNA Damage and Apoptosis in Human Skin Epidermal Cells After Exposure to Nickel Nanoparticles. Biol. Trace Elem. Res. 2014, 157, 84–93. [Google Scholar] [CrossRef] [PubMed]
  42. Choi, J.W.; Park, J.W.; Na, Y.; Jung, S.J.; Hwang, J.K.; Choi, D.; Lee, K.G.; Yun, C.O. Using a magnetic field to redirect an oncolytic adenovirus complexed with iron oxide augments gene therapy efficacy. Biomaterials 2015, 65, 163–174. [Google Scholar] [CrossRef]
  43. Wang, S.H.; Luo, J.; Zhang, Z.H.; Dong, D.D.; Shen, Y.; Fang, Y.W.; Hu, L.J.; Liu, M.Y.; Dai, C.F.; Peng, S.L.; et al. Iron and magnetic: New research direction of the ferroptosis-based cancer therapy. Am. J. Cancer Res. 2018, 8, 1933–1946. [Google Scholar] [PubMed]
  44. Watanabe, Y.; Nakagawa, M.; Miyakoshi, Y. Enhancement of lipid peroxidation in the liver of mice exposed to magnetic fields. Ind. Health 1997, 35, 285–290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Sabo, J.; Mirossay, L.; Horovcak, L.; Sarissky, M.; Mirossay, A.; Mojzis, J. Effects of static magnetic field on human leukemic cell line HL-60. Bioelectrochemistry 2002, 56, 227–231. [Google Scholar] [CrossRef]
  46. Alvarez-Garcia, V.; Tawil, Y.; Wise, H.M.; Leslie, N.R. Mechanisms of PTEN loss in cancer: It’s all about diversity. Semin. Cancer Biol. 2019, 59, 66–79. [Google Scholar] [CrossRef]
  47. Cully, M.; You, H.; Levine, A.J.; Mak, T.W. Beyond PTEN mutations: The PI3K pathway as an integrator of multiple inputs during tumorigenesis. Nat. Rev. Cancer 2006, 6, 184–192. [Google Scholar] [CrossRef]
  48. Tsutsui, S.; Inoue, H.; Yasuda, K.; Suzuki, K.; Higashi, H.; Era, S.; Mori, M. Reduced expression of PTEN protein and its prognostic implications in invasive ductal carcinoma of the breast. Oncology 2005, 68, 398–404. [Google Scholar] [CrossRef]
  49. Ferraro, B.; Bepler, G.; Sharma, S.; Cantor, A.; Haura, E.B. EGR1 predicts PTEN and survival in patients with non-small-cell lung cancer. J. Clin. Oncol. 2005, 23, 1921–1926. [Google Scholar] [CrossRef]
  50. Colakoglu, T.; Yildirim, S.; Kayaselcuk, F.; Nursal, T.Z.; Ezer, A.; Noyan, T.; Karakayali, H.; Haberal, M. Clinicopathological significance of PTEN loss and the phosphoinositide 3-kinase/Akt pathway in sporadic colorectal neoplasms: Is PTEN loss predictor of local recurrence? Am. J. Surg. 2008, 195, 719–725. [Google Scholar] [CrossRef]
  51. Jang, K.S.; Song, Y.S.; Jang, S.H.; Min, K.W.; Na, W.; Jang, S.M.; Jun, Y.J.; Lee, K.H.; Choi, D.; Paik, S.S. Clinicopathological significance of nuclear PTEN expression in colorectal adenocarcinoma. Histopathology 2010, 56, 229–239. [Google Scholar] [CrossRef] [PubMed]
  52. Sawai, H.; Yasuda, A.; Ochi, N.; Ma, J.; Matsuo, Y.; Wakasugi, T.; Takahashi, H.; Funahashi, H.; Sato, M.; Takeyama, H. Loss of PTEN expression is associated with colorectal cancer liver metastasis and poor patient survival. BMC Gastroenterol. 2008, 8, 56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Ahmad, I.; Morton, J.P.; Singh, L.B.; Radulescu, S.M.; Ridgway, R.A.; Patel, S.; Woodgett, J.; Winton, D.J.; Taketo, M.M.; Wu, X.R.; et al. beta-Catenin activation synergizes with PTEN loss to cause bladder cancer formation. Oncogene 2011, 30, 178–189. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Lei, H.Q.; Furlong, P.J.; Ra, J.H.; Mullins, D.; Cantor, R.; Fraker, D.L.; Spitz, F.R. AKT activation and response to interferon-beta in human cancer cells. Cancer Biol. Ther. 2005, 4, 709–715. [Google Scholar] [CrossRef] [Green Version]
  55. Huang, X.M.; Zhang, N.R.; Lin, X.T.; Zhu, C.Y.; Zou, Y.F.; Wu, X.J.; He, X.S.; He, X.W.; Wan, Y.L.; Lan, P. Antitumor immunity of low-dose cyclophosphamide: Changes in T cells and cytokines TGF-beta and IL-10 in mice with colon-cancer liver metastasis. Gastroenterol. Rep. (Oxf.) 2020, 8, 56–65. [Google Scholar] [CrossRef]
  56. Rossowska, J.; Anger, N.; Szczygiel, A.; Mierzejewska, J.; Pajtasz-Piasecka, E. Reprogramming the murine colon cancer microenvironment using lentivectors encoding shRNA against IL-10 as a component of a potent DC-based chemoimmunotherapy. J. Exp. Clin. Cancer Res. 2018, 37, 126. [Google Scholar] [CrossRef] [Green Version]
  57. Bhavsar, M.D.; Amiji, M.M. Oral IL-10 gene delivery in a microsphere-based formulation for local transfection and therapeutic efficacy in inflammatory bowel disease. Gene Ther. 2008, 15, 1200–1209. [Google Scholar] [CrossRef] [Green Version]
  58. Apetoh, L.; Locher, C.; Ghiringhelli, F.; Kroemer, G.; Zitvogel, L. Harnessing dendritic cells in cancer. Semin. Immunol. 2011, 23, 42–49. [Google Scholar] [CrossRef]
  59. Madhubala, V.; Pugazhendhi, A.; Thirunavukarasu, K. Cytotoxic and immunomodulatory effects of the low concentration of titanium dioxide nanoparticles (TiO2 NPs) on human cell lines—An in vitro study. Process Biochem. 2019, 86, 186–195. [Google Scholar] [CrossRef]
  60. Liu, J.Q.; Li, X.F.; Gu, C.Y.; da Silva, J.C.S.; Barros, A.L.; Alves, S.; Li, B.H.; Ren, F.; Batten, S.R.; Soares, T.A. A combined experimental and computational study of novel nanocage-based metal-organic frameworks for drug delivery. Dalton Trans. 2015, 44, 19370–19382. [Google Scholar] [CrossRef]
  61. Li, F.M.; Li, B.H.; Wang, C.F.; Zeng, Y.P.; Liu, J.Q.; Gu, C.Y.; Lu, P.F.; Mei, L. Encapsulation of pharmaceutical ingredient linker in metal-organic framework: Combined experimental and theoretical insight into the drug delivery. RSC Adv. 2016, 6, 47959–47965. [Google Scholar] [CrossRef]
  62. Qin, L.; Liang, F.L.; Li, Y.; Wu, J.A.; Guan, S.Y.; Wu, M.Y.; Xie, S.L.; Luo, M.S.; Ma, D.Y. A 2D Porous Zinc-Organic Framework Platform for Loading of 5-Fluorouracil. Inorganics 2022, 10, 202. [Google Scholar] [CrossRef]
  63. Gurunathan, S.; Jeyaraj, M.; Kang, M.H.; Kim, J.H. Tangeretin-Assisted Platinum Nanoparticles Enhance the Apoptotic Properties of Doxorubicin: Combination Therapy for Osteosarcoma Treatment. Nanomaterials 2019, 9, 1089. [Google Scholar] [CrossRef] [Green Version]
  64. Tran, N.; Webster, T.J. Understanding magnetic nanoparticle osteoblast receptor-mediated endocytosis using experiments and modeling. Nanotechnology 2013, 24, 185102. [Google Scholar] [CrossRef]
Pharmaceutics 15 00245 g001 550
Figure 1. The (a) SEM image and (b) DLS analysis of Fe3O4 NPs.
Figure 1. The (a) SEM image and (b) DLS analysis of Fe3O4 NPs.
Pharmaceutics 15 00245 g001
Pharmaceutics 15 00245 g002 550
Figure 2. FTIR spectrum (a) and XRD pattern (b) of Fe3O4 NPs.
Figure 2. FTIR spectrum (a) and XRD pattern (b) of Fe3O4 NPs.
Pharmaceutics 15 00245 g002
Pharmaceutics 15 00245 g003 550
Figure 3. Cell viability was measured with an MTT assay (n = 6). The effect of Fe3O40-NPs, 5-FU, and Fe3O4-NPs + 5-FU on Caco-2 cells’ viability. Cells were cultured in 96-well plates and treated with Fe3O4-NPs 6 μg/mL, 5-FU (4, 8, and 16 μg/mL), and the Fe3O4 NPs + 5-FU combination for 24 h and 72 h. The results are presented as the average of three separate experiments. Statistical significance: * p < 0.05; ** p < 0.01.
Figure 3. Cell viability was measured with an MTT assay (n = 6). The effect of Fe3O40-NPs, 5-FU, and Fe3O4-NPs + 5-FU on Caco-2 cells’ viability. Cells were cultured in 96-well plates and treated with Fe3O4-NPs 6 μg/mL, 5-FU (4, 8, and 16 μg/mL), and the Fe3O4 NPs + 5-FU combination for 24 h and 72 h. The results are presented as the average of three separate experiments. Statistical significance: * p < 0.05; ** p < 0.01.
Pharmaceutics 15 00245 g003
Pharmaceutics 15 00245 g004 550
Figure 4. The effect of Fe3O40-NPs, 5-FU, and Fe3O4-NPs + 5-FU on Caco-2 cell LDH activity (n = 6). Cells were cultured in 96-well plates and treated with Fe3O4-NPs 6 μg/mL, 5-FU (4, 8, and 16 μg/mL), and combinations of Fe3O4 + 5-FU NPs for 24 h and 72 h, and LDH activity was determined. The results represent the average of three separate experiments. Statistical significance is represented as * p < 0.05; ** p < 0.01.
Figure 4. The effect of Fe3O40-NPs, 5-FU, and Fe3O4-NPs + 5-FU on Caco-2 cell LDH activity (n = 6). Cells were cultured in 96-well plates and treated with Fe3O4-NPs 6 μg/mL, 5-FU (4, 8, and 16 μg/mL), and combinations of Fe3O4 + 5-FU NPs for 24 h and 72 h, and LDH activity was determined. The results represent the average of three separate experiments. Statistical significance is represented as * p < 0.05; ** p < 0.01.
Pharmaceutics 15 00245 g004
Pharmaceutics 15 00245 g005 550
Figure 5. The effect of Fe3O40-NPs, 5-FU, and Fe3O4-NPs + 5-FU on Caco-2 cells’ TAC (n = 6). Cells were cultured in 96-well plates and treated with Fe3O4 NPs 6 μg/mL, 5-FU (4, 8, and 16 μg/mL), and Fe3O4 + 5-FU NPs combinations for 24 h and 72 h, and TAC determined. The results represent the average of three separate experiments. Statistical significance: * p < 0.05; ** p < 0.01.
Figure 5. The effect of Fe3O40-NPs, 5-FU, and Fe3O4-NPs + 5-FU on Caco-2 cells’ TAC (n = 6). Cells were cultured in 96-well plates and treated with Fe3O4 NPs 6 μg/mL, 5-FU (4, 8, and 16 μg/mL), and Fe3O4 + 5-FU NPs combinations for 24 h and 72 h, and TAC determined. The results represent the average of three separate experiments. Statistical significance: * p < 0.05; ** p < 0.01.
Pharmaceutics 15 00245 g005
Pharmaceutics 15 00245 g006 550
Figure 6. The effect of Fe3O40-NPs, 5-FU, and Fe3O4-NPs + 5-FU on Caco-2 cells TOS levels (n = 6). Cells were cultured in 96-well plates and treated with Fe3O4_NPs 6 μg/mL, 5-FU (4, 8, and 16 μg/mL), and combinations of Fe3O4 + 5-FU NPs for 24 h and 72 h, and TOS determined. The results represent the average of three separate experiments. Statistical significance: * p < 0.05; ** p < 0.01.
Figure 6. The effect of Fe3O40-NPs, 5-FU, and Fe3O4-NPs + 5-FU on Caco-2 cells TOS levels (n = 6). Cells were cultured in 96-well plates and treated with Fe3O4_NPs 6 μg/mL, 5-FU (4, 8, and 16 μg/mL), and combinations of Fe3O4 + 5-FU NPs for 24 h and 72 h, and TOS determined. The results represent the average of three separate experiments. Statistical significance: * p < 0.05; ** p < 0.01.
Pharmaceutics 15 00245 g006
Pharmaceutics 15 00245 g007 550
Figure 7. The effect of Fe3O40-NPs, 5-FU, and Fe3O4_NPs + 5-FU on PTEN and IL-10 gene expression. (a) IL-10 gene level; (b) PTEN gene level (n = 3). Cells were cultured in 96-well plates and treated with Fe3O4_NPs 6 μg/mL, 5-FU (4, 8, and 16 μg/mL), and combinations of Fe3O4 + 5-FU NPs for 72 h. The results represent the average of three separate experiments. Statistical significance: * p < 0.05; ** p < 0.01.
Figure 7. The effect of Fe3O40-NPs, 5-FU, and Fe3O4_NPs + 5-FU on PTEN and IL-10 gene expression. (a) IL-10 gene level; (b) PTEN gene level (n = 3). Cells were cultured in 96-well plates and treated with Fe3O4_NPs 6 μg/mL, 5-FU (4, 8, and 16 μg/mL), and combinations of Fe3O4 + 5-FU NPs for 72 h. The results represent the average of three separate experiments. Statistical significance: * p < 0.05; ** p < 0.01.
Pharmaceutics 15 00245 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Genc, S.; Taghizadehghalehjoughi, A.; Yeni, Y.; Jafarizad, A.; Hacimuftuoglu, A.; Nikitovic, D.; Docea, A.O.; Mezhuev, Y.; Tsatsakis, A. Fe3O4 Nanoparticles in Combination with 5-FU Exert Antitumor Effects Superior to Those of the Active Drug in a Colon Cancer Cell Model. Pharmaceutics 2023, 15, 245. https://doi.org/10.3390/pharmaceutics15010245

AMA Style

Genc S, Taghizadehghalehjoughi A, Yeni Y, Jafarizad A, Hacimuftuoglu A, Nikitovic D, Docea AO, Mezhuev Y, Tsatsakis A. Fe3O4 Nanoparticles in Combination with 5-FU Exert Antitumor Effects Superior to Those of the Active Drug in a Colon Cancer Cell Model. Pharmaceutics. 2023; 15(1):245. https://doi.org/10.3390/pharmaceutics15010245

Chicago/Turabian Style

Genc, Sidika, Ali Taghizadehghalehjoughi, Yesim Yeni, Abbas Jafarizad, Ahmet Hacimuftuoglu, Dragana Nikitovic, Anca Oana Docea, Yaroslav Mezhuev, and Aristidis Tsatsakis. 2023. "Fe3O4 Nanoparticles in Combination with 5-FU Exert Antitumor Effects Superior to Those of the Active Drug in a Colon Cancer Cell Model" Pharmaceutics 15, no. 1: 245. https://doi.org/10.3390/pharmaceutics15010245

APA Style

Genc, S., Taghizadehghalehjoughi, A., Yeni, Y., Jafarizad, A., Hacimuftuoglu, A., Nikitovic, D., Docea, A. O., Mezhuev, Y., & Tsatsakis, A. (2023). Fe3O4 Nanoparticles in Combination with 5-FU Exert Antitumor Effects Superior to Those of the Active Drug in a Colon Cancer Cell Model. Pharmaceutics, 15(1), 245. https://doi.org/10.3390/pharmaceutics15010245

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop