Headache and NOTCH3 Gene Variants in Patients with CADASIL
Abstract
:1. Introduction
2. Patients and Methods
2.1. Patients
2.2. Genetic Analysis
2.3. Statistical Analyses
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mizuno, T.; Mizuta, I.; Watanabe-Hosomi, A.; Mukai, M.; Koizumi, T. Clinical and genetic aspects of CADASIL. Front. Aging Neurosci. 2020, 12, 91. [Google Scholar] [CrossRef] [PubMed]
- Granild-Jensen, J.A.; Jensen, U.B.; Schwartz, M.; Hansen, U.S. Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy resulting in stroke in an 11-year-old male. Dev. Med. Child Neurol. 2009, 51, 754–757. [Google Scholar] [CrossRef] [PubMed]
- Pescini, F.; Nannucci, S.; Bertaccini, B.; Salvadori, E.; Bianchi, S.; Ragno, M.; Sarti, C.; Valenti, R.; Zicari, E.; Moretti, M.; et al. The cerebral autosomal-dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) scale: A screening tool to select patients for NOTCH3 gene analysis. Stroke 2012, 43, 2871–2876. [Google Scholar] [CrossRef] [PubMed]
- Chabriat, H.; Joutel, A.; Dichgans, M.; Tournier-Lasserve, E.; Bousser, M.G. Cadasil. Lancet Neurol. 2009, 8, 643–653. [Google Scholar] [CrossRef]
- Di Donato, I.; Bianchi, S.; De Stefano, N.; Dichgans, M.; Dotti, M.T.; Duering, M.; Jouvent, E.; Korczyn, A.D.; Lesnik-Oberstein, S.A.; Malandrini, A.; et al. Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) as a model of small vessel disease: Update on clinical, diagnostic, and management aspects. BMC Med. 2017, 15, 41. [Google Scholar] [CrossRef]
- Dichgans, M.; Mayer, M.; Uttner, I.; Brüning, R.; Müller-Höcker, J.; Rungger, G.; Ebke, M.; Klockgether, T.; Gasser, T. The phenotypic spectrum of CADASIL: Clinical findings in 102 cases. Ann. Neurol. 1998, 44, 731–739. [Google Scholar] [CrossRef]
- Chabriat, H.; Vahedi, K.; Iba-Zizen, M.T.; Joutel, A.; Nibbio, A.; Nagy, T.G.; Krebs, M.O.; Julien, J.; Dubois, B.; Ducrocq, X.; et al. Clinical spectrum of CADASIL: A study of 7 families. Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy. Lancet 1995, 346, 934–939. [Google Scholar] [CrossRef]
- Desmond, D.W.; Moroney, J.T.; Lynch, T.; Chan, S.; Chin, S.S.; Mohr, J.P. The natural history of CADASIL: A pooled analysis of previously published cases. Stroke 1999, 30, 1230–1233. [Google Scholar] [CrossRef]
- Russell, M.B.; Rasmussen, B.K.; Fenger, K.; Olesen, J. Migraine without aura and migraine with aura are distinct clinical entities: A study of four hundred and eighty-four male and female migraineurs from the general population. Cephalalgia 1996, 16, 239–245. [Google Scholar] [CrossRef]
- Digre, K.B. Headaches and other head pain. In Goldman-Cecil Medicine, 25th ed.; Saunders Elsevier: Amsterdam, The Netherlands, 2016. [Google Scholar]
- Friedman, B.W.; Lipton, R.B. Headache emergencies: Diagnosis and management. Neurol. Clin. 2012, 30, 43–59. [Google Scholar] [CrossRef]
- Green, M.W. Secondary headaches. Contin. Lifelong Learn. Neurol. 2012, 18, 783–795. [Google Scholar] [CrossRef] [PubMed]
- Headache Classification Committee of the International Headache Society (IHS). The International Classification of Headache Disorders, 3rd edition (beta version). Cephalalgia 2013, 33, 629–808. [Google Scholar] [CrossRef] [PubMed]
- Mier, R.W.; Dhadwal, S. Primary Headaches. Dent. Clin. N. Am. 2018, 62, 611–628. [Google Scholar] [CrossRef] [PubMed]
- Stovner, L.; Hagen, K.; Jensen, R.; Katsarava, Z.; Lipton, R.; Scher, A.; Steiner, T.; Zwart, J.A. The global burden of headache: A documentation of headache prevalence and disability worldwide. Cephalalgia 2007, 27, 193–210. [Google Scholar] [CrossRef] [PubMed]
- May, A. Hints on Diagnosing and Treating Headache. Dtsch. Arztebl. Int. 2018, 115, 299–308. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.C.; Liu, C.S.; Chang, M.H.; Lin, K.P.; Fuh, J.L.; Lu, Y.C.; Liu, Y.F.; Soong, B.W. Population-specific spectrum of NOTCH3 mutations, MRI features and founder effect of CADASIL in Chinese. J. Neurol. 2009, 256, 249–255. [Google Scholar] [CrossRef] [PubMed]
- Hassan, M.; Asaad, T. Tension-type headache, its relation to stress, and how to relieve it by cryotherapy among academic students. Middle East Curr. Psychiatry 2020, 27, 20. [Google Scholar] [CrossRef]
- Mattsson, P.; Lundberg, P.O. Characteristics and prevalence of transient visual disturbances indicative of migraine visual aura. Cephalalgia 1999, 19, 479–484. [Google Scholar] [CrossRef]
- Safiri, S.; Pourfathi, H.; Eagan, A.; Mansournia, M.A.; Khodayari, M.T.; Sullman, M.J.M.; Kaufman, J.; Collins, G.; Dai, H.; Bragazzi, N.L.; et al. Global, regional, and national burden of migraine in 204 countries and territories, 1990 to 2019. Pain 2022, 163, 293–309. [Google Scholar] [CrossRef]
- Woldeamanuel, Y.W.; Cowan, R.P. Migraine affects 1 in 10 people worldwide featuring recent rise: A systematic review and meta-analysis of community-based studies involving 6 million participants. J. Neurol. Sci. 2017, 372, 307–315. [Google Scholar] [CrossRef]
- Polk, A.N.; Smitherman, T.A. A meta-analytic review of acceptance-based interventions for migraine. Headache 2023. online ahead of print. [Google Scholar] [CrossRef] [PubMed]
- Queiroz, L.P.; Friedman, D.I.; Rapoport, A.M.; Purdy, R.A. Characteristics of migraine visual aura in Southern Brazil and Northern USA. Cephalalgia 2011, 31, 1652–1658. [Google Scholar] [CrossRef] [PubMed]
- Pavlović, J.M. The impact of midlife on migraine in women: Summary of current views. Womens Midlife Health 2020, 6, 11. [Google Scholar] [CrossRef] [PubMed]
- Ripa, P.; Ornello, R.; Degan, D.; Tiseo, C.; Stewart, J.; Pistoia, F.; Carolei, A.; Sacco, S. Migraine in menopausal women: A systematic review. Int. J. Womens Health 2015, 7, 773–782. [Google Scholar]
- Burstein, R.; Noseda, R.; Borsook, D. Migraine: Multiple processes, complex pathophysiology. J. Neurosci. 2015, 35, 6619–6629. [Google Scholar] [CrossRef]
- Ophoff, R.A.; Terwindt, G.M.; Vergouwe, M.N.; Oefner, R.; van Eijk, P.J.; Hoffman, S.M.; Lamerdin, J.E.; Mohrenweiser, H.W.; Bulman, D.E.; Ferrari, M.; et al. Familial hemiplegic migraine and episodic ataxia type-2 are caused by mutations in the Ca2+ channel gene CACNL1A4. Cell 1996, 87, 543–552. [Google Scholar] [CrossRef]
- De Fusco, M.; Marconi, R.; Silvestri, L.; Atorino, L.; Rampoldi, L.; Morgante, L.; Ballabio, A.; Aridon, P.; Casari, G. Haploinsufficiency of ATP1A2 encoding the Na+/K+ pump alpha2 subunit associated with familial hemiplegic migraine type 2. Nat. Genet. 2003, 33, 192–196. [Google Scholar] [CrossRef]
- Dichgans, M.; Freilinger, T.; Eckstein, G.; Babini, E.; Lorenz-Depiereux, B.; Biskup, S.; Ferrari, M.D.; Herzog, J.; van den Maagdenberg, A.M.; Pusch, M.; et al. Mutation in the neuronal voltage-gated sodium channel SCN1A in familial hemiplegic migraine. Lancet 2005, 366, 371–377. [Google Scholar] [CrossRef]
- de Vries, B.; Haan, J.; van den Maagdenberg, A.M.J.M.; Ferrari, M.D. Migraine. Genetics; In Encyclopedia of the Neurological Sciences, 2nd ed.; Aminoff, M.J., Daroff, R.B., Eds.; Academic Press: Oxford, UK, 2014; pp. 42–46. [Google Scholar]
- Schwaag, S.; Evers, S.; Schirmacher, A.; Stögbauer, F.; Ringelstein, E.B.; Kuhlenbäumer, G. Genetic variants of the NOTCH3 gene in migraine-a mutation analysis and association study. Cephalalgia 2006, 26, 158–161. [Google Scholar] [CrossRef]
- Tournier-Lasserve, E.; Joutel, A.; Melki, J.; Weissenbach, J.; Mark Lathrop, G.; Chabriat, H.; Mas, J.-L.; Cabanis, E.-A.; Baudrimont, M.; Maciazek, J.; et al. Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy maps to chromosome 19q12. Nat. Genet. 1993, 3, 256–259. [Google Scholar] [CrossRef]
- Ungaro, C.; Mazzei, R.; Conforti, F.L.; Sprovieri, T.; Servillo, P.; Liguori, M.; Citrigno, L.; Gabriele, A.L.; Magariello, A.; Patitucci, A.; et al. Cadasil: Extended polymorphisms and mutational analysis of the NOTCH3 gene. J. Neurosci. Res. 2009, 87, 1162–1167. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.M. Notch signaling and Notch signaling modifiers. Int. J. Biochem. Cell Biol. 2011, 43, 1550–1562. [Google Scholar] [CrossRef] [PubMed]
- Kopan, R.; Ilagan, M.X. The canonical Notch signaling pathway: Unfolding the activation mechanism. Cell 2009, 137, 216–233. [Google Scholar] [CrossRef]
- Aburjania, Z.; Jang, S.; Whitt, J.; Jaskula-Stzul, R.; Chen, H.; Rose, J.B. The Role of Notch3 in Cancer. Oncologist 2018, 23, 900–911. [Google Scholar] [CrossRef] [PubMed]
- Stephenson, N.L.; Avis, J.M. Direct observation of proteolytic cleavage at the S2 site upon forced unfolding of the Notch negative regulatory region. Proc. Natl. Acad. Sci. USA 2012, 109, E2757–E2765. [Google Scholar] [CrossRef] [PubMed]
- Joutel, A.; Vahedi, K.; Corpechot, C.; Troesch, A.; Chabriat, H.; Vayssière, C.; Cruaud, C.; Maciazek, J.; Weissenbach, J.; Bousser, M.G.; et al. Strong clustering and stereotyped nature of Notch3 muations in CADASIL patients. Lancet 1997, 350, 1511–1515. [Google Scholar] [CrossRef]
- Duering, M.; Karpinska, A.; Rosner, S.; Hopfner, F.; Zechmeister, M.; Peters, N.; Kremmer, E.; Haffner, C.; Giese, A.; Dichgans, M.; et al. Co-aggregate formation of CADASIL-mutant NOTCH3: A single-particle analysis. Hum. Mol. Genet. 2011, 20, 3256–3265. [Google Scholar] [CrossRef]
- Meng, H.; Zhang, X.; Yu, G.; Lee, S.J.; Chen, Y.E.; Prudovsky, I.; Wang, M.M. Biochemical characterization and cellular effects of CADASIL mutants of NOTCH3. PLoS ONE 2012, 7, 44964. [Google Scholar] [CrossRef]
- Opherk, C.; Duering, M.; Peters, N.; Karpinska, A.; Rosner, S.; Schneider, E.; Bader, B.; Giese, A.; Dichgans, M. CADASIL mutations enhance spontaneous multimerization of NOTCH3. Hum. Mol. Genet. 2009, 18, 2761–2767. [Google Scholar] [CrossRef]
- Joutel, A.; Andreux, F.; Gaulis, S.; Domenga, V.; Cecillon, M.; Battail, N.; Piga, N.; Chapon, F.; Godfrain, C.; Tournier-Lasserve, E. The ectodomain of the Notch3 receptor accumulates within the cerebrovasculature of CADASIL patients. J. Clin. Investig. 2000, 105, 597–605. [Google Scholar] [CrossRef]
- Yamamoto, Y.; Craggs, L.J.; Watanabe, A.; Booth, T.; Attems, J.; Low, R.W.; Oakley, A.E.; Kalaria, R.N. Brain microvascular accumulation and distribution of the NOTCH3 ectodomain and granular osmiophilic material in CADASIL. J. Neuropathol. Exp. Neurol. 2013, 72, 416–431. [Google Scholar] [CrossRef] [PubMed]
- Haritunians, T.; Chow, T.; De Lange, R.P.; Nichols, J.T.; Ghavimi, D.; Dorrani, N.; St Clair, D.M.; Weinmaster, G.; Schanen, C. Functional analysis of a recurrent missense mutation in Notch3 in CADASIL. J. Neurol. Neurosurg. Psychiatry 2005, 76, 1242–1248. [Google Scholar] [CrossRef] [PubMed]
- Rutten, J.W.; Dauwerse, H.G.; Gravesteijn, G.; van Belzen, M.J.; van der Grond, J.; Polke, J.M.; Bernal-Quiros, M.; Lesnik-Oberstein, S.A. Archetypal NOTCH3 mutations frequent in public exome: Implications for CADASIL. Ann. Clin. Transl. Neurol. 2016, 3, 844–853. [Google Scholar] [CrossRef]
- Mykkänen, K.; Junna, M.; Amberla, K.; Bronge, L.; Kääriäinen, H.; Pöyhönen, M.; Kalimo, H.; Viitanen, M. Different clinical phenotypes in monozygotic CADASIL twins with a novel NOTCH3 mutation. Stroke 2009, 40, 2215–2218. [Google Scholar] [CrossRef] [PubMed]
- Kowalska, M.; Wize, K.; Wieczorek, I.; Kozubski, W.; Dorszewska, J. Migraine and risk factors of vascular diseases. In Ischemic Stroke of Brain; Sanchetee, P., Ed.; IntechOpen: London, UK; Rijeka, Croatia, 2018; pp. 1–20. [Google Scholar]
- Varsome.com. Available online: https://varsome.com/position/hg38/19:15192257 (accessed on 13 December 2023).
- Dorszewska, J.; Kowalska, M.; Grzegorski, T.; Dziewulska, D.; Karmelita-Katulska, K.; Barciszewska, A.; Prendecki, M.; Gorczyński, W.; Kozubski, W. Clinical presentation of Y189C mutation of the NOTCH3 gene in the Polish family with CADASIL. Folia Neuropathol. 2020, 58, 83–92. [Google Scholar] [CrossRef]
- Varsome.com. Available online: https://varsome.com/variant/hg38/chr19%3A15192073%3AT%3AC? (accessed on 10 August 2023).
- NCBI.NLM.NIH.GOV Internet Site. Available online: https://www.ncbi.nlm.nih.gov/clinvar/variation/995327/ (accessed on 10 August 2023).
- NCBI.NLM.NIH.GOV Internet Site. Available online: https://www.ncbi.nlm.nih.gov/clinvar/variation/256148/?oq=rs1043994&m=NM_000435.3(NOTCH3):c.606A%3EG%20(p.Ala202=) (accessed on 10 August 2023).
- NCBI.NLM.NIH.GOV Internet site. Available online: https://www.ncbi.nlm.nih.gov/clinvar/variation/256131/?oq=rs3815188&m=NM_000435.3(NOTCH3):c.303C%3ET%20(p.Thr101=) (accessed on 10 August 2023).
- Singhal, S.; Bevan, S.; Barrick, T.; Rich, P.; Markus, H.S. The influence of genetic and cardiovascular risk factors on the CADASIL phenotype. Brain 2004, 127, 2031–2038. [Google Scholar] [CrossRef]
- Narayan, S.K.; Gorman, G.; Kalaria, R.N.; Ford, G.A.; Chinnery, P.F. The minimum prevalence of CADASIL in northeast England. Neurology 2012, 78, 1025–1027. [Google Scholar] [CrossRef]
- Ni, W.; Zhang, Y.; Zhang, L.; Xie, J.-J.; Li, H.-F.; Wu, Z.-Y. Genetic spectrum of NOTCH3 and clinical phenotype of CADASIL patients in different populations. CNS Neurosci. Ther. 2022, 28, 1779–1789. [Google Scholar] [CrossRef]
- He, D.; Chen, D.; Li, X.; Hu, Z.; Yu, Z.; Wang, W.; Luo, X. The comparisons of phenotype and genotype between CADASIL and CADASIL-like patients and population-specific evaluation of CADASIL scale in China. J. Headache Pain 2016, 17, 55. [Google Scholar] [CrossRef]
- Chen, S.; Ni, W.; Yin, X.Z.; Liu, H.Q.; Lu, C.; Zheng, Q.J.; Zhao, G.X.; Xu, Y.F.; Wu, L.; Zhang, L.; et al. Clinical features and mutation spectrum in Chinese patients with CADASIL: A multicenter retrospective study. CNS Neurosci. Ther. 2017, 23, 707–716. [Google Scholar] [CrossRef]
- Dunn, P.J.; Maksemous, N.; Smith, R.A.; Sutherland, H.G.; Haupt, L.M.; Griffiths, L.R. Investigating diagnostic sequencing techniques for CADASIL diagnosis. Hum. Genom. 2020, 14, 2. [Google Scholar] [CrossRef]
- Matsushima, T.; Conedera, S.; Tanaka, R.; Li, Y.; Yoshino, H.; Funayama, M.; Ikeda, A.; Hosaka, Y.; Okuzumi, A.; Shimada, Y.; et al. Genotype-phenotype correlations of cysteine replacement in CADASIL. Neurobiol. Aging 2017, 50, 1697–16914. [Google Scholar] [CrossRef] [PubMed]
- Ceroni, M.; Poloni, T.E.; Tonietti, S.; Fabozzi, D.; Uggetti, C.; Frediani, F.; Simonetti, F.; Malaspina, A.; Alimonti, D.; Celano, M.; et al. Migraine with aura and white matter abnormalities: Notch3 mutation. Neurology 2000, 54, 1869–1871. [Google Scholar] [CrossRef] [PubMed]
- Guey, S.; Mawet, J.; Hervé, D.; Duering, M.; Godin, O.; Jouvent, E.; Opherk, C.; Alili, N.; Dichgans, M.; Chabriat, H. Prevalence and characteristics of migraine in CADASIL. Cephalalgia 2016, 36, 1038–1047. [Google Scholar] [CrossRef]
- Zhu, Y.; Wang, J.; Wu, Y.; Wang, G.; Hu, B. Two novel mutations in NOTCH3 gene causes cerebral autosomal dominant arteriopathy with subcritical infarct and leucoencephalopathy in two Chinese families. Int. J. Clin. Exp. Pathol. 2015, 8, 1321–1327. [Google Scholar] [PubMed]
- Cappelli, A.; Ragno, M.; Cacchiò, G.; Scarcella, M.; Staffolani, P.; Pianese, L. High recurrence of the R1006C NOTCH3 mutation in central Italian patients with cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). Neurosci. Lett. 2009, 462, 176–178. [Google Scholar] [CrossRef] [PubMed]
- Guerreiro, R.J.; Lohmann, E.; Kinsella, E.; Brás, J.M.; Luu, N.; Gurunlian, N.; Dursun, B.; Bilgic, B.; Santana, I.; Hanagasi, H.; et al. Exome sequencing reveals an unexpected genetic cause of disease: NOTCH3 mutation in a Turkish family with Alzheimer’s disease. Neurobiol. Aging 2012, 33, 17–23. [Google Scholar] [CrossRef] [PubMed]
- Testi, S.; Malerba, G.; Ferrarini, M.; Ragno, M.; Pradotto, L.; Mauro, A.; Fabrizi, G.M. Mutational and haplotype map of NOTCH3 in a cohort of Italian patients with cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). J. Neurol. Sci. 2012, 319, 37–41. [Google Scholar] [CrossRef]
- Roy, B.; Maksemous, N.; Smith, R.A.; Menon, S.; Davies, G.; Griffiths, L.R. Two novel mutations and a previously unreported intronic polymorphism in the NOTCH3 gene. Mutat. Res. 2012, 732, 3–8. [Google Scholar] [CrossRef]
- Rutten-Jacobs, L.C.; Traylor, M.; Adib-Samii, P.; Thijs, V.; Sudlow, C.; Rothwell, P.M.; Boncoraglio, G.; Dichgans, M.; Bevan, S.; Meschia, J.; et al. Common NOTCH3 variants and cerebral small-vessel disease. Stroke 2015, 46, 1482–1487. [Google Scholar] [CrossRef]
- Keat Wei, L.; Griffiths, L.R.; Irene, L.; Kooi, C.W. Association of NOTCH3 gene polymorphisms with ischemic stroke and its subtypes: A Meta-Analysis. Medicina 2019, 55, 351. [Google Scholar] [CrossRef]
- González-Giraldo, Y.; Barreto, G.E.; Fava, C.; Forero, D.A. Ischemic stroke and six genetic variants in CRP, EPHX2, FGA, and NOTCH3 genes: A meta-analysis. J. Stroke Cerebrovasc. Dis. 2016, 25, 2284–2289. [Google Scholar] [CrossRef]
- Ensembl.org. Available online: https://www.ensembl.org/Homo_sapiens/Variation/Population?r=19:15191914-15192914;v=rs3815188;vdb=variation;vf=202725780 (accessed on 10 August 2023).
- Menon, S.; Cox, H.C.; Kuwahata, M.; Quinlan, S.; MacMillan, J.C.; Haupt, L.M.; Lea, R.A.; Griffiths, L.R. Association of a Notch 3 gene polymorphism with migraine susceptibility. Cephalalgia 2011, 31, 264–270. [Google Scholar] [CrossRef]
- Monteith, T.S.; Sprenger, T. Tension type headache in adolescence and childhood: Where are we now? Curr. Pain Headache Rep. 2010, 14, 424–430. [Google Scholar] [CrossRef]
- Fonseca, E.; Torres-Ferrús, M.; Gallardo, V.J.; Macaya, A.; Pozo-Rosich, P. Impact of puberty in pediatric migraine: A pilot prospective study. J. Clin. Neurol. 2020, 16, 416–422. [Google Scholar] [CrossRef]
- Coto, E.; Menéndez, M.; Navarro, R.; García-Castro, M.; Alvarez, V. A new de novo Notch3 mutation causing CADASIL. Eur. J. Neurol. 2006, 13, 628–631. [Google Scholar] [CrossRef]
- Grangeon, L.; Lange, K.S.; Waliszewska-Prosół, M.; Onan, D.; Marschollek, K.; Wiels, W.; Mikulenka, P.; Farham, F.; Gollion, C.; Ducros, A. European Headache Federation School of Advanced Studies (EHF-SAS). Genetics of migraine: Where are we now? J. Headache Pain 2023, 24, 12. [Google Scholar] [CrossRef]
- Li, S.J.; Shi, J.J.; Mao, C.Y.; Zhang, C.; Xu, Y.F.; Fan, Y.; Hu, Z.W.; Yu, W.K.; Hao, X.Y.; Li, M.J.; et al. Identifying causal genes for migraine by integrating the proteome and transcriptome. J. Headache Pain 2023, 24, 111. [Google Scholar] [CrossRef]
- de Boer, I.; Terwindt, G.M.; van den Maagdenberg, A.M.J.M. Genetics of migraine aura: An update. J. Headache Pain 2020, 21, 64. [Google Scholar] [CrossRef]
- Katsuki, M.; Matsumori, Y.; Kawahara, J.; Yamagishi, C.; Koh, A.; Kawamura, S.; Kashiwagi, K.; Kito, T.; Oguri, M.; Mizuno, S.; et al. Headache education by leaflet distribution during COVID-19 vaccination and school-based on-demand e-learning: Itoigawa Geopark Headache Awareness Campaign. Headache 2023, 63, 429–440. [Google Scholar] [CrossRef]
Domain of NOTCH3 Protein | Mutations in the NOTCH3 Gene |
---|---|
Signal peptide | L33 del, A34V |
EGF-like 1 | C43G, C43F, C49G, C49F, C49Y, R54C, S60C, C65S, C65Y, C67Y, W71C, R75W, R75P, C76R, C76W |
EGF-like 2 | 77–83 del, 80–84 del, C87R, C87Y, R90C, C93F, C93Y, C93 dup, C106W, C108W, C108Y, C108R, R110C, R113Q, 114–120 del, C117F, S118C |
EGF-like 3 | C123F, C123Y, C128Y, C128G, C128F, G131C, R133C, C134W, D139V, R141C, F142C, C144F, C144S, C144Y, S145C, C146R, C146F, C146Y, G149C, Y150C, 153–155 del, R153C, C155S, C155Y |
EGF-like 4, calcium-binding | C162S, C162W, R169C, H170R, G171C, C174F, C174R, C174Y, S180C, R182C, C183F, C183R, C183S, C185G, C185R, Y189C, C194F, C194R, C194S, C194Y |
EGF-like 5 | C201Y, C201R, A202E, C206Y, C206R, R207C, C209R, C212S, R213K, Y220C, C222G, C222Y, C224Y, C233S, C233Y, C233W |
EGF-like 6, calcium-binding | 239–253 del, V237M, C240S, C245R, C251R, C251S, C251G, Y258C, C260Y, C271F |
EGF-like 7 | S299C |
EGF-like 8, calcium-binding | A319C, R332C, S335C, Y337C, C338R |
EGF-like 9 | C366W, CC379S, C379R, G382C, C388Y |
EGF-like 10, calcium-binding | C395R, G420C, R421C, P426L, C428Y, C428S |
EGF-like 11, calcium-binding | C435R, C440G, C440S, C446S, C446F, R449C, C455R, Y465C |
EGF-like 12, calcium-binding | C484F, C484Y, C4884G, C495Y, P496L, S497L |
EGF-like 13, calcium-binding | C511R, C516Y, G528C, R532C, C533Y, C542Y |
Interdomain | R544C |
EGF-like 14, calcium-binding | C549Y, C549R, H556R, R558C, C568Y, R578C, R578H |
EGF-like 15, calcium-binding | A587C, C591R, C597W, R607C, R607H |
EGF-like 16, calcium-binding | R640C, V644D |
EGF-like 17, calcium-binding | G667C, R680H |
EGF-like 18 | Y710C, R728C |
EGF-like 19 | R767H, C775S |
EGF-like 20 -> EGF-like 23, calcium-binding | - |
EGF-like 24 | G953C |
EGF-like 25 | C977S, S978R, F984C, R985C, C988Y, C997G |
EGF-like 26 | R1006C, C1015R, A1020P, Y1021C, W1028C, R1031C |
EGF-like 27 | G1058C, C1061Y, D1063C, R1076C |
EGF-like 28 | C1099Y, Y1106C, N1118Y |
EGF-like 29, calcium-binding | H1133Q, C1157W |
EGF-like 30, calcium-binding | V1183M |
EGF-like 31 | R1231C, H1235L, R1242H |
EGF-like 32 | C1250W, C1261R, C1261Y |
EGF-like 33 | Q1297L |
EGF-like 34 | P1357L |
LNR 1 -> LNR 3 | - |
HD? | L1518M, L1547V, I1586V |
RAM? | L1691E, G1710D, R1748H, V1762M, R1837H |
ANK 1 -> ANK 5 | A1850S, A1850D, V1952M, F1995C, P2033T, P2074L, R2109Q, A2223V |
Number of People (N = 30) | Female | N = 20 | Male | N = 10 | |
---|---|---|---|---|---|
Age | 43.6 ± 11.5 | 39.6 ± 15.8 | |||
Age of CADASIL diagnosis | ≤45 years old >45 years old | 11 9 | ≤45 years old >45 years old | 5 5 | |
Headache | Yes | 20 | Yes | 9 | |
MA | Yes | 10 | Yes | 4 | |
MO | Yes | 3 | Yes | 0 | |
Other types of headaches (N = 12) | TTH (N = 2) | Yes | 1 | Yes | 1 |
Headache (N = 10) | Yes | 6 | Yes | 4 | |
Family history of headache | Yes | 11 | Yes | 4 | |
Genetic tests of NOTCH3 | Yes | 20 | Yes | 10 | |
Stroke in family history | Yes | 2 | Yes | 1 | |
Neuroimaging changes (MRI/CT) | Vascular changes/ischemic stroke | 8 | Vascular changes/ischemic stroke | 2 |
Genetic Variants of NOTCH3 Gene | Primer Sequences | Exon | Temperature of Annealing | Product Size [Base Pair, bp] |
---|---|---|---|---|
rs3815188 p.Thr101= rs28937321 p.Trp71Cys | Forward: 5′GGCCTCAGARAGAGCTGAACC3′ | 3 | 65 °C | 303 bp |
Reverse: 5′ACCCTCGATCTAAGGACCCC3′ | ||||
rs1043994 p.Ala202= | Forward: 5′GATGGACGCTTCCTCTGCT3′ | 4 | 62 °C | 300 bp |
Reverse: 5′CACCCCTCTGACTCTCCTGA3′ | ||||
rs371491165 p.Gln151Glu rs797045014 p.Arg153Cys rs2893369 rs28933697 p.Arg182Cys | Forward: 5′GATGGACGCTTCCTCTGCT3′ | 4 | 63 °C | 203 bp |
Reverse: 5′CATGGTGAGGGTGCACAG3′ | ||||
rs797045015 p.Asp105Gly rs137852642 p.Arg133Cys rs371491165 p.Gln151Glu | Forward: 5′AGTCTGGAGGGGAGGTAGTC3′ | 4 | 65 °C | 217 bp |
Reverse: 5′CACCCGGCACTCATCCAC3′ | ||||
rs864621965 p.Asp239_Asp253del | Forward: 5′GACCATCCTTGCCCCCTTC3′ | 5 | 65 °C | 209 bp |
Reverse: 5′CACCTGGCGCATGTCCAC3′ | ||||
rs35793356 p.Gly594= | Forward: 5′GGCCTCAGARAGAGCTGAACC3′ | 11 12 | 65 °C | 600 bp |
Reverse: 5′ACCCTCGATCTAAGGACCCC3′ |
NOTCH3 Genetic Variant | Clinical Significance | Number of Patients | Age of Patient [Mean Age ± SD or Single Results] | Type of Headache | Headache Attack Duration [Hours] | Number of Headache Attacks [Per Month] | Changes in the MRI/CT Image | References | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
MA | MO | Other Types of Headaches | No Headache | <24 | 24–48 | >48 | 1–2 | 3–4 | >4 | Vascular Changes/Ischemic Stroke | No Changes | ||||||
TTH | Other | ||||||||||||||||
p.Tyr189Cys | Pathogenic | 3 | 34.0 ± 1.0 | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 3 | 2 | 1 | 0 | 2 | 1 | [49] |
p.Arg153Cys | Pathogenic | 1 | 63 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | [50] |
p.Thr101= | Benign | ||||||||||||||||
p.Cys144Arg | Likely pathogenic | 1 | 53 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | [51] |
p.Ala202= p.Thr101= | Benign | ||||||||||||||||
p.Ala202= | Benign | 16 | 39.9 ± 13.0 | 9 | 1 | 1 | 4 | 1 | 14 | 1 | 1 | 10 | 2 | 4 | 3 | 13 | [52] |
p.Thr101= and p.Ala202= | Benign | 8 | 45.9 ± 13.5 | 5 | 1 | 1 | 1 | 0 | 4 | 3 | 1 | 3 | 1 | 4 | 2 | 6 | [53] |
chr19:15192257 T>G, exon 4, codon: 128, Cysteine | Not confirmed in the literature | 1 | 45 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | Varsome page [48] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szymanowicz, O.; Korczowska-Łącka, I.; Słowikowski, B.; Wiszniewska, M.; Piotrowska, A.; Goutor, U.; Jagodziński, P.P.; Kozubski, W.; Dorszewska, J. Headache and NOTCH3 Gene Variants in Patients with CADASIL. Neurol. Int. 2023, 15, 1238-1252. https://doi.org/10.3390/neurolint15040078
Szymanowicz O, Korczowska-Łącka I, Słowikowski B, Wiszniewska M, Piotrowska A, Goutor U, Jagodziński PP, Kozubski W, Dorszewska J. Headache and NOTCH3 Gene Variants in Patients with CADASIL. Neurology International. 2023; 15(4):1238-1252. https://doi.org/10.3390/neurolint15040078
Chicago/Turabian StyleSzymanowicz, Oliwia, Izabela Korczowska-Łącka, Bartosz Słowikowski, Małgorzata Wiszniewska, Ada Piotrowska, Ulyana Goutor, Paweł P. Jagodziński, Wojciech Kozubski, and Jolanta Dorszewska. 2023. "Headache and NOTCH3 Gene Variants in Patients with CADASIL" Neurology International 15, no. 4: 1238-1252. https://doi.org/10.3390/neurolint15040078
APA StyleSzymanowicz, O., Korczowska-Łącka, I., Słowikowski, B., Wiszniewska, M., Piotrowska, A., Goutor, U., Jagodziński, P. P., Kozubski, W., & Dorszewska, J. (2023). Headache and NOTCH3 Gene Variants in Patients with CADASIL. Neurology International, 15(4), 1238-1252. https://doi.org/10.3390/neurolint15040078