Next Article in Journal
Yield Response of Grafted and Self-Rooted Tomato Plants Grown Hydroponically under Varying Levels of Water Salinity
Next Article in Special Issue
Increasing Application of Multifunctional Bacillus for Biocontrol of Pests and Diseases and Plant Growth Promotion: Lessons from Brazil
Previous Article in Journal
Effects of GmERF5-Responsive Effector on Soybean Symbiotic Nodulation
Previous Article in Special Issue
Microbial Metabolomics Interaction and Ecological Challenges of Trichoderma Species as Biocontrol Inoculant in Crop Rhizosphere
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 14
Issue 6
10.3390/agronomy14061241
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Potential Biofertilizers for Alkaline Soil: Bacteria Isolated from the Rhizosphere of Potatoes

by
Zhongchen Yu
1,†,
Caiding Chen
1,†,
Zhou Li
2,†,
Yunjie Song
1,
Chunhong Yan
1,
Xinyu Jiang
1,
Heng Jia
1,
Yi Shang
1 and
Mengqing Tian
1,*
1
Key Laboratory for Potato Biology of Yunnan Province, The CAAS-YNNU-YINMORE Joint Academy of Potato Science, Yunnan Normal University, Kunming 650092, China
2
Zhaotong Academy of Agricultural Sciences, Zhaotong 657000, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2024, 14(6), 1241; https://doi.org/10.3390/agronomy14061241
Submission received: 27 March 2024 / Revised: 2 June 2024 / Accepted: 3 June 2024 / Published: 7 June 2024
(This article belongs to the Special Issue From Soil-Plant-Microbial Interactions to New-Concept Biopesticides and Biofertilizers)
Browse Figures
Versions Notes

Abstract

:
Root-associated microorganisms, which can be recruited specially by plants to cope with environmental stress under extreme conditions, are one of the major mediators of nutrient exchange between plants and the environment. To obtain more crop-beneficial microbes, rhizosphere bacteria of Désirée potatoes cultivated in poor and alkaline soil have been studied. The screening of 83 strains with incomplete identical 16S rDNA sequences showed that 47 strains produced indole acetic acid (IAA), with contents ranging from 0.2 to 42 mg/L, and seven strains were phosphorus-solubilizing, among which six strains significantly increased the growth rate of potato plants. Thirty-seven strains produced siderophore and four strains were zinc-solubilizing, among which three strains significantly alleviated the chlorosis of potato plants. In all of the isolates, the species Variovorax soli (ST98) and Cellulomonas biazotea (ST118) were first found to possess an IAA-secreting ability; the species Leifsonia aquatica (ST172) and Leifsonia naganoensis (ST177) and the genus Sutcliffiella (ST11) were first discovered to be capable of phosphorus solubilization; the species Chryseobacterium daecheongense (ST32) was the first reported to be capable of zinc solubilization; and the species V. soli (ST98), C. biazotea (ST118) and L. naganoensis (ST177) were first found to be capable of plant growth promotion. The discovery of multiple functional bacteria enriched the resources of plant growth-promoting bacteria and provided a foundation for biofertilizer production to improve soil conditions and crop production.

1. Introduction

The potato is the fourth most important staple food crop. It is a food security crop and a possibly decisive weapon in the fight against starvation because of its high yield and great nutritive value, and it is rich in starch, protein and microelements [1]. China, as a major potato-planting country, has consistently ranked first in terms of potato-planting area and production volume worldwide [2]. Unfortunately, quality and production are under great threat because of the soil environment, pests and diseases. The application of large amounts of chemical fertilizers and pesticides will cause environmental degradation and affect the sustainable development of agriculture.
Plants growing in natural ecosystems live in close association with a multitude of microorganisms [3]. As the second genome of plants, the rhizosphere microbiome plays an important role in promoting plant growth and disease resistance [4]. In particular, plant growth-promoting rhizobacteria (PGPR), which can benefit plants by producing plant growth hormones [5], convert many plant-unavailable essential nutrients, such as nitrogen, phosphorous, zinc and iron, into available forms, synthesize antibiotics or enhance induced systemic resistance (ISR) to help plants against pathogenic bacteria and fungi [6]. In potatoes, the function of rhizosphere microorganisms is mainly concentrated on the resistance of pathogenic bacteria. Only a few studies have shown that arbuscular fungi, such as Rhizophagus irregularis, Funneliformis mosseae and Claroideoglomus etunicatum, and some bacteria, such as Enterobacter cloacae, Bacillus thuringiensis and Pseudomonas pseudoalcaligenes, can improve increase both the yield and nutritional quality of potatoes [7].
Plant rhizosphere microbial composition is affected by hosts and environment [8]. Plants shape rhizosphere microbes by modifying the amount and composition of root exudates to acquire belowground resources in nutrient-limited soil, which is consistent with the “cry for help” hypothesis in disease resistance [9]. Plants may shape rhizosphere flora by secreting phenolic substances and recruit related flora to improve the iron solubility in the rhizosphere when planted in iron-deficient soil [10,11], and the result was similar when it experienced phosphorus deficiencies [12]. In view of the above research, we hypothesized that when potatoes are grown in poor alkaline soil, special beneficial strains will be recruited to facilitate nutrient absorption. Yunnan is a major province for potato cultivation, but some of the major cultivation areas for potatoes have alkaline soils with extremely low nutrient availability. This is particularly true for Dayao, a small city located in the northwestern part of Yunnan Province. To exploit more microbial biofertilizer to assist the green potato industry development in Yunnan, the rhizosphere bacteria of potatoes cultivated in Dayao were studied.

2. Materials and Methods

2.1. Soil Sample Collection and Physicochemical Parameter Determination

Soil samples were collected from four major production areas of potatoes in Yunnan Province of China, including Dayao (25.85° N, 101.25° E), Xundian (25.63° N, 102.96° E), Dehong (24.02° N, 97.85° E) and the planting base on campus (24.86° N, 102.84° E). The pH of the soils was measured using a pH meter. Plant-available iron and zinc were measured using chelator diethylenetriaminepentaacetic acid (DTPA) extraction [13]. Briefly, 10 g of air-dried soil was shaken for 2 h with 20 mL of extracting solution (0.005 M DTPA, 0.1 M triethanolamine and 0.01 M CaCl2, pH 7.3). The leachate was centrifuged and filtered through a 0.22 µm membrane. The iron and zinc contents in the leachate were measured using an atomic spectrophotometer. Plant-available phosphorus was measured using NaHCO3 extraction—the molybdenum antimony resistance colorimetric method [14].

2.2. Isolation and Purification of Potato Rhizosphere Bacteria

Samples were collected from the growing region of potato plants that grow in Dayao, Yunnan, China (25.85° N, 101.25° E). The whole root system was carefully collected using tweezers, and large soil aggregates and debris were removed by gently shaking. Roots were placed in a 15 mL centrifuge tube and transferred to a laboratory being kept on ice. Isolation of bacteria was carried out through the serial dilution method. Ten grams of root tissues were homogenized using a grinding mill and dissolved in 100 mL of saline solution (0.9% NaCl). One milliliter of suspension was added to a test tube containing 9 mL of saline solution to obtain a suspension with a 10−2 dilution level. Dilution was performed in the same manner until a 10−6 suspension was obtained. Subsequently, 0.1 mL of the suspension was grown on Tryptone Soy Agar (TSA) medium in a Petri dish at 30 °C. Single colonies were picked and grown to reisolate and make pure cultures [15].

2.3. Sequencing and Phylogenetic Analysis

To confirm the taxonomic status of bacterial isolates, 16S ribosomal Deoxyribo Nucleic Acid(16S rDNA) with a length of 1.5 kb was amplified and sequenced with the primers 8F/1492R (8F, AGAGTTTGATCCTGGCTCAG; 1492R, GGTTACCTTGTTACGACTT) [16]. The sequences of the selected strains were compared and aligned with those of other strains from GenBank using BLAST (http://www.ncbi.nlm.nih.gov/blast, accessed on 4 May 2023). A phylogenetic tree was constructed using the neighbor joining method with MEGA.

2.4. Indole Acetic Acid (IAA) Production

Each bacterial strain was grown in TSB solution under shaking at 180 rpm at 30 °C for 3 days, and supernatants were collected to determine the auxin IAA. The production of IAA by bacteria was tested using Salkowski reagent (1.2% FeCl3 and 37% H2SO4) and measured at 530 nm wavelength using a spectrophotometer. The concentration of IAA was calculated using a standard curve of known concentrations of synthetic IAA [17].

2.5. Siderophore Production

Siderophore production by the bacterial isolates was detected using the universal chrome azurol ‘S’ (CAS) agar plate assay. A single colony of isolated bacteria was cultured in TSB solution overnight at 30 °C, and then 10 µL of bacterial solution was inoculated on CAS plates and incubated at 30 °C for 72 h [18]. The diameters of the colony and orange halo were detected, and the solubilization index (SI) was calculated as follows:
S I = Halozone   Diameter mm   / Colony   Diameter ( mm )

2.6. Phosphate Solubilization

Ten microliters of bacterial solution cultured in TSB overnight were inoculated on insoluble inorganic phosphorus medium (glucose 10 g, Ca3(PO4)2 5 g, (NH4)2SO4 0.5 g, NaCl 0.3 g, CaCl2 0.3 g, MgSO4·7H2O 0.3 g, FeSO4·7H2O 0.03 g, MnSO4·H2O 0.03 g, agar powder 18 g, distilled water 1 L, pH 7.0 to 7.2) and incubated at 30 °C for 3–5 days. The plates were observed for clear phosphate solubilization around colonies, and the solubilization index (SI) was calculated as follows:
SI = Clearance   zone   Diameter mm / Colony   Diameter ( mm )

2.7. Zinc Solubilization

A 10 µL volume of bacterial solution cultured in TSB overnight was inoculated on insoluble zinc medium (10 g glucose, 5 g ZnO, 0.5 g (NH4)2SO4, 0.3 g NaCl, 0.3 g CaCl2, 0.3 g MgSO₄·7H₂O, 0.3 g FeSO₄·7H₂O, 0.03 g MnSO4·H2O 0.03 g, agar powder 18 g, distilled water 1 L, pH 7.0 to 7.2) and incubated at 30 °C for 7–10 days. The plates were observed for clear ZnO solubilization around colonies, and the solubilization index (SI) was calculated as above [19].

2.8. Plant–Bacteria Interaction

To investigate the effect of the strains on plant growth under greenhouse conditions, the strains were cultured overnight, washed and resuspended in 0.9% NaCl. Three-week-old potato plants grown in 1/2 Hoagland medium were inoculated with a cell suspension of strains at a final concentration of 5 × 107 CFU mL−1. To further verify whether related strains can promote mineral element absorption in plants, potato plants were grown in 1/2 Fe/P/Zn-deficient Hoagland medium with insoluble FeCl3 (pH 7.3)/Ca3(PO4)2/ZnO. The plant height and root length were measured every week to calculate the growth rate. The relative growth rates (RGRs) were calculated as follows:
RGR = height   on   the   7 th / 14 th / 2 1 st   day ( mm ) − height   on   the   1 st   day ( mm ) height   on   the   1 st   day ( mm )

2.9. Detection of Chlorophyll and Mineral Elements in Plants

Chlorophyll extraction and quantification were adapted from reference [20]. Samples were prepared by a hole puncher from 10 mm2 of leaf tissue. Chlorophyll was extracted by adding 1 mL Dimethyl sulfoxide (DMSO) and incubating samples at 65 °C with shaking for 45–60 min until plant tissue was transparent and chlorophyll was completely extracted. The absorbance of the tissue-free chlorophyll extract was measured at 652 nm on a spectrophotometer (NanoDrop One, Thermo Scientific, Waltham, MA, USA). The youngest fully expanded leaves were collected for drying and digestion by a microwave digestion system, and the content of mineral elements was measured by an atomic spectrophotometer.

2.10. Data Analysis

Statistical analysis of the data was carried out by GraphPad Prism 6 software. When the normality and homogeneity of variance hypotheses were satisfied, a one-way analysis of variance (ANOVA) was used to compare the effect of these bacterial isolates on potato growth performance. A posteriori multiple comparisons were carried out using Tukey’s range tests at p ≤ 0.05. All results are the means of three to five independent replicates, as specified above.

2.11. Nucleotide Sequence Accession Number

The GenBank accession numbers for the 16S rDNA gene sequence of all the strains are attached in Table S1.

3. Results

3.1. Physicochemical Parameters of Soils

The pH and available iron, zinc and phosphorus of soil samples collected from four areas of potato crops in Yunnan Province were measured. All the soil samples were neutral (6.5 < pH < 7.5) or alkaline (7.5 < pH < 8.5). The soil of Dehong contained high contents of iron and phosphorus, followed by Xundian and the planting base in campus. The soil of Dayao contained the lowest iron and phosphorus contents, possibly because of its higher pH (Figure 1).

3.2. Identification and Phylogenetic Analysis of Bacteria Isolated from the Potato Rhizosphere

One hundred and fifty-three strains were isolated and identified from the roots (mixed with six plants) of cultivated potato cultivated in Dayao and named following ST (Solanum tuberosum). Based on the sequencing results of the 16S rDNA gene, the nucleotide sequences displayed with high query coverage and sequence similarity (to 98%) were assigned to the same species. These bacterial isolates belonged to four phyla (Actinomycetota, Bacillota, Bacteroidota and Pseudomonadota), six classes (Actinomycetes, Bacilli, Flavobacteriia, Betaproteobacteria, Alphaproteobacteria and Gammaproteobacteria), 10 orders (Micrococcales, Mycobacteriales, Kitasatosporales, Bacillales, Flavobacteriales, Burkholderiales, Hyphomicrobiales, Xanthomonadales, Pseudomonadales and Sphingomonadales), 19 families (Microbacteriaceae, Cellulomonadaceae, Promicromonosporaceae, Streptomycetaceae, Bacillaceae, Paenibacillaceae, Weeksellaceae, Alcaligenaceae, Rhizobiaceae, Boseaceae, Burkholderiaceae, Devosiaceae, Rhizobiaceae, Xanthomonadaceae, Sphaerotilaceae, Pseudomonadaceae, Xanthomonadaceae, Sphingomonadaceae and Comamonadaceae) and 32 genera (Table S1). Microbacterium, which belongs to Actinomycetota, was determined to be the dominant genus among them (Figure 2).

3.3. Rhizosphere Bacterial Strains Promote Plant Growth by Producing IAA

IAA is one of the most physiologically active auxins in plants and can regulate the growth of stems, buds and roots. Forty-seven isolates could produce IAA, among which seven strains had concentrations greater than 10 mg/L, nine strains had concentrations between 5 and 10 mg/L and 18 strains had concentrations ranging from 1 to 5 mg/L (Table 1). Twenty strains that were highly IAA-producing strains were inoculated into three-week-old potato plant roots. The results showed that the growth rates of plants inoculated with strains, V. soli ST98, Agromyces sp. ST139, C. biazotea ST118, Cupriavidus sp. ST9 and Cellulosimicrobium sp. ST85 were significantly increased on the 21st day (Figure 3a,b). We also observed the growth of roots. Interestingly, plants whose above-ground growth was promoted had a decrease in the amount of root (Figure 3c), which may be related to the availability of nutrition, because root morphology and growth are regulated by environmental nutrition, and in an environment with adequate nutrition, not too many roots are needed for nutrient acquisition [21,22].

3.4. Rhizosphere Bacterial Strains Promote Plant Iron Absorption by Siderophore Production

Siderophores production were tested using a chrome azurol ‘S’ (CAS) agar plate. Nearly one-third of the isolates could produce siderophores, among which nine strains, including Microbacterium foliorum ST51, Microbacterium phyllosphaerae ST40, Microbacterium sp. ST35, Pseudomonas fluorescens ST18, Microbacterium hydrocarbonoxydans ST49, Agrobacterium tumefaciens ST81, Cellulosimicrobium sp. ST85, Microbacterium sp. ST43 and Pseudoxanthomonas sp. ST106, had a high solubilization index greater than 1.7 and were inoculated into plant roots (Figure 4a, Table 2). The results showed that plants inoculated with M. phyllosphaerae ST40 and Microbacterium sp. ST35 had higher chlorophyll in young leaves when cultured in Fe-deficient Hoagland medium with FeCl3 (pH = 7.3) (Figure 4b,c).

3.5. Rhizosphere Bacterial Strains Promote Plant Phosphorus Absorption by Phosphorus Solubilization

Phosphorus (P) availability limits crop productivity in many agricultural soils [23]. Phosphate-solubilizing microorganisms (PSM) are often reported to positively affect crop productivity through enhanced phosphorus (P) nutrition [24]. Seven isolates could improve the solubility of insoluble phosphorus. The strains were identified as L. naganoensis ST177, Curtobacterium sp. ST47, P. fluorescens ST18, L. aquatica ST172, Paenibacillus sp. ST22, Pseudomonas plecoglossicida ST4 and Sutcliffiella horikoshii ST11. L. naganoensis ST177 showed a prominent growth-promoting effect on potato plants when planted in P-deficient Hoagland medium with Ca3(PO4)2 (Figure 5, Table 3).

3.6. Rhizosphere Bacterial Strains Promote Plant Zinc Absorption by Zinc Solubilization

Four isolates, Lysobacter sp. ST103, C. daecheongense ST32, Stenotrophomonas sp. ST34 and Cellulosimicrobium sp. ST85, could improve the solubility of insoluble zinc. ST103 showed significant solubilizing capacity, and large clearance rings with diameters greater than two appeared around the colony (Figure 6a, Table 4). Plants inoculated with Lysobacter sp. ST103 and Stenotrophomonas sp. ST34 had higher chlorophyll in leaves when planted in Zn-deficient Hoagland medium with ZnO (Figure 6b,c).

4. Discussion

Plant growth and health are closely related to rhizosphere microorganisms. Plants regulate rhizosphere microbiota through exudate secretion to shape and utilize specific microbial communities to help them respond to external stressors by secreting hormones, siderophores, organic acid antibiotics, lytic enzymes, volatile organic compounds and so on [9]. Our object was to isolate and screen more plant-promoting bacteria from potato rhizosphere soils with low iron, phosphorus and zinc. Our research showed that Microbacterium, which is one of the most common PGPR, was determined to be the dominant genus [6]. Bacteria in this genus promoted plant growth in a variety of ways, such as auxin, salicylic acid and gibberellin secretion [25], siderophore production [26], phosphorus solubilization [26], volatile substances production [27], nitrogen fixation [28] and zinc solubilization [29].
PGPR can promote plant growth by directly secreting plant hormones or by influencing the hormone synthesis process of plants [5]. The production of IAA has been recognized as an important factor in direct plant growth-promoting abilities of rhizosphere bacteria. They stimulate the proliferation of lateral roots that increase nutrient-absorbing surfaces and result in the better assimilation of water and nutrients from the soil [30]. In our study, more than 50% of strains produced IAA, among which Chryseobacterium sp. ST32 reached the highest with a yield of 43.16 mg/L under natural culture conditions. The genus of Chryseobacterium has been widely reported for IAA production and a growth-promoting effect on crops, and most of them were tryptophan-dependent [5,31]. In addition, the genera of Microbacterium (ST25, ST49, ST144, ST43) [25], Arthrobacter (ST7, S21) [32], Variovorax (ST98) [33], Agromyces (ST139) [34], Cellulomonas (ST118) [35], Cupriavidus (ST9) [36], Cellulosimicrobium (ST85) [37] and Ensifer (ST46) [38] were also reported to possess the ability to secrete IAA, while the species V. soli (ST98) and C. biazotea (ST118) were first found to be capable of that in the present study.
Siderophores are common microbial secondary metabolites that can chelate metal ions such as iron and zinc from the environment and transport them into cells through specific receptors [39], and the bacterial siderophore–Fe complex can be utilized by plants with higher efficiency than EDTA-Fe [40]. Studies have shown that, in addition to serving as a medium to chelate iron, siderophores can also act as signaling molecules [41]. Siderophores produced by some bacteria can induce other strains to produce homologous iron carriers, thereby enhancing the use of iron in the soil. In addition, some strains can secrete siderophores to deplete limited iron in the environment, thereby inhibiting the growth of pathogenic bacteria from the same ecological niche [42] or inducing other genera of bacteria to produce many antibacterial substances to resist invasion by plant pathogens [43]. According to our research, half of the isolates from potato roots planted in Dayao were siderophore producers, which may be involved in the low iron property of the soil. Most of the strains identified as high-siderophore-producing strains belong to Microbacterium (ST51, ST35, ST40, ST49, ST43), and the species M. foliorum (ST51) [44], M. phyllosphaerae (ST40) [45] and M. hydrocarbonoxydans (ST49) [46] have been reported to produce a high amount of siderophores and promote plant growth. Siderophores produced by P. fluorescens (ST18) have been extensively studied and demonstrated to play roles in growth promotion, biocontrol and pheromones [47]. The kinds and biosynthetic gene clusters of siderophores produced by A. tumefaciens (ST81) have also been identified [48]. In addition to these common species, the genera Cellulosimicrobium (ST85) [29], Pseudoxanthomonas (ST106) [49] and Bordetella (ST65) [50] have also been reported to produce siderophores.
Phosphorus and zinc solubilization are also approaches through which PGPR promote nutrient absorption. Among our seven strains of phosphorus-solubilizing bacteria, Leifsonia (ST172, ST177) [51], Curtobacterium (ST47) [52], Pseudomonas (ST4, ST18) [53] and Paenibacillu (ST22) [54] have been reported to be related to phosphorus solubilization, while the species L. aquatica (ST172) and L. naganoensis (ST177) and the genus Sutcliffiella (ST11) were the first-discovered to have this capability. Four isolates possessing a zinc-solubilizing ability were screened, and the genera Lysobacter (ST103) [55], Chryseobacterium (ST32) [56], Stenotrophomonas (ST34) [57] and Cellulosimicrobium (ST85) [37] have been reported to be zinc-solubilizing, but the species C. daecheongense (ST32) was the first reported to have this ability.
According to relevant reports, appropriate amounts of IAA can promote plant growth, and P is an essential element for plant growth, so the relative growth rate was selected as the target for the function verification of IAA-producing and phosphorus-solubilizing strains. Most strains isolated from potato roots could produce a certain concentration of IAA, but only strains with IAA concentrations ranging from 5 to 15 mg/L could promote the root growth of potato plants. This indicated that the promotive effect of IAA on plants was limited to a certain concentration range, which was consistent with reports [58]. Among the screened strains, the species V. soli (ST98), C. biazotea (ST118) and L. naganoensis (ST177) were first found in the present study to promote plant growth. Both iron and zinc are directly related to chlorophyll synthesis, and the chlorosis of leaves is an obvious symptom of iron and zinc deficiency [59]. Therefore, chlorophyll content was selected as the functional target of iron- and zinc-solubilizing strains. Only two isolates with a high siderophores yield and one isolate with a zinc-solubilizing function could improve the chlorosis of plants significantly, which may be related to the colonization ability of the strains.
According to our research, none of these strains can dissolve iron, phosphorus and zinc simultaneously, indicating that a single strain is unlikely to possess multiple functions. Only multiple strains that coexist and collaborate can help plants achieve a balanced nutrient absorption and resist pathogen invasion in complex soil environments. Therefore, research on and the preparation of synthetic microbial communities (SynComs) that contain carefully chosen microbial species to produce the desired microbiome function has become the trend. In recent years, more and more studies have focused on the use of SynComs to improve plant nutrient efficiency and health [60,61]. In contrast to selecting microbes based on single microbial in vitro activities or taxonomy, SynComs development considers multiple attributes, including microbes associated with desirable plant phenotypes and microbial traits, such as the production of metabolites, robust biofilm formation and the ability to chemically trigger plant defense mechanisms that will make microbes fit to persist in different environments and to colonize plants.

5. Conclusions

In this study, 153 bacterial strains were isolated and identified from potato roots cultured in alkaline soil. Among the 83 bacterial strains with incompletely identical 16S rDNA sequences, 47 isolates produced different concentrations of IAA, 37 isolates produced siderophores and seven and four isolates produced phosphate and zinc solubilizers, respectively. Five isolates significantly increased the growth rate of potato plants and four isolates significantly alleviated the chlorosis of leaves. Among all strains, the species V. soli (ST98) and C. biazotea (ST118) were first found to possess the ability to secrete IAA; the species L. aquatica (ST172) and L. naganoensis (ST177) and the genus Sutcliffiella (ST11) were first discovered to be phosphorus-solubilizing; the species C. daecheongense (ST32) was first reported to be zinc-solubilizing; and the species V. soli (ST98), C. biazotea (ST118) and L. naganoensis (ST177) were first found to be plant growth-promoting. Although the isolates represented only part of large plant rhizosphere bacteria population, the new functions discovered in some strains has enriched the resources of plant growth-promoting bacteria. The validation of growth-promoting functions under hydroponic conditions is the initial step for biofertilizer production for field applications. Future research on colonization mechanisms and optimization conditions, and competition with other soil microbial communities for exploiting multifunctional microbial fertilizers (i.e., SynComs) are needed.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy14061241/s1.

Author Contributions

M.T.: conceptualization; Z.Y., C.C., Z.L., Y.S. (Yunjie Song), C.Y., X.J. and H.J.: methodology; Z.Y., C.C. and Z.L.: formal analysis; Z.Y., C.C., Z.L. and M.T.: writing—original draft; M.T.: writing—review and editing; M.T. and Z.Y.: visualization; Y.S. (Yi Shang) and M.T.: supervision; Y.S. (Yi Shang) and M.T.: funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the National Natural Science Foundation of China (grant 32360798 to M.T.), the China Postdoctoral Science Foundation (grant 2022MD723850 to M.T.) and the Yunnan Provincial Science and Technology Department (grant YSZJGZZ-2022091 and 202105AF150028 to Y.S. (Yi Shang)).

Data Availability Statement

Data will be made available on request.

Conflicts of Interest

The authors declare no competing interests.

References

  1. Devaux, A.; Goffart, J.-P.; Petsakos, A.; Kromann, P.; Gatto, M.; Okello, J.; Suarez, V.; Hareau, G. Global Food Security, Contributions from Sustainable Potato Agri-Food Systems. In The Potato Crop: Its Agricultural, Nutritional and Social Contribution to Humankind; Campos, H., Ortiz, O., Eds.; Springer International Publishing: Cham, Switzerland, 2020; pp. 3–35. [Google Scholar]
  2. Zhang, H.; Xu, F.; Wu, Y.; Hu, H.; Dai, X. Progress of potato staple food research and industry development in China. J. Integr. Agric. 2017, 16, 2924–2932. [Google Scholar] [CrossRef]
  3. Buchholz, F.; Antonielli, L.; Kostić, T.; Sessitsch, A.; Mitter, B. The bacterial community in potato is recruited from soil and partly inherited across generations. PLoS ONE 2019, 14, e0223691. [Google Scholar] [CrossRef] [PubMed]
  4. Olanrewaju, O.S.; Glick, B.R.; Babalola, O.O. Mechanisms of action of plant growth promoting bacteria. World J. Microbiol. Biotechnol. 2017, 33, 197. [Google Scholar] [CrossRef]
  5. Xu, F.; Liao, H.; Yang, J.; Zhang, Y.; Yu, P.; Cao, Y.; Fang, J.; Chen, S.; Li, L.; Sun, L.; et al. Auxin-producing bacteria promote barley rhizosheath formation. Nat. Commun. 2023, 14, 5800. [Google Scholar] [CrossRef] [PubMed]
  6. Hakim, S.; Naqqash, T.; Nawaz, M.S.; Laraib, I.; Siddique, M.J.; Zia, R.; Mirza, M.S.; Imran, A. Rhizosphere Engineering With Plant Growth-Promoting Microorganisms for Agriculture and Ecological Sustainability. Front. Sustain. Food Syst. 2021, 5, 617157. [Google Scholar] [CrossRef]
  7. Petrushin, I.S.; Filinova, N.V.; Gutnik, D.I. Potato Microbiome: Relationship with Environmental Factors and Approaches for Microbiome Modulation. Int. J. Mol. Sci. 2024, 25, 750. [Google Scholar] [CrossRef] [PubMed]
  8. Santoyo, G. How plants recruit their microbiome? New insights into beneficial interactions. J. Adv. Res. 2022, 40, 45–58. [Google Scholar] [CrossRef] [PubMed]
  9. Wen, Z.; White, P.J.; Shen, J.; Lambers, H. Linking root exudation to belowground economic traits for resource acquisition. New Phytol. 2022, 233, 1620–1635. [Google Scholar] [CrossRef] [PubMed]
  10. Harbort, C.J.; Hashimoto, M.; Inoue, H.; Niu, Y.; Schulze-Lefert, P. Root-Secreted Coumarins and the Microbiota Interact to Improve Iron Nutrition in Arabidopsis. Cell Host Microbe 2020, 28, 825–837.e6. [Google Scholar] [CrossRef]
  11. Tato, L.; Lattanzio, V.; Ercole, E.; Dell’Orto, M.; Sorgonà, A.; Linsalata, V.; Salvioli di Fossalunga, A.; Novero, M.; Astolfi, S.; Abenavoli, M.R.; et al. Plasticity, exudation and microbiome-association of the root system of Pellitory-of-the-wall plants grown in environments impaired in iron availability. Plant Physiol. Biochem. PPB 2021, 168, 27–42. [Google Scholar] [CrossRef]
  12. Guo, Z.; Wang, X.; Zhang, X.; Wang, R.; Wang, S.; Chen, Y.; Liu, J.; Tian, H.; Wang, Z.; Shi, M. Rhizosphere microbiome-related changes in soil zinc and phosphorus availability improve grain zinc concentration of wheat. Plant Soil 2023, 490, 651–668. [Google Scholar] [CrossRef]
  13. Lindsay, W.L.; Norvell, W.A. Development of a DTPA Soil Test for Zinc, Iron, Manganese, and Copper. Soil Sci. Soc. Am. J. 1978, 42, 421–428. [Google Scholar] [CrossRef]
  14. Shen, Y.; Ma, Z.; Chen, H.; Lin, H.; Li, G.; Li, M.; Tan, D.; Gao, W.; Jiao, S.; Liu, P.; et al. Effects of macromolecular organic acids on reducing inorganic phosphorus fixation in soil. Heliyon 2023, 9, e14892. [Google Scholar] [CrossRef] [PubMed]
  15. Kesaulya, H.; Baharuddin; Zakaria, B.; Syaiful, S.A. Isolation and Physiological Characterization of PGPR from Potato Plant Rhizosphere in Medium Land of Buru Island. Procedia Food Sci. 2015, 3, 190–199. [Google Scholar] [CrossRef]
  16. Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef] [PubMed]
  17. Suliasih; Widawati, S. Isolation of Indole Acetic Acid (IAA) producing Bacillus siamensis from peat and optimization of the culture conditions for maximum IAA production. IOP Conf. Ser. Earth Environ. Sci. 2020, 572, 012025. [Google Scholar] [CrossRef]
  18. Louden, B.C.; Haarmann, D.; Lynne, A.M. Use of blue agar CAS assay for siderophore detection. J. Microbiol. Biol. Educ. 2011, 12, 51–53. [Google Scholar] [CrossRef] [PubMed]
  19. Dinesh, R.; Srinivasan, V.; Hamza, S.; Sarathambal, C.; Anke Gowda, S.J.; Ganeshamurthy, A.N.; Gupta, S.B.; Aparna Nair, V.; Subila, K.P.; Lijina, A.; et al. Isolation and characterization of potential Zn solubilizing bacteria from soil and its effects on soil Zn release rates, soil available Zn and plant Zn content. Geoderma 2018, 321, 173–186. [Google Scholar] [CrossRef]
  20. Hiscox, J.D.; Israelstam, G.F. A method for the extraction of chlorophyll from leaf tissue without maceration. Can. J. Bot. 1979, 57, 1332–1334. [Google Scholar] [CrossRef]
  21. White, P.J.; George, T.S.; Gregory, P.J.; Bengough, A.G.; Hallett, P.D.; McKenzie, B.M. Matching roots to their environment. Ann. Bot. 2013, 112, 207–222. [Google Scholar]
  22. Lynch, J.P. Root phenotypes for improved nutrient capture: An underexploited opportunity for global agriculture. New Phytol. 2019, 223, 548–564. [Google Scholar] [CrossRef] [PubMed]
  23. Rowe, H.; Withers, P.J.; Baas, P.; Chan, N.I.; Doody, D.; Holiman, J.; Jacobs, B.; Li, H.; MacDonald, G.K.; McDowell, R. Integrating legacy soil phosphorus into sustainable nutrient management strategies for future food, bioenergy and water security. Nutr. Cycl. Agroecosyst. 2016, 104, 393–412. [Google Scholar] [CrossRef]
  24. Raymond, N.S.; Gómez-Muñoz, B.; van der Bom, F.J.; Nybroe, O.; Jensen, L.S.; Müller-Stöver, D.S.; Oberson, A.; Richardson, A.E. Phosphate-solubilising microorganisms for improved crop productivity: A critical assessment. New Phytol. 2021, 229, 1268–1277. [Google Scholar] [CrossRef] [PubMed]
  25. Sodhi, K.K.; Kumar, M.; Dhaulaniya, A.S.; Balan, B.; Singh, D.K.J.E.S. Enhanced ciprofloxacin removal by plant growth-promoting Microbacterium sp. WHC1 in presence of Eichhornia crassipes root exudates. Environ. Sustain. 2021, 4, 143–153. [Google Scholar] [CrossRef]
  26. Kaur, G.J.K.; Dadhich, K.S.S.; CAMEOTRA, A.S.S. Phosphate-Solubilizing bacteria Microbacterium paraoxydans isolated from the rhizospheric system of wheat (Teiticum aestivum). Wetl. Divers. Agron. 2011, 12, e9062. [Google Scholar]
  27. Siraj, S.; Khan, M.A.; Hamayun, M.; Ali, S.; Khan, S.A.; Hussain, A.; Iqbal, A.; Khan, H.; Kang, S.-M.; Lee, I.-J. Microbacterium oxydans Regulates Physio-Hormonal and Molecular Attributes of Solanum lycopersicum under Drought Stress. Agronomy 2022, 12, 3224. [Google Scholar] [CrossRef]
  28. Zheng, J.; Liao, Y.; Li, Y.; Li, D.; Sun, Y.; Xiao, Z. Description of Microbacterium dauci sp. nov., a plant growth hormone indoleacetic acid-producing and nitrogen-fixing bacterium isolated from carrot rhizosphere soil. Arch. Microbiol. 2024, 206, 102. [Google Scholar] [CrossRef] [PubMed]
  29. Verma, S.; Kumar, M.; Kumar, A.; Das, S.; Chakdar, H.; Varma, A.; Saxena, A.K. Diversity of Bacterial Endophytes of Maize (Zea mays) and Their Functional Potential for Micronutrient Biofortification. Curr. Microbiol. 2021, 79, 6. [Google Scholar] [CrossRef] [PubMed]
  30. Egamberdieva, D. Indole-Acetic Acid Production by Root Associated Bacteria and its Role in Plant Growth and Development; Nova Publishers: Hauppauge, NY, USA, 2012. [Google Scholar]
  31. Chhetri, G.; Kim, I.; Kim, J.; So, Y.; Seo, T. Chryseobacterium tagetis sp. nov., a plant growth promoting bacterium with an antimicrobial activity isolated from the roots of medicinal plant (Tagetes patula). J. Antibiot. 2022, 75, 312–320. [Google Scholar] [CrossRef]
  32. Li, M.; Guo, R.; Yu, F.; Chen, X.; Zhao, H.; Li, H.; Wu, J. Indole-3-Acetic Acid Biosynthesis Pathways in the Plant-Beneficial Bacterium Arthrobacter pascens ZZ21. Int. J. Mol. Sci. 2018, 19, 443. [Google Scholar] [CrossRef]
  33. Jiang, F.; Chen, L.; Belimov, A.A.; Shaposhnikov, A.I.; Gong, F.; Meng, X.; Hartung, W.; Jeschke, D.W.; Davies, W.J.; Dodd, I.C. Multiple impacts of the plant growth-promoting rhizobacterium Variovorax paradoxus 5C-2 on nutrient and ABA relations of Pisum sativum. J. Exp. Bot. 2012, 63, 6421–6430. [Google Scholar] [CrossRef] [PubMed]
  34. Zhang, Y.; Zhao, J.; Hu, J.; Han, C.; Yu, B.; Wu, Y.; Xiao, J.; Wang, X.; Xiang, W. Agromyces mariniharenae sp. nov., a novel indole-acetic acid producing actinobacterium isolated from marine sand. Int. J. Syst. Evol. Microbiol. 2021, 71, 5026. [Google Scholar] [CrossRef]
  35. Jung, W.; Song, Y.S.; Seo, D.J.; Lee, J.H.J. Antifungal Activity and Properties of Crude Enzymes Produced from Cellulomonas fimi JH-1. J. Chitin Chitosan 2022, 27, 59–68. [Google Scholar] [CrossRef]
  36. Zheng, Y.; Tang, J.; Liu, C.; Liu, X.; Luo, Z.; Zou, D.; Xiang, G.; Bai, J.; Meng, G.; Liu, X.; et al. Alleviation of metal stress in rape seedlings (Brassica napus L.) using the antimony-resistant plant growth-promoting rhizobacteria Cupriavidus sp. S-8-2. Sci. Total Environ. 2023, 858, 159955. [Google Scholar] [CrossRef]
  37. Chatterjee, S.; Sau, G.B.; Mukherjee, S.K. Plant growth promotion by a hexavalent chromium reducing bacterial strain, Cellulosimicrobium cellulans KUCr3. World J. Microbiol. Biotechnol. 2009, 25, 1829–1836. [Google Scholar] [CrossRef]
  38. Katiyar, P.; Dubey, R.C.; Maheshwari, D.K. ACC deaminase-producing Ensifer adhaerens KS23 enhances proximate nutrient of Pisum sativum L. cultivated in high altitude. Arch. Microbiol. 2021, 203, 2689–2698. [Google Scholar] [CrossRef]
  39. Kaur, H.; Sharma, P.; Kaur, N.; Gill, B.S. Tapping of native Bradyrhizobium and Ensifer sp. diversity for functional traits in soybean [Glycine max (L.) Merrill]. Legume Res. 2014, 37, 651–657. [Google Scholar] [CrossRef]
  40. Kraemer, S.M. Iron oxide dissolution and solubility in the presence of siderophores. Aquat. Sci. 2004, 66, 3–18. [Google Scholar] [CrossRef]
  41. Vansuyt, G.; Robin, A.; Briat, J.F.; Curie, C.; Lemanceau, P. Iron acquisition from Fe-pyoverdine by Arabidopsis thaliana. Mol. Plant-Microbe Interact. 2007, 20, 441–447. [Google Scholar] [CrossRef]
  42. Kramer, J.; Özkaya, Ö.; Kümmerli, R. Bacterial siderophores in community and host interactions. Nat. Rev. Microbiol. 2020, 18, 152–163. [Google Scholar] [CrossRef]
  43. Gu, S.; Wei, Z.; Shao, Z.; Friman, V.-P.; Cao, K.; Yang, T.; Kramer, J.; Wang, X.; Li, M.; Mei, X. Competition for iron drives phytopathogen control by natural rhizosphere microbiomes. Nat. Microbiol. 2020, 5, 1002–1010. [Google Scholar] [CrossRef]
  44. Andrić, S.; Rigolet, A.; Argüelles Arias, A.; Steels, S.; Hoff, G.; Balleux, G.; Ongena, L.; Höfte, M.; Meyer, T.; Ongena, M. Plant-associated Bacillus mobilizes its secondary metabolites upon perception of the siderophore pyochelin produced by a Pseudomonas competitor. ISME J. 2023, 17, 263–275. [Google Scholar] [CrossRef] [PubMed]
  45. Alka, S.; Shahir, S.; Ibrahim, N.; Vo, D.-V.N.; Abd Manan, F. Assessment of plant growth promotion properties and impact of Microbacterium foliorum for arsenic removal in Melastoma Malabathricum. Bioremediat. J. 2023, 27, 251–262. [Google Scholar] [CrossRef]
  46. Kumar, M.; Singh, R.P.J.C.C.; Sustainability, E. Plant Growth Promoting Activities of Microbacterium phyllosphaerae in Wheat (Triticum aestivum L.). Agric. Food Sci. 2018, 6, 79. [Google Scholar] [CrossRef]
  47. Cabello-Conejo, M.I.; Becerra-Castro, C.; Prieto-Fernández, A.; Monterroso, C.; Saavedra-Ferro, A.; Mench, M.; Kidd, P.S. Rhizobacterial inoculants can improve nickel phytoextraction by the hyperaccumulator Alyssum pintodasilvae. Plant Soil 2014, 379, 35–50. [Google Scholar] [CrossRef]
  48. Lincoln, A.; Mandal, S.; Environment, K.J. Isolation and Assessment of Plant Growth Promoting Activity of Siderophore Producing Pseudomonas fluorescens in Crops. Int. J. Agric. Environ. Biotechnol. 2014, 7, 63–67. [Google Scholar]
  49. Rondon, M.R.; Ballering, K.S.; Thomas, M.G. Identification and analysis of a siderophore biosynthetic gene cluster from Agrobacterium tumefaciens C58. Microbiology 2004, 150, 3857–3866. [Google Scholar] [CrossRef] [PubMed]
  50. Peng, Y.; Jiang, L.; Jeon, D.; Cho, D.; Kim, Y.; Kim, C.Y.; Lee, J.H.; Lee, J. Pseudoxanthomonas sp. JBR18, a halotolerant endophytic bacterium, improves the salt tolerance of Arabidopsis seedlings. Plant Physiol. Biochem. 2024, 207, 108415. [Google Scholar] [CrossRef] [PubMed]
  51. Flores Clavo, R.; Valladolid-Suyón, E.; Reinoza-Farroñan, K.; Asmat Ortega, C.; Riboldi Monteiro, P.H.; Apaza-Castillo, G.A.; Zuñiga-Valdera, G.; Fantinatti Garboggini, F.; Iglesias-Osores, S.; Carreño-Farfán, C.R. Rhizobacterial Isolates from Prosopis limensis Promote the Growth of Raphanus sativus L. Under Salt Stress. Curr. Microbiol. 2023, 80, 269. [Google Scholar] [CrossRef]
  52. Madhaiyan, M.; Poonguzhali, S.; Lee, J.-S.; Senthilkumar, M.; Lee, K.C.; Sundaram, S. Leifsonia soli sp. nov., a yellow-pigmented actinobacterium isolated from teak rhizosphere soil. Int. J. Syst. Evol. Microbiol. 2010, 60, 1322–1327. [Google Scholar] [CrossRef]
  53. Sowmya, S.; Rekha, P.D.; Arun, A.B. Isolation, identification and characterization of Curtobacterium sp. YU-SS-C-67 for phosphate solubilization and uranium tolerance. Int. Res. J. Biol. Sci. 2013, 2, 102–106. [Google Scholar]
  54. Jha, B.K.; Gandhi, P.M.; Cletus, J.; Raman, G.; Sakthivel, N. Simultaneous phosphate solubilization potential and antifungal activity of new fluorescent pseudomonad strains, Pseudomonasaeruginosa, P. plecoglossicida and P. mosselii. World J. Microbiol. Biotechnol. 2009, 25, 573–581. [Google Scholar] [CrossRef]
  55. Brito, L.; Lopez, M.G.; Straube, L.; Wendisch, V.F. Inorganic Phosphate Solubilization by Rhizosphere Bacterium Paenibacillus sonchi: Gene Expression and Physiological Functions. Front. Microbiol. 2020, 11, 588605. [Google Scholar] [CrossRef]
  56. Weigold, P.; Adaktylou, I.J.; Kappler, A.; Behrens, S.; Mühe, E.-M. Rhizosphere Microbial Community Composition Affects Cadmium and Zinc Uptake by the Metal-Hyperaccumulating Plant Arabidopsis halleri. Appl. Environ. Microbiol. 2019, 81, 2173–2181. [Google Scholar] [CrossRef]
  57. Jung, H.; Lee, D.; Lee, S.; Kong, H.J.; Park, J.; Seo, Y.-S. Comparative genomic analysis of Chryseobacterium species: Deep insights into plant-growth-promoting and halotolerant capacities. Microb. Genom. 2023, 9, 001108. [Google Scholar] [CrossRef] [PubMed]
  58. Rahman, A.; Ahmad, M.A.; Mehmood, S.; Rauf, A.; Iqbal, A.; Ali, B.; Ullah, M.; Ali, M.; Mohamed, H.I.; Uddin, I. Isolation and Screening of Zn (Zn) Solubilizing Rhizosphere Bacteria from Different Vegetations for Their Ability to Improve Growth, Zn Uptake, and Expression of Zn Transporter Genes in Tomato. Curr. Microbiol. 2024, 81, 83. [Google Scholar] [CrossRef] [PubMed]
  59. Mike-Anosike, E.; Braidedr, W.; Adeleye, S.A. International Journal of Advanced Research in Biological Sciences Studies on Indole Acetic Acid (IAA) Production by Rhizobacteria and Growth promoting potentials. Int. J. Adv. Res. Biol. Sci. 2018, 5, 133–140. [Google Scholar]
  60. Roosta, H.R.; Estaji, A.; Niknam, F. Effect of iron, zinc and manganese shortage-induced change on photosynthetic pigments, some osmoregulators and chlorophyll fluorescence parameters in lettuce. Photosynthetica 2018, 56, 606–615. [Google Scholar] [CrossRef]
  61. Martins, S.J.; Pasche, J.; Silva, H.A.O.; Selten, G.; Savastano, N.; Abreu, L.M.; Bais, H.P.; Garrett, K.A.; Kraisitudomsook, N.; Pieterse, C.M.J.; et al. The Use of Synthetic Microbial Communities to Improve Plant Health. Phytopathology 2023, 113, 1369–1379. [Google Scholar] [CrossRef]
Agronomy 14 01241 g001
Figure 1. The pH and available mineral element contents of soil from different areas of Yunnan Province: (a) pH of soil from different areas of Yunnan Province; (b) available mineral element contents of soil from different areas of Yunnan Province; and (c) potato plants cultivated in Dayao (left) and Dehong soil (right).
Figure 1. The pH and available mineral element contents of soil from different areas of Yunnan Province: (a) pH of soil from different areas of Yunnan Province; (b) available mineral element contents of soil from different areas of Yunnan Province; and (c) potato plants cultivated in Dayao (left) and Dehong soil (right).
Agronomy 14 01241 g001
Agronomy 14 01241 g002
Figure 2. Phylogenetic tree of strains isolated from potato rhizosphere.
Figure 2. Phylogenetic tree of strains isolated from potato rhizosphere.
Agronomy 14 01241 g002
Agronomy 14 01241 g003
Figure 3. Growth promotion by IAA-producing strains: (a) partial plant growth state on the 21st day; (b) relative height growth rate on the 21st day; and (c) root dry weight on the 21st day. * p ≤ 0.05 (Student’s t test).
Figure 3. Growth promotion by IAA-producing strains: (a) partial plant growth state on the 21st day; (b) relative height growth rate on the 21st day; and (c) root dry weight on the 21st day. * p ≤ 0.05 (Student’s t test).
Agronomy 14 01241 g003
Agronomy 14 01241 g004
Figure 4. Production of siderophores in strains: (a) halo presented on CAS; (b) plant growth state cultured in Fe-deficient Hoagland medium with FeCl3 (pH = 7.3); and (c) chlorophyll contents of plants. * p ≤ 0.05 (Student’s t test).
Figure 4. Production of siderophores in strains: (a) halo presented on CAS; (b) plant growth state cultured in Fe-deficient Hoagland medium with FeCl3 (pH = 7.3); and (c) chlorophyll contents of plants. * p ≤ 0.05 (Student’s t test).
Agronomy 14 01241 g004
Agronomy 14 01241 g005
Figure 5. Solubilization of phosphorus: (a) clearance zone presented on medium with insoluble Ca3(PO4)2; (b) relative height growth rate of plants; and (c) plant growth state cultured in P-deficient Hoagland medium with Ca3(PO4)2. * p ≤ 0.05 (Student’s t test).
Figure 5. Solubilization of phosphorus: (a) clearance zone presented on medium with insoluble Ca3(PO4)2; (b) relative height growth rate of plants; and (c) plant growth state cultured in P-deficient Hoagland medium with Ca3(PO4)2. * p ≤ 0.05 (Student’s t test).
Agronomy 14 01241 g005
Agronomy 14 01241 g006
Figure 6. Solubilization of zinc: (a) clearance zone presented on medium with insoluble ZnO; (b) chlorophyll contents of plans; and (c) plant growth state cultured in Zn-deficient Hoagland medium with ZnO. * p ≤ 0.05 (Student’s t test).
Figure 6. Solubilization of zinc: (a) clearance zone presented on medium with insoluble ZnO; (b) chlorophyll contents of plans; and (c) plant growth state cultured in Zn-deficient Hoagland medium with ZnO. * p ≤ 0.05 (Student’s t test).
Agronomy 14 01241 g006
Table 1. IAA production by strains.
Table 1. IAA production by strains.
StrainsIAA Contents (mg/L)StrainsIAA Contents (mg/L)
ST3243.16 ± 0.5894ST1461.69 ± 0.0192
ST2523.57 ± 0.7434ST1121.67 ± 0.1761
ST4923.47 ± 0.235ST501.41 ± 0.0419
ST714.18 ± 0.4438ST41.37 ± 0.3029
ST989.81 ± 0.8337ST11.15 ± 0.0679
ST1399.6 ± 0.3101ST1281.14 ± 0.2128
ST1187.79 ± 0.2416ST1301.05 ± 0.0712
ST97.5 ± 0.3165ST1760.96 ± 0.0546
ST856.13 ± 0.1182ST220.96 ± 0.0726
ST466.05 ± 0.1425ST550.93 ± 0.0144
ST215.93 ± 0.1774ST680.92 ± 0.0173
ST1405.88 ± 0.2822ST140.84 ± 0.0127
ST1445.67 ± 0.319ST1450.71 ± 0.1446
ST435.56 ± 0.0459ST1070.69 ± 0.1248
ST284.38 ± 0.166ST1210.69 ± 0.1357
ST1243.89 ± 0.2196ST260.49 ± 0.0474
ST823.84 ± 0.0679ST700.48 ± 0.1639
ST1323.16 ± 0.1692ST170.34 ± 0.1901
ST1732.43 ± 0.0804ST510.31 ± 0.0694
ST352.34 ± 0.2021ST120.23 ± 0.0614
ST1162.09 ± 0.0939ST1000.18 ± 0.0139
ST1722.03 ± 0.5157ST1750.16 ± 0.0948
ST731.94 ± 0.141ST970.15 ± 0.036
ST401.92 ± 0.0756
Table 2. Solubilization index of siderophores produced by strains.
Table 2. Solubilization index of siderophores produced by strains.
StrainsSolubilization Index (SI)StrainsSolubilization Index (SI)
ST512.72 ± 0.0473ST1321.25 ± 0.0056
ST352.57 ± 0.0552ST1471.25 ± 0.0029
ST402.66 ± 0.1117ST231.18 ± 0.0025
ST182.29 ± 0.0072ST81.17 ± 0.0085
ST492.08 ± 0.0087ST1281.18 ± 0.0101
ST812.02 ± 0.015ST771.15 ± 0.0214
ST851.92 ± 0.0532ST91.19 ± 0.0391
ST431.77 ± 0.025ST1751.12 ± 0.0028
ST1061.73 ± 0.018ST261.1 ± 0.012
ST171.54 ± 0.019ST111.11 ± 0.0074
ST391.45 ± 0.0262ST661.08 ± 0.0016
ST221.47 ± 0.0336ST121.05 ± 0.0225
ST651.5 ± 0.054ST71.08 ± 0.0036
ST211.42 ± 0.0836ST341.07 ± 0.0148
ST451.31 ± 0.0207ST61.05 ± 0.0195
ST531.29 ± 0.0067ST1001.07 ± 0.0186
ST1261.27 ± 0.0177ST41.05 ± 0.0093
ST961.27 ± 0.0057ST721.02 ± 0.0097
ST421.26 ± 0.0056
Table 3. Solubilization index of strains on phosphorus.
Table 3. Solubilization index of strains on phosphorus.
StrainsSolubilization Index (SI)
ST1771.35 ± 0.2046
ST471.27 ± 0.0433
ST1721.23 ± 0.0396
ST181.27 ± 0.0584
ST221.15 ± 0.0496
ST41.07 ± 0.0278
ST111.06 ± 0.0014
Table 4. Solubilization index of strains on zinc.
Table 4. Solubilization index of strains on zinc.
StrainsSolubilization Index (SI)
ST1032.4 ± 0.0111
ST321.47 ± 0.0384
ST341.16 ± 0.0411
ST851.08 ± 0.0072
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yu, Z.; Chen, C.; Li, Z.; Song, Y.; Yan, C.; Jiang, X.; Jia, H.; Shang, Y.; Tian, M. Potential Biofertilizers for Alkaline Soil: Bacteria Isolated from the Rhizosphere of Potatoes. Agronomy 2024, 14, 1241. https://doi.org/10.3390/agronomy14061241

AMA Style

Yu Z, Chen C, Li Z, Song Y, Yan C, Jiang X, Jia H, Shang Y, Tian M. Potential Biofertilizers for Alkaline Soil: Bacteria Isolated from the Rhizosphere of Potatoes. Agronomy. 2024; 14(6):1241. https://doi.org/10.3390/agronomy14061241

Chicago/Turabian Style

Yu, Zhongchen, Caiding Chen, Zhou Li, Yunjie Song, Chunhong Yan, Xinyu Jiang, Heng Jia, Yi Shang, and Mengqing Tian. 2024. "Potential Biofertilizers for Alkaline Soil: Bacteria Isolated from the Rhizosphere of Potatoes" Agronomy 14, no. 6: 1241. https://doi.org/10.3390/agronomy14061241

APA Style

Yu, Z., Chen, C., Li, Z., Song, Y., Yan, C., Jiang, X., Jia, H., Shang, Y., & Tian, M. (2024). Potential Biofertilizers for Alkaline Soil: Bacteria Isolated from the Rhizosphere of Potatoes. Agronomy, 14(6), 1241. https://doi.org/10.3390/agronomy14061241

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop