Next Article in Journal
Disentangling the Physiological Responses of Sweet Orange Citrus Trees to Optimize the Design of Deficit Irrigation Strategies
Previous Article in Journal
Prediction of Greenhouse Microclimatic Parameters Using Building Transient Simulation and Artificial Neural Networks
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Organic Fertilizer with Different Degrees of Maturity on Bacteria in Saline–Alkali Soil

1
College of Grassland, Resources and Environment, Inner Mongolia Agricultural University, Hohhot 010018, China
2
Inner Mongolia Academy of Agricultural & Animal Husbandry Science, Hohhot 010031, China
3
Erdos Forest Farm, Ordos 017000, China
*
Authors to whom correspondence should be addressed.
Agronomy 2024, 14(6), 1148; https://doi.org/10.3390/agronomy14061148
Submission received: 2 April 2024 / Revised: 26 May 2024 / Accepted: 26 May 2024 / Published: 27 May 2024
(This article belongs to the Section Soil and Plant Nutrition)

Abstract

:
Soil microorganisms are important components of soil ecosystems, and their diversity plays an important role in maintaining their functional stability. Organic fertilizer is an important measure for improving soil fertility in agronomic practice. The effects of organic fertilizer on soil microbial diversity and community structure are different with different degrees of maturation. In this study, uncomposted organic fertilizer (R), high-temperature organic fertilizer (H), cooling organic fertilizer (C), and decomposed organic fertilizer (D) were applied, and the 16S rRNA gene sequences of bacteria in soil were analyzed via high-throughput sequencing technology to understand the effects of organic fertilizer with different degrees of maturation on bacterial diversity and community structure in saline soil. Compared with no fertilization, the uncomposted organic fertilizer, high-temperature organic fertilizer, and decomposed organic fertilizer treatments significantly reduced soil bacterial diversity: the decomposed organic fertilizer treatment significantly reduced soil bacterial richness, the cooling organic fertilizer treatment had no significant effect on soil bacterial diversity and bacterial richness, Proteobacteria representing soil nutrients significantly increased under the cooling organic fertilizer treatment, and the relative abundance of Firmicutes significantly decreased. These four organic fertilizers, with different degrees of maturation, significantly increased the beneficial bacterium Bacillus and nitrile-based degrading bacteria but also significantly increased the potential pathogenicity of the soil, and there was no significant difference between the four treatments. In addition, during a cooling period, the organic fertilizer treatment helped to increase the population of oxidative-stress-tolerant bacteria. The application of organic fertilizer during a cooling period to saline–alkali soil is more helpful in improving its nutrient levels.

1. Introduction

There is a large amount of uncultivated saline soil in China, and it is an important reserve of land resources. Finding ways to improve and manage these saline soils has become one of the emphases of future land use research [1]. Saline soil usually has a high salt content, a heavy soil texture, insufficient nutrients, and low microbial activity, which greatly limit the growth and development of plants. Soil microorganisms are the most active and important parts of soil ecosystems. They play an important role in maintaining the stability and sustainability of this ecosystem [2] and play a key role in soil organic matter decomposition, nutrient cycling, improving soil structure, regulating soil fertility, and promoting crop growth [3]. Microorganisms are extremely sensitive to soil disturbances and external environmental changes. Compared with physical and chemical soil indicators, they can quickly characterize soil quality changes [4].
Applying organic fertilizer is an important measure of soil improvement and soil fertility enhancement. Organic fertilizer can effectively change the species and quantity of soil microorganisms and thereby affect the structure and spatial distribution of the soil bacterial community [5,6,7,8]. Soil bacterial diversity and community structure can sensitively reflect soil quality, soil fertility, and soil health [9,10]. Different kinds of organic fertilizers have different effects on soil nutrients and crop growth owing to their different carbon source types and physicochemical properties. Different kinds of organic fertilizers have different effects on the growth of microorganisms and the composition of microbial communities after their application in soil [11]. The distribution of the soil microbial community is mainly affected by the soil nutrients and total organic carbon content [12]. In addition, applying different organic fertilizers leads to the production of different soil physical and chemical properties, which, in turn, affects soil enzyme activity and participates in a series of biochemical reactions and material metabolism processes in soil, thus affecting the abundance of dominant microbial flora and the composition of the microbial community [13].
At present, the research on soil physicochemical properties and the microbial structure of uncomposted green manure and straw returning is relatively popular. Fresh organic matter helps to enhance soil microbial activity, but the amount of organic carbon mineralization is large, and the carbon sequestration capacity is poor. By contrast, livestock and poultry manure has a complex structure; its decomposition is slow and long-lasting and can sustainably supply microbial nutrition and energy [14]. However, in order to reduce the risk of pathogens entering the soil, soil fertilization and improvement usually use fully decomposed organic fertilizers. However, the completely decomposed organic fertilizer has a large loss in nutrients and carbon. Therefore, some researchers have long suggested that a certain amount of uncomposted organic material should be applied to soil every year to continuously renew and activate aging humus materials, thereby improving soil enzyme activity and carbon storage. However, which specific degree of organic fertilizer application can better increase soil nutrition and stability needs to be further studied. Additionally, we learned that organic fertilizers with different degrees of maturity not only affect soil nutrient characteristics but also change the structure and spatial distribution of the soil’s bacterial community. At present, there are few reports on the response of organic fertilizers with different degrees of maturity to soil microbial community structure and environmental changes; in particular, there is no clear research process or results for the bacterial community structure of saline soil in the Yellow River Basin of Inner Mongolia.
This study took an uncomposted organic fertilizer, high-temperature organic fertilizer, cooling organic fertilizer, and decomposed organic fertilizer as the research object and studied the effects of organic fertilizer with different composting degrees on bacterial diversity and community structure in saline soil. We intend to provide a technical reference for changes in soil microbial properties in the process of saline–alkali land treatment and improvement, as well as to provide a scientific basis for organic fertilizer fermentation control and the use of saline land.

2. Materials and Methods

2.1. Test Materials

Test soil: The test soil was taken from uncultivated saline soil in the Yellow River Basin, and the texture was sandy. The sampling area has a continental monsoon climate with four distinct seasons, the average annual precipitation is about 350 mm, and the average annual evaporation is about 1800 mm. The soil’s basic chemical indices (0~20 cm) are as follows: the electrical conductivity is 1246 μs cm−1, the organic matter content is 5.02 g kg−1, the alkali-hydrolyzed nitrogen concentration is 35.00 mg kg−1, the available phosphorus level is 18.91 mg kg−1, the available potassium content is 99.93 mg kg−1, the microbial biomass carbon concentration is 27.67 mg kg−1, and the microbial biomass nitrogen concentration is 2.91 mg kg−1. The soil was air-dried and passed through a 2 mm sieve. The soil salt indices are shown in Table 1.
Organic fertilizer for testing: Uncomposted organic fertilizer (initial organic fertilizer), high-temperature organic fertilizer, cooling organic fertilizer, and decomposed organic fertilizer were taken from sheep manure during self-heating aerobic composting. The organic fertilizer was air-dried and crushed through a 2 mm sieve and then inactivated at 120 °C. The indicators of organic fertilizer are shown in Table 2.

2.2. Experimental Design and Method

The experiment was carried out in April 2021 at the Inner Mongolia Academy of Agricultural and Animal Husbandry Sciences with four fertilization treatments. They were as follows: uncomposted organic fertilizer, high-temperature organic fertilizer, cooling organic fertilizer, and decomposed organic fertilizer. Based on the application amount commonly used by farmers, 2000 kg/667 m2, the amount of soil fertilizer per unit of weight in this experiment was converted to 17.0 g/kg based on the inner diameter area of the basin. Treatment without fertilization was used as a control, and all treatments were repeated 3 times.
The pot culture method (no crops) was used in this experiment. The organic fertilizer was fully mixed with 5.0 kg of soil and loaded into a PP resin environmental protection pot (diameter, 240 mm; height, 250 mm). Then, 4/5 of the pot was buried in soil so that the soil in the pot was consistent with the ground height. It was cultured under ventilation, natural temperature change, and rain shelter conditions. Irrigation was carried out regularly to maintain the water-holding capacity of the field at about 70%.
Note: Each treatment in this article is represented by the following abbreviations. R: uncomposted organic fertilizer treatment; H: high-temperature organic fertilizer treatment; C: cooling organic fertilizer treatment; D: decomposed organic fertilizer treatment; Y: treatment without fertilization.

2.3. Sampling and Processing

On the 180th day after culturing began (October of the same year), 0–20 cm soil samples were collected using a small soil drill (five-point sampling method). They were mixed evenly, removing impurities such as plant residues; packed into a mold-free centrifuge tube; and stored in a refrigerator at −80 °C.

2.4. Determination Items and Methods

The total DNA of the soil microorganisms was extracted using an OMEGA kit, and the extraction was carried out according to the operation instructions. The quality, concentration, and fragment length of the extracted DNA were detected using a NanoDrop ND-2000 spectrophotometer and 1% agarose gel electrophoresis. The soil samples were sent to Shanghai Meiji Biomedicine Technology Co., Ltd., Shanghai, China for Illumina MiSeq sequencing. Primer corresponding areas: 16SV3-4 zone [338F/806R (5′_ACTCCTACGGGAGGCAGCAG_3′/5′_GGACTACHVGGGTWTCTAAT_3′)]. The Qiime 2 (V2020.2) analysis process was used for sequence denoising or ASV (amplicon sequence variant) clustering. A Bayes classifier was used for species annotation. The comparison database was silva138/16s_bacteria. Based on the distribution of ASVs in different samples, the Alpha diversity level of each sample was evaluated. The distance matrix of each sample was calculated to measure the Beta diversity between different treatments. According to the 16S rRNA sequencing results, the BugBase phenotype of the soil bacteria was predicted.

2.5. Data Analysis

Excel 2010 was used to sort out and calculate the basic data, SPSS20.0 was used to analyze data variance, and the RDP classifier Bayesian algorithm was used to classify the representative sequences of OTU at a 97% similarity level. PCoA and BugBase phenotype prediction were performed through the Shanghai Meiji Biocloud platform. The subgroup samples of the community composition analysis chart were calculated using the mean value method, and the data in the chart were the mean ± standard deviation.

3. Results and Analysis

3.1. OTU Distribution of Soil Bacteria Caused by Organic Fertilizer with Different Degrees of Maturity

The overlap of OTU sequences with more than 97% similarity with the soil bacterial community under each treatment is expressed as a Venn diagram (Figure 1). The mutual OTU number of the five treatments was 819, and each treatment had unique OTUs. The number of bacterial OTUs was in the order Y (1880) > R (1879) > H (1840) > C (1825) > D (1723). The number of bacterial OTUs in the D treatment was the smallest, and the number of common bacterial species in the R, H, and C treatments was the largest. The R treatment had the highest unique OTU, while the H and C treatments had high consistency and a small difference. There were significant differences in bacterial species between the D and Y treatments.

3.2. Analysis of Alpha Diversity of Soil Bacteria Caused by Organic Fertilizer with Different Degrees of Maturity

The community richness index reflects the richness of species in a community, including Sobs, Chao, Ace, Jack, bootstrap, etc. Community diversity reflects the comprehensive status of species richness and evenness, such as Shannon–Wiener (Shannon), Simpson, and invsimpson.
Our analysis of the soil bacterial community richness indices (Chao1 index and Ace index) and the community diversity indices (Shannon index and Simpson index) of organic fertilizers with different degrees of maturity showed (Table 3) that the Chao1 index values and the Ace index values of the R, H, and C treatments were higher than those of the Y treatment, while those of the D treatment were significantly reduced (Table 3). The order of Chao1 index values was R > H > C > Y > D, indicating that R, H, and C helped to improve the bacterial richness of saline soil, while the D treatment significantly reduced the bacterial richness of saline soil. The Shannon index values of the four fertilization treatments were lower than that of Y. There were significant differences between R, H, D, and Y, and the Simpson index values of the four fertilization treatments significantly increased compared with that of Y. This indicated that R, H, and D significantly reduced the bacterial diversity of saline soil, and the C treatment could improve bacterial richness while also minimizing reductions in the bacterial diversity of saline soil.

3.3. Analysis of Beta Diversity of Soil Bacteria Caused by Organic Fertilizer with Different Degrees of Maturity

Figure 2 shows a Beta diversity analysis of the soil bacterial community structure based on relative abundance at the genus level. The PC1 axis and PC2 axis explained 79.79% of the total variation in the community structure. The Y treatment was located in the first and fourth quadrants, the R treatment was located in the second quadrant, the D treatment was located in the fourth quadrant, and the H and C treatments spanned the second and third quadrants. The community distribution between different treatments showed some differences. The Adonis test (R2 = 0.7855, p < 0.05) showed that the distance between groups was greater than that within groups. Therefore, the differences mainly came from different fertilization treatments. Four organic fertilizers with different degrees of maturity significantly changed the bacterial community structure, and there were also differences in the bacterial community structure between the C and D treatments and the R treatments.

3.4. Effects of Organic Fertilizers with Different Degrees of Maturity on Soil Bacterial Community Structure

Figure 3a shows the composition of the bacterial phylum-level community after applying organic fertilizer with different degrees of maturity. The results show that Proteobacteria accounted for 15.88–31.67%, Firmicutes accounted for 11.23–27.98%, Actinobacteria accounted for 12.39–36.64%, Bacteroidota accounted for 5.95–10.37%, and Chloroflexi accounted for 5.94–8.88%, accounting for 78.01–87.45% of the total abundance. There were significant differences in the ordering of the top 5 dominant phyla in the relative abundance of soil under different treatments. The order for treatment Y was Actinobacteria, Proteobacteria, Firmicutes, Bacteroidota, and Chloroflexi; the order for treatment R was Proteobacteria, Firmicutes, Actinobacteria, Chloroflexi, and Bacteroidota; and the dominant phyla of the other treatments were consistent, with Proteobacteria, Firmicutes, Actinobacteria, Bacteroidetes, and Chloroflexi. Therefore, adding organic fertilizers with different degrees of maturity changed the relative abundance of bacterial phyla and their dominant phyla.
Figure 3b shows that, compared with treatment Y, the four different degrees of organic fertilizer treatments significantly increased the dominant bacteria Proteobacteria and Firmicutes and significantly decreased Actinobacteria and Gemmatimonadetes (p < 0.05). Compared with Y, the relative abundance of Proteobacteria increased by 79.35%, 82.75%, 99.43%, and 83.56%, respectively, and that of Firmicutes increased by 141.14%, 147.20%, 98.13%, and 149.15%, respectively. The relative abundance of Actinobacteria decreased by 66.18%, 62.69%, 59.17%, and 61.41%, respectively, and that of Gemmatimonadetes decreased by 64.77%, 68.85%, 66.55%, and 68.17%, respectively. There was no significant difference between the four fertilization treatments. In addition, there was no significant difference in the relative abundance of Bacteroidetes between the R, H, and Y treatments, but C and D significantly increased by 73.99% and 71.81% compared with the Y treatment, and C and D were significantly different from the R and H treatments (p < 0.05).

3.5. Effects of Organic Fertilizers with Different Degrees of Maturity on Soil Bacterial Phenotype Prediction

BugBase phenotype prediction analysis can determine the high-level phenotypes in soil bacterial communities. The results are shown in Figure 4. Gram-negative bacteria had the highest population abundance in saline–alkali soil, while anaerobic bacteria had a low population abundance. Compared with Y, the four organic fertilizer treatments with different degrees of maturity significantly increased the population abundance of facultative anaerobic bacteria, mobile elements, biofilm-forming bacteria, potential pathogenic bacteria, and oxidative-stress-tolerant bacteria. With the increase in composting time, the population abundance of oxidative-stress-tolerant bacteria gradually increased. The population abundance of oxidative-stress-tolerant bacteria in treatment C was the highest and was significantly higher than that in the R and H treatments. In addition, the population abundance of anaerobic bacteria in treatment D was significantly higher than that in treatment R. Although there were some differences in the population abundance of other phenotypic bacteria under the different treatments, they did not reach a significant level.

4. Discussion

4.1. Effects of Organic Fertilizers with Different Degrees of Maturity on Bacterial Community Diversity in Saline–Alkali Soil

Soil microorganisms are an important part of the soil system, and bacteria are the largest and most active group of microorganisms [15,16], playing an important role in the saline soil ecosystem. The diversity and richness of bacterial communities play an important ecological function in soil nutrient cycling, organic matter degradation, transformation, etc. [17,18,19], and are often changed by different fertilization systems [20,21]. In this study, the diversity of soil bacterial communities decreased after applying four different degrees of maturity organic fertilizers. The order of bacterial community diversity was Y > C > R > H > D; that is, the soil bacterial community diversity of the incompletely decomposed organic fertilizer treatment was higher than that of the decomposed organic fertilizer treatment. Liu Haiyang also found that the diversity of the soil bacterial community decreased when applying pig manure to a rice–rape rotation planting area, and the higher the nitrogen content of pig manure, the greater the decrease in soil bacterial community diversity [22]. This may be due to the gradual increase in total nitrogen content with the activated decomposition of organic fertilizer [23], which stimulates an increase in nitrogen-philic microorganisms and leads to competition with other microorganisms [24]. Some studies have also shown that uncomposted organic materials contain a large number of easily degradable carbon sources; decomposed organic materials contain a large number of easily degradable carbon sources, thus leading to a decrease in soil microbial diversity [25]. In addition, pH is also a key factor affecting the diversity of soil bacterial communities [26,27]. Soil bacteria are very sensitive to salt changes. In severe saline–alkali ecosystems, they will produce osmotic stress in bacteria and ultimately reduce and inhibit the active bacterial population and its quantity [28]. In our study, soil bacterial community richness increased in the R, H, and C treatments, which is similar to the results of Dong’s study [1]. However, decomposed organic fertilizer significantly reduced the soil bacterial richness, which was the same as in Peng’s study [5]. This may be due to the low content and energy of easily degradable carbon sources in decomposed organic materials, which reduces the metabolism and reproduction of microorganisms, thereby reducing the richness of the soil bacteria [25]. Therefore, incompletely decomposed organic fertilizer can increase the richness of the soil bacterial community and increase the number of species in the community, while completely decomposed organic fertilizer significantly reduces the richness of the bacterial community. Through a PCoA of Beta diversity, we found that the bacterial community structure under the organic fertilizer treatment in the cooling period and decomposed period was different from that of the uncomposted organic fertilizer treatment.

4.2. Effects of Organic Fertilizers with Different Degrees of Maturity on Bacterial Community Structure in Saline–Alkali Soil

After applying organic fertilizer with different degrees of maturity, the top 3 phyla with respect to soil relative abundance were Proteobacteria, Actinobacteria, and Firmicutes. These phyla are common in saline soil. Proteobacteria is the most abundant phylum in the world. It is the dominant phylum in most soils [29,30] and participates in a variety of soil biogeochemical cycles [31]. In this experiment, applying four kinds of organic fertilizers with different degrees of maturity significantly increased the relative abundance of Proteobacteria, and the increase caused by the organic fertilizer treatment during the cooling period was the highest. Proteobacteria are significantly correlated with soil nutrients and enzyme activities, and an increase in their relative abundance is also a manifestation of increased soil nutrients [32]. Actinobacteria are aerobic bacteria that can degrade complex lignin and cellulose [33]. In this experiment, there were significantly fewer actinobacteria in the four fertilization treatments, which may be related to the severe salinization of the tested soil. Some studies have also shown that maintaining the field-water-holding capacity during the test period increases the anaerobic environment of the soil and thus inhibits the growth of Actinobacteria [29]. Firmicutes are the main degraders of organic matter and can degrade complex organic matter. All four fertilization treatments significantly increased Firmicutes, which is the same as in previous research results [34]. However, the abundance of soil Firmicutes in the organic fertilizer treatment during the cooling period was lower than that in the other fertilization treatments. This may be because the organic fertilizer treatment during the cooling period improved the physical and chemical properties of the soil and changed the enzyme activity, thus driving the change in the microbial community structure. Acidobacteria and Chloroflexi are oligotrophic bacteria and can be used as indicators of a poor soil environment [35]. In this study, the order of the relative abundance of Acidobacteria and Chloroflexi in the four fertilization treatments was R > Y > H > C ≥ D. The results showed that the organic fertilizer treatment during the cooling period and the decomposed period reduced the poor nutrient bacteria, which proved that these two fertilization treatments were more helpful in improving the poor soil environment. In addition, Planctomycetes are obligate aerobic bacteria that can use nitrite (NO2) and ammonium oxide ions (NH4+) to generate nitrogen to obtain energy in anoxic environments, which is of great significance to the nitrogen cycle. In this experiment, the number of Planctomycetes under the decomposed organic fertilizer treatment was significantly lower, which may have been due to the less easily degradable carbon source and energy in decomposed organic fertilizer, reducing the energy available to soil microorganisms and, therefore, the metabolism and reproduction of Planctomycetes.
The effect of fertilization on soil is complicated. The diversity and community structures of soil bacteria are the collective results of multiple factors in the soil environment. In addition to nutrients provided by organic fertilizer, the microbial growth environment also significantly affects the diversity and community structure of soil bacteria [36].

4.3. Effects of Organic Fertilizers with Different Degrees of Maturity on Bacterial Community Function in Saline–Alkali Soil

BugBase phenotype prediction showed that the four treatments significantly increased the population abundance of facultative anaerobic bacteria, mobile elements, biofilm-forming bacteria, potential pathogenic bacteria, and oxidative-stress-tolerant bacteria. Nowadays, to reduce the introduction of pathogenic bacteria into manure, soil fertilization and improvements are mainly achieved using fully decomposed organic fertilizers. In this study, four kinds of organic fertilizers with different degrees of maturity significantly increased the potential pathogenicity of the soil, but there was no significant difference between the four treatments. This showed that there was no significant difference in the pathogenic microorganisms in the soil treated with incompletely decomposed organic fertilizer and decomposed organic fertilizer after high-temperature sterilization. In addition, the abundance of anaerobic bacteria in the uncomposted organic fertilizer treatment was significantly lower than that in the decomposed organic fertilizer treatment, which may be because the uncomposted organic fertilizer continuously updated and activated the aging humus in the soil, and the soil enzyme increased the soil aeration, thus improving the soil’s physical properties. Since a species may belong to multiple phenotypes, further studies should include predictive analyses of the bacterial BugBase phenotype.

5. Conclusions

Applying organic fertilizers with different degrees of maturity changed the diversity and relative abundance of bacteria in saline–alkali soil. Uncomposted organic fertilizer, high-temperature organic fertilizer, and decomposed organic fertilizer significantly reduced the soil bacterial diversity, and decomposed organic fertilizer significantly reduced the soil bacterial richness.
The soil bacterial community structure of the four fertilization treatments was significantly different from that of the non-fertilization treatment, and there were significant differences in the bacterial community structure between the organic fertilizer treatment during the cooling period, that during the decomposed period, and that during the uncomposted period.
The dominant bacterial phylum was basically the same after the organic fertilizers with different degrees of maturity were applied to the soil, but the relative abundance of bacterial phyla in each treatment was different. The four fertilization treatments significantly increased the dominant bacteria Proteobacteria and Firmicutes and significantly reduced Actinobacteria and Gemmatimonadetes. The relative abundance of Bacteroidetes in the organic fertilizer treatments during the cooling and decomposed periods was significantly higher than that in the uncomposted and high-temperature organic fertilizer treatments.
BugBase phenotype prediction showed that the four kinds of organic fertilizers with different degrees of maturity significantly increased the potential pathogenicity of the soil. Although there was no significant difference between them, the abundance of potential pathogenic bacteria in the organic fertilizers during the cooling period was relatively low. In addition, with an increase in organic fertilizer decomposition time, the abundance of oxidative-stress-tolerant bacteria increased gradually. The abundance of oxidative-stress-tolerant bacteria in the organic fertilizer treatment during the cooling period was the highest and significantly higher than that in the organic fertilizer treatment during the uncomposted and high-temperature periods.
In conclusion, using organic fertilizer during a cooling period helps improve the diversity and richness of bacterial communities in saline–alkali soil, increase the abundance of soil oxidative-stress-tolerant bacteria, and reduce the possibility of soil diseases; it can also be used to regulate the soil micro-ecological environment.

Author Contributions

Conceptualization, Q.S.; methodology, Q.S. and W.J.; software, H.B., Y.L. and S.C.; validation, H.B., M.L., Y.J. and G.X.; formal analysis, H.B., Y.L. and S.C.; investigation, Y.J. and J.W.; resources, Q.S., W.J. and M.L.; data curation, H.B., Y.J. and Y.L.; writing—original draft preparation, H.B., Y.L. and S.C.; writing—review and editing, Q.S. and M.L.; visualization, Q.S.; supervision, Q.S.; project administration, Q.S.; funding acquisition, Q.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Youth Innovation Fund Project of the Inner Mongolia Academy of Agricultural and Animal Husbandry Sciences (2020QNJJN07, Quanyi Suo, Wei Jiang and Yajie Li participated).

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Deng, P.B.; Guo, L.P.; Yang, H.T.; Leng, X.Y.; Wang, Y.M.; Bi, J.; Shi, C.F. Effect of an organic fertilizer of ganoderma lucidum residue on the physical and chemical properties and microbial communities of saline alkaline soil. Water 2023, 15, 962. [Google Scholar] [CrossRef]
  2. Bardgett, R.D.; van der Putten, W.H. Belowground biodiversity and ecosystem functioning. Nature 2014, 515, 505–511. [Google Scholar] [CrossRef]
  3. Antonio, C.; Nathan, S.B.; Sarah, L.S. Impact of fumigants on non-target soil microorganisms: A review. J. Hazard. Mater. 2022, 427, 128149. [Google Scholar] [CrossRef]
  4. Nsabimana, D.; Haynes, R.J.; Wallis, F.M. Size, activity and catabolic diversity of the soil microbial biomass as affected by land use. Appl. Soil Ecol. 2004, 26, 81–92. [Google Scholar] [CrossRef]
  5. Peng, M.; Tabashsum, Z.; Millner, P.; Parveen, S.; Biswas, D. Influence of manure application on the soil bacterial microbiome in integrated crop-livestock farms in maryland. Microorganisms 2021, 9, 2586. [Google Scholar] [CrossRef]
  6. Lee, J.; Jo, N.Y.; Shim, S.Y.; Linh, L.T.Y.; Kim, S.R.; Lee, M.G.; Hwang, S.G. Effects of hanwoo (Korean cattle) manure as organic fertilizer on plant growth, feed quality, and soil bacterial community. Front. Plant Sci. 2023, 14, 1135947. [Google Scholar] [CrossRef]
  7. Gu, Y.Y.; Zhang, H.Y.; Liang, X.Y.; Fu, R.; Li, M.; Chen, C.J. Impact of biochar and bioorganic fertilizer on rhizosphere bacteria in saline-alkali soil. Microorganisms 2022, 10, 2310. [Google Scholar] [CrossRef]
  8. Zhang, X.; Davidson, E.A.; Mauzerall, D.L.; Searchinger, T.D.; Dumas, P.; Shen, Y. Managing nitrogen for sustainable development. Nature 2015, 528, 51–59. [Google Scholar] [CrossRef]
  9. Lu, S.; He, Y.H.; Chen, Y.Q.; Chen, L.J.; Wang, Z.Y.; Yuan, J.; Wu, L.C. Co-analysis of rhizosphere metabolomics and bacterial community structures to unfold soil ecosystem health in Camellia oleifera land under long-term cultivation. Appl. Soil Ecol. 2022, 171, 104336. [Google Scholar] [CrossRef]
  10. Wang, Y.; Liu, L.; Luo, Y.; Awasthi, M.K.; Yang, J.; Duan, Y.; Li, H.; Zhao, Z. Mulching practices alter the bacterial-fungal community and network in favor of soil quality in a semiarid orchard system. Sci. Total Environ. 2020, 725, 138527. [Google Scholar] [CrossRef]
  11. Liu, J.A.; Shu, A.P.; Song, W.F.; Shi, W.C.; Li, M.C.; Zhang, W.X.; Gao, Z. Long-term organic fertilizer substitution increases rice yield by improving soil properties and regulating soil bacteria. Geoderma 2021, 404, 115287. [Google Scholar] [CrossRef]
  12. Busby, R.R.; Torbert, A.H.; Gebhart, L.D. Carbon and nitrogen mineralization of non-composted and composted municipal solid waste in sandy soils. Soil Biol. Biochem. 2007, 39, 1277–1283. [Google Scholar] [CrossRef]
  13. Ren, J.; Liu, X.; Yang, W.; Yang, X.; Li, W.; Xia, Q.; Li, J.; Gao, Z.; Yang, Z. Rhizosphere soil properties, microbial community, and enzyme activities: Short-term responses to partial substitution of chemical fertilizer with organic manure. J. Environ. Manag. 2021, 299, 113650. [Google Scholar] [CrossRef]
  14. Chatzistathis, T.; Kavvadias, V.; Sotiropoulos, T.; Papadakis, I.E. Organic fertilization and tree orchards. Agriculture 2021, 11, 692. [Google Scholar] [CrossRef]
  15. Joergensen, G.R.; Wichern, F. Alive and kicking: Why dormant soil microorganisms matter. Soil Biol. Biochem. 2018, 116, 419–430. [Google Scholar] [CrossRef]
  16. Ren, C.; Teng, Y.; Chen, X.; Shen, Y.; Xiao, H.; Wang, H. Impacts of earthworm introduction and cadmium on microbial communities composition and function in soil. Environ. Toxicol. Pharmacol. 2021, 83, 103606. [Google Scholar] [CrossRef]
  17. Shang, L.; Wan, L.; Zhou, X.; Li, S.; Li, X. Effects of organic fertilizer on soil nutrient status, enzyme activity, and bacterial community diversity in Leymus chinensis steppe in Inner Mongolia, China. PLoS ONE 2020, 15, e0240559. [Google Scholar] [CrossRef]
  18. Bai, Y.C.; Li, B.X.; Xu, C.Y.; Raza, M.; Wang, Q.; Wang, Q.Z.; Fu, Y.N.; Hu, J.Y.; Imoulan, A.; Hussain, M.; et al. Intercropping walnut and tea: Effects on soil nutrients, enzyme activity, and microbial communities. Front. Microbiol. 2022, 13, 852342. [Google Scholar] [CrossRef]
  19. Jiao, S.; Peng, Z.; Qi, J.; Gao, J.; Wei, G. Linking bacterial-fungal relationships to microbial diversity and soil nutrient cycling. MSystems 2021, 6, e01052-20. [Google Scholar] [CrossRef]
  20. Sparks, D.L.; Page, A.L.; Helmke, P.A.; Loeppert, R.H. Methods of Soil Analysis, Part 3, Chemical Methods. Soil Sci. Soc. Am. Am. Soc. Agron. 1996, 32, 869–920. [Google Scholar]
  21. Esperschütz, J.; Gattinger, A.; Mäder, P.; Schloter, M.; Fliessbach, A. Response of soil microbial biomass and community structures to conventional and organic farming systems under identical crop rotations. FEMS Microbiol. Ecol. 2007, 61, 26–37. [Google Scholar] [CrossRef] [PubMed]
  22. Liu, H.; Huang, X.; Tan, W.; Di, H.; Xu, J.; Li, Y. High manure load reduces bacterial diversity and network complexity in a paddy soil under crop rotations. Soil Ecol. Lett. 2020, 2, 104–119. [Google Scholar] [CrossRef]
  23. Li, M.X.; He, X.S.; Tang, J.; Li, X.; Zhao, R.; Tao, Y.Q.; Wang, C.; Qiu, Z.P. Influence of moisture content on chicken manure stabilization during microbial agent-enhanced composting. Chemosphere 2021, 264, 128549. [Google Scholar] [CrossRef]
  24. Bobbink, R.; Hicks, K.; Galloway, J.; Spranger, T.; Alkemade, R.; Ashmore, M.; Bustamante, M.; Cinderby, S.; Davidson, E.; Dentener, F.; et al. Global assessment of nitrogen deposition effects on terrestrial plant diversity: A synthesis. Ecol. Appl. A Publ. Ecol. Soc. Am. 2010, 20, 30–59. [Google Scholar] [CrossRef] [PubMed]
  25. Bruggen, V.A.; Semenov, A. In search of biological indicators for soil health and disease suppression. Appl. Soil Ecol. 2000, 15, 13–24. [Google Scholar] [CrossRef]
  26. Bei, Q.; Yang, T.; Ren, C.; Guan, E.; Dai, Y.; Shu, D.; He, W.; Tian, H.; Wei, G. Soil pH determines arsenic-related functional gene and bacterial diversity in natural forests on the Taibai Mountain. Environ. Res. 2023, 220, 115181. [Google Scholar] [CrossRef] [PubMed]
  27. Cheng, J.; Zhao, M.; Cong, J.; Qi, Q.; Xiao, Y.; Cong, W.; Deng, Y.; Zhou, J.; Zhang, Y. Soil pH exerts stronger impacts than vegetation type and plant diversity on soil bacterial community composition in subtropical broad-leaved forests. Plant Soil 2020, 450, 273–286. [Google Scholar] [CrossRef]
  28. PGarcıá-Gil, J.C.; Plaza, C.; Soler-Rovira, P.; Polo, A. Long-term effects of municipal solid wasted compost application on soil enzyme activities and microbial biomass. Soil Biol. Biochem. 2000, 32, 1907–1913. [Google Scholar] [CrossRef]
  29. Gao, M.; Yang, J.; Liu, C.; Gu, B.; Han, M.; Li, J.; Han, X. Effects of long-term biochar and biochar-based fertilizer application on brown earth soil bacterial communities. Agric. Ecosyst. Environ. 2021, 309, 107285. [Google Scholar] [CrossRef]
  30. Qu, L.; Liu, B.; Ma, Y.; Xu, J.; Sun, H. The response of the soil bacterial community and function to forest succession caused by forest disease. Funct. Ecol. 2020, 34, 2548–2559. [Google Scholar] [CrossRef]
  31. Shi, W.; Takano, T.; Liu, S. Isolation and characterization of novel bacterial taxa from extreme alkali-saline soil. World J. Microbiol. Biotechnol. 2012, 28, 2147–2157. [Google Scholar] [CrossRef]
  32. Solanki, M.K.; Wang, Z.; Wang, F.Y.; Li, C.N.; Gupta, C.L.; Singh, R.K.; Malviya, M.K.; Singh, P.; Yang, L.T.; Li, Y.R. Assessment of diazotrophic proteobacteria in sugarcane rhizosphere when intercropped with legumes (Peanut and Soybean) in the Field. Front. Microbiol. 2020, 11, 1814. [Google Scholar] [CrossRef] [PubMed]
  33. Pankratov, T.A.; Ivanova, A.O.; Dedysh, S.N.; Liesack, W. Bacterial populations and environmental factors controlling cellulose degradation in an acidic Sphagnum peat. Environ. Microbiol. 2011, 13, 1800–1814. [Google Scholar] [CrossRef] [PubMed]
  34. Tu, J.; Qiao, J.; Zhu, Z.; Li, P.; Wu, L. Soil bacterial community responses to long-term fertilizer treatments in Paulownia plantations in subtropical China. Appl. Soil Ecol. 2018, 124, 317–326. [Google Scholar] [CrossRef]
  35. Kalam, S.; Basu, A.; Ahmad, I.; Sayyed, R.Z.; El-Enshasy, H.A.; Dailin, D.J.; Suriani, N.L. Recent Understanding of soil acidobacteria and their ecological significance: A critical review. Front. Microbiol. 2020, 11, 580024. [Google Scholar] [CrossRef]
  36. Zhang, K.; Chen, L.; Li, Y.; Luo, Y. Interactive effects of soil pH and substrate quality on microbial utilization. Eur. J. Soil Biol. 2020, 96, 103151. [Google Scholar] [CrossRef]
Figure 1. Venn chart of OTU distribution of bacteria under different treatments. Y: treatment without fertilization; R: uncomposted organic fertilizer treatment; H: high-temperature organic fertilizer treatment; C: cooling organic fertilizer treatment; and D: decomposed organic fertilizer treatment.
Figure 1. Venn chart of OTU distribution of bacteria under different treatments. Y: treatment without fertilization; R: uncomposted organic fertilizer treatment; H: high-temperature organic fertilizer treatment; C: cooling organic fertilizer treatment; and D: decomposed organic fertilizer treatment.
Agronomy 14 01148 g001
Figure 2. PCA analysis of soil bacterial communities under different treatments. Y: treatment without fertilization; R: uncomposted organic fertilizer treatment; H: high-temperature organic fertilizer treatment; C: cooling organic fertilizer treatment; and D: decomposed organic fertilizer treatment.
Figure 2. PCA analysis of soil bacterial communities under different treatments. Y: treatment without fertilization; R: uncomposted organic fertilizer treatment; H: high-temperature organic fertilizer treatment; C: cooling organic fertilizer treatment; and D: decomposed organic fertilizer treatment.
Agronomy 14 01148 g002
Figure 3. Relative abundance of soil bacterial communities at the phylum level under different treatments. Figure 3a: The composition of the bacterial phylum-level community; Figure 3b: Relative abundance of bacterial community at phylum level. Y: treatment without fertilization; R: uncomposted organic fertilizer treatment; H: high-temperature organic fertilizer treatment; C: cooling organic fertilizer treatment; and D: decomposed organic fertilizer treatment.
Figure 3. Relative abundance of soil bacterial communities at the phylum level under different treatments. Figure 3a: The composition of the bacterial phylum-level community; Figure 3b: Relative abundance of bacterial community at phylum level. Y: treatment without fertilization; R: uncomposted organic fertilizer treatment; H: high-temperature organic fertilizer treatment; C: cooling organic fertilizer treatment; and D: decomposed organic fertilizer treatment.
Agronomy 14 01148 g003
Figure 4. BugBase phenotype prediction of soil bacterial communities. (a): Relative abundance of Aerobic for each treatment. (b): Relative abundance of Anaerobic for each treatment. (c): Relative abundance of Anaerobic Facultatively for each treatment. (d): Relative abundance of Mobile Element Containing for each treatment. (e): Relative abundance of Biofilm Forming for each treatment. (f): Relative abundance of Gram Negative for each treatment. (g): Relative abundance of Gram Positive for each treatment. (h): Relative abundance of Pathogenic for each treatment. (i): Relative abundance of Oxidative Stress Tolerant for each treatment. Y: treatment without fertilization; R: uncomposted organic fertilizer treatment; H: high-temperature organic fertilizer treatment; C: cooling organic fertilizer treatment; and D: decomposed organic fertilizer treatment.
Figure 4. BugBase phenotype prediction of soil bacterial communities. (a): Relative abundance of Aerobic for each treatment. (b): Relative abundance of Anaerobic for each treatment. (c): Relative abundance of Anaerobic Facultatively for each treatment. (d): Relative abundance of Mobile Element Containing for each treatment. (e): Relative abundance of Biofilm Forming for each treatment. (f): Relative abundance of Gram Negative for each treatment. (g): Relative abundance of Gram Positive for each treatment. (h): Relative abundance of Pathogenic for each treatment. (i): Relative abundance of Oxidative Stress Tolerant for each treatment. Y: treatment without fertilization; R: uncomposted organic fertilizer treatment; H: high-temperature organic fertilizer treatment; C: cooling organic fertilizer treatment; and D: decomposed organic fertilizer treatment.
Agronomy 14 01148 g004aAgronomy 14 01148 g004b
Table 1. Basic properties of tested soil.
Table 1. Basic properties of tested soil.
pHAlkalization Degree (%)Salt Content (g·kg−1)Salt-Based Ion Composition (g·kg−1)
CO32−HCO3ClSO42−Mg2+Ca2+Na+K+
9.3310.054.030.460.680.151.750.160.200.520.15
Table 2. Basic properties of organic fertilizers.
Table 2. Basic properties of organic fertilizers.
Test MaterialOrganic Carbon
(g·kg−1)
Total Nitrogen
(g·kg−1)
Total Phosphorus
(g·kg−1)
Total Potassium
(g·kg−1)
EC
(μs·cm−1)
C/NpH
Uncomposted organic fertilizer311.0014.2111.9925.66686132.868.49
High-temperature organic fertilizer287.7415.9015.2927.22662328.009.33
Cooling organic fertilizer241.5915.1015.7629.15722124.019.73
Decomposed organic fertilizer232.5917.9017.2533.71782019.499.75
Table 3. Bacterial community richness and diversity index of soil under different treatments.
Table 3. Bacterial community richness and diversity index of soil under different treatments.
TreatmentAceChao1Shannon IndexSimpson Index
Y1651.54 ± 48.78 a1656.26 ± 37.10 a5.55 ± 0.04 a0.009 ± 0.000 b
R1700.67 ± 68.11 a1730.00 ± 44.48 a5.02 ± 0.10 b0.048 ± 0.011 a
H1663.49 ± 83.27 a1703.47 ± 41.47 a4.91 ± 0.43 b0.058 ± 0.044 a
C1685.70 ± 57.46 a1697.64 ± 53.12 a5.20 ± 0.20 ab0.027 ± 0.011 a
D1539.08 ± 127.74 b1529.50 ± 134.02 b4.84 ± 0.11 b0.049 ± 0.013 a
Note: Different lowercase letters in the same column indicate significant differences between treatments (p < 0.05). Y: treatment without fertilization; R: uncomposted organic fertilizer treatment; H: high-temperature organic fertilizer treatment; C: cooling organic fertilizer treatment; and D: decomposed organic fertilizer treatment.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bai, H.; Liu, M.; Jing, Y.; Li, Y.; Chen, S.; Xue, G.; Wang, J.; Suo, Q.; Jiang, W. Effects of Organic Fertilizer with Different Degrees of Maturity on Bacteria in Saline–Alkali Soil. Agronomy 2024, 14, 1148. https://doi.org/10.3390/agronomy14061148

AMA Style

Bai H, Liu M, Jing Y, Li Y, Chen S, Xue G, Wang J, Suo Q, Jiang W. Effects of Organic Fertilizer with Different Degrees of Maturity on Bacteria in Saline–Alkali Soil. Agronomy. 2024; 14(6):1148. https://doi.org/10.3390/agronomy14061148

Chicago/Turabian Style

Bai, Hongmei, Meiying Liu, Yupeng Jing, Yajie Li, Shuhui Chen, Guoping Xue, Jianguo Wang, Quanyi Suo, and Wei Jiang. 2024. "Effects of Organic Fertilizer with Different Degrees of Maturity on Bacteria in Saline–Alkali Soil" Agronomy 14, no. 6: 1148. https://doi.org/10.3390/agronomy14061148

APA Style

Bai, H., Liu, M., Jing, Y., Li, Y., Chen, S., Xue, G., Wang, J., Suo, Q., & Jiang, W. (2024). Effects of Organic Fertilizer with Different Degrees of Maturity on Bacteria in Saline–Alkali Soil. Agronomy, 14(6), 1148. https://doi.org/10.3390/agronomy14061148

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop