Next Article in Journal
A Strategic Management Approach to Reduce Pepper Weevil Damage to Jalapeño Pepper Plants with Conventional and Biorational Insecticides
Previous Article in Journal
Mechanistic Insights into Phosphorus Efficiency and Shoot P Concentration in Chinese Cabbage
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 15
Issue 1
10.3390/agronomy15010129
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

CRISPR/Cas9-Mediated Editing of a NODULATION SIGNALING PATHWAY 1 Homolog Alters the Production of Strigolactones in Sunflower Roots

by
Maria A. Lebedeva
1,*,
Maria S. Gancheva
1,
Maksim R. Losev
1,
Sofia V. Sokornova
2,
Oleg S. Yuzikhin
2,3,
Anna A. Krutikova
4,
Kirill V. Plemyashov
4 and
Lyudmila A. Lutova
1
1
Department of Genetics and Biotechnology, Saint Petersburg State University, Universitetskaya Emb. 7/9, St. Petersburg 199034, Russia
2
Federal State Budget Scientific Institution “All-Russian Institute of Plant Protection”, (FSBSI VIZR), Podbelskogo, 3, St. Petersburg-Pushkin 196608, Russia
3
All-Russia Research Institute for Agricultural Microbiology, Podbelskogo, 3, St. Petersburg-Pushkin 196608, Russia
4
Department of Genetic and Reproductive Biotechnology, St. Petersburg State University of Veterinary Medicine, Chernigovskaya St., 5, St. Petersburg 196084, Russia
*
Author to whom correspondence should be addressed.
Agronomy 2025, 15(1), 129; https://doi.org/10.3390/agronomy15010129
Submission received: 9 December 2024 / Revised: 29 December 2024 / Accepted: 4 January 2025 / Published: 7 January 2025
(This article belongs to the Section Crop Breeding and Genetics)
Browse Figures
Versions Notes

Abstract

:
Sunflower (Helianthus annuus L.) is specifically infected by an obligatory root parasitic plant Orobanche cumana Wallr. (sunflower broomrape), which causes significant losses of sunflower yield. Breeding of sunflower varieties resistant to broomrape is an important challenge for agriculture. However, the selection of new resistant sunflower varieties was accompanied by the emergence of new virulent races of broomrape, which overcame the effect of resistance genes. Unraveling the molecular mechanisms underlying the resistance to broomrape in sunflowers should facilitate the development of new sunflower varieties with complex resistance to broomrape using genome editing technology. Here, we used CRISPR/Cas9-mediated genome editing in sunflower hairy roots for a specific knock-out of the gene encoding a GRAS transcription factor (HaNSP1a), acting as a possible regulator of strigolactone biosynthesis, a class of phytohormones known to induce the germination of broomrape seeds. According to HPLC-IT-TOF/MS analysis, the levels of orobanchol were decreased in the genetically modified roots with knock-out of the HaNSP1a gene, whereas, in contrast, 5-deoxystrigol levels were increased in the roots with HaNSP1a knock-out, suggesting the role of HaNSP1a in the regulation of the strigolactone biosynthetic pathway. The experimental approach described here could be used in further studies to test the effect of gene knock-out on the development of resistance to O. cumana in sunflowers.

1. Introduction

The sunflower plant (Helianthus annuus L.) is the fourth most important oilseed crop in the world. Significant losses in sunflower yield are caused by broomrape Orobanche cumana Wallr. Broomrape is an obligate parasitic plant that does not have its own chlorophyll and, therefore, its nutrition is completely dependent on the host plant. It is estimated that 30% of sunflower cultivation areas worldwide are infected with broomrape, where sunflower seed losses can be up to 80–100% under high infestations [1,2]. The selection of new sunflower varieties resistant to broomrape was accompanied by the emergence of new virulent races of broomrape, which overcame the effect of resistance genes. Currently, there are already eight races of broomrape, named A, B, C, D, E, F, G, and H, with race G being the dominant race in many countries [3]. Deciphering the molecular mechanisms underlying sunflower resistance to broomrape would make it possible to use gene engineering approaches to produce new sunflower varieties resistant to different races of broomrape simultaneously.
The molecular basis of the interaction between sunflower and broomrape is not yet well understood [4]. Broomrape seeds are germinated only in the presence of host plants, whose roots produce stimulators for their germination. The key germination stimulators for parasitic plants are strigolactones (SLs) secreted by the roots of a host plant. The main strigolactones secreted by sunflower are orobanchyl acetate, 5-deoxystrigol, and sesquiterpene lactones [5]. Moreover, 5-sorgolactone and orobanchol were identified in sunflower root exudates [6]. A specific inducer of the germination of O. cumana seeds is a sesquiterpene lactone, dehydrocostus lactone, secreted by sunflower roots [7]. In addition, other sesquiterpene lactones [8], as well as the non-canonical strigolactone, heliolactone [9] are able to induce germination of O. cumana seeds.
Among the regulators of SL biosynthesis in the root, the NSP1 (NODULATION SIGNALING PATHWAY 1) and NSP2 genes encoding the GRAS transcription factor have been characterized. NSP1 was initially identified as a key regulator of symbiotic nodule development in legumes [10]. Recently, its involvement in mycorrhizal symbiosis was shown as well [11]. Interestingly, the low mycorrhizal colonization phenotype observed in the nsp1 mutant appeared to be associated with lower SL production: the nsp1 mutant was not able to produce detectable SL amounts [12]. Moreover, RNAi of NSP1 and NSP2 homologs in rice showed a significant decrease in the level of SLs in the roots, and rice nsp1 nsp2 RNAi root exudates demonstrated significantly reduced germination of Striga hermonthica seeds, a parasitic plant whose seed germination depends on the presence of SLs [12].
Since SLs and related compounds are the inductors O. cumana seed germination, we hypothesized that the creation of new sunflower varieties resistant to broomrape could be achieved through modulation of SL production in sunflower roots via knock-out of the closest NSP1 homolog in sunflower. Here, we identified HaNSP1 homologs in sunflower and carried out successful editing of the HaNSP1a gene in sunflower roots using the CRISPR-Cas9 approach, which resulted in impaired strigolactone production. The experimental approach described in our work could be used in further studies to test the effect of knock-out in candidate genes for the development of resistance to broomrape.

2. Materials and Methods

2.1. Plant Material

The sunflower cultivar LG 50479 SX (Limagrain Group, Saint-Beauzire, Puy-de-Dôme, France) (resistant to broomrape races A-F and susceptible to more recent races) was used in this study.

2.2. Identification and Phylogenetic Analysis of NSP Proteins in Sunflower

BLASTp was used to search homologs of NSP1/2 genes of sunflower in the Phytozome [13] database with the protein sequences of M. truncatula NSP1 and NSP2 as a query. The presence of the GRAS domain was checked using the Pfam database. The NSP proteins of Arabidopsis thaliana, M. truncatula, and rice were obtained from a previous study [12] and aligned using Muscle. A phylogenetic tree was constructed in MEGA v11 [14] using the maximum likelihood method with 1000 bootstrap replications. The Arabidopsis gene AT3G49950 was used as an outgroup.

2.3. RNA-Seq Data Analysis

Raw reads were obtained from the NCBI PRJNA706194 project. The read quality was assessed using FastQC v0.11.9 [15] and MultiQC v1.12 [16]. The raw reads were filtered using Trimmomatic v0.39 [17] with the “IILLUMINACLIP:TruSeq3-SE.fa:2:30:10:2:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36” options. Reads were then mapped against the Helianthus annuus r1.2 genome (phytozome genome ID: 494, NCBI taxonomy ID: 4232; [18]) by HISAT2 v2.2.1 [19] with the “--no-softclip” option. BAM files were sorted using the samtools v1.13 software package [20] and the quantitation of data was performed using StringTie v2.2.1 [21].

2.4. Construction of the Vector for CRISPR-Cas9-Mediated Editing of the Candidate Gene

The target sequence for CRISPR/Cas9-mediated editing of the HaNSP1a gene was selected using CRISPOR http://crispor.tefor.net/ (accessed on 1 June 2022) and CRISPR-direct https://crispr.dbcls.jp/ (accessed on 1 June 2022), and their specificity and off-targets were analyzed using Cas-OFFinder http://www.rgenome.net/cas-offinder/ (accessed on 1 June 2022). The fragment of the HaNSP1a gene including the selected target sequence was amplified on DNA extracted from sunflower cultivar LG 50479 SX, and the presence of the target sequence in its genome was verified by sequencing. The following oligos were designed for the selected target sequence: HaNSP1_target_F: ATTGGCTGCAGTACGTTCGAGAC and HaNSP1_target_R: AAACGTCTCGAACGTACTGCAGC (5′ overhangs used for subsequent cloning are underlined). The target sequence was inserted into the pKSEe401R vector according to the protocol provided by Xing et al. in 2014 [22]. This vector represents the pKSE401 vector [22] modified by the addition of the OsMac3 translational enhancer upstream of the zCas9 coding sequence and pAtUBQ10::DsRed1 cassette for the selection of transgenic roots [23]. The insertion of the target sequence specific to HaNSP1 was checked by sequencing using the ABI Prism 3500xl Genetic Analyzer (Applied Biosystems, USA). The obtained vector (pKSEe401R-HaNSP1) was introduced into the Agrobacterium (Rhizobium) rhizogenes strain Arqua1.

2.5. Sunflower Seed Sterilization and Its Transformation Using Agrobacterium (Rhizonium) Rhizogenes

Sunflower seeds were pre-peeled from the seedcoat and then immersed in 70% ethanol for 2 min. After that, ethanol was removed, and the seeds were treated with a 50% solution of bleach (contains 10–15% of sodium hypochlorite) for 20 min and then washed extensively with a large amount of sterile water 5 times and germinated on 1% agar plates. In 3–4 days after germination, the root was cut off from the seedlings in the hypocotyl area, and a suspension of agrobacteria containing the target vector was applied to the cut area of the shoot. After that, the rootless explants were placed either on Petri dishes or in Grodan Rockwool Grow Cubes (Grodan ROCKWOOL B.V., Roermond, The Netherlands) impregnated with ¼ liquid MS medium with bacteria resuspended in it (at an optical density of OD600 about 0.2) and placed in sterile Microbox plastic containers with ventilated lids (SacO2, Belgium). The method for A. rhizogenes-mediated transformation was adapted from [24]. After 10 days, the fluorescence of DsRED in the roots was checked under a fluorescent binocular (SteREO Discovery.V12, Carl Zeiss, Oberkochen, Germany), and non-transgenic roots were cut off. After that, composite sunflower plants with transgenic roots (about 90% of plants formed DsRED-positive transgenic roots) were transferred to an aeroponic system supplied with an aeroponic medium [25] and were grown at a 16-h light for two weeks. DsRED-positive transgenic roots were genotyped and frozen for subsequent analysis.

2.6. Genotyping of Transgenic Roots

The genotyping of transgenic roots was performed using a NucleoType Plant PCR kit (Macherey-Nagel, Dueren, Germany). The primers used for PCR analysis were HaNSP1_F_genotyping, TTCATCTCAAACATTCTCCGTCTAG, and HaNSP1_R_genotyping, CCCTTTCCACCATAACCCC. The amplification of the PCR product was verified using gel electrophoresis, and after that, the PCR product was sequenced using the ABI Prism 3500xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) using the HaNSP1_F_genotyping primer. Sequencing was performed at the St. Petersburg State University Resource Center “Development of Molecular and Cellular Technologies”. To identify gene editing events, sequencing chromatograms were analyzed using the Synthego ICE program (https://ice.synthego.com/#/ (accessed on 1 May 2024)). The samples with R2 values more than 0.8 were considered acceptable for ICE analysis.

2.7. Identification of Strigolactones in Transgenic Sunflower Roots

Identification of strigolactones in transgenic sunflower roots was performed by HPLC-IT-TOF/MS analysis of root extracts. In total, 200 mg of DsRED-positive transgenic roots were ground to powder in liquid nitrogen with 1.5 mL of ethyl acetate, extracted in an ultrasonic bath Transsonic Digital (Elma, Tovatech, Plano, TX, USA) at 30 °C for 30 min, evaporated on a centrifuge vaporizer Savant ™ SPD121P SpeedVac™ Kits (Thermo Scientific™, Göteborg, Sweden), weighed, and re-dissolved to a concentration of 1 mg/L. The extracts were analyzed by HPLC-MS using an IT-TOF mass spectrometer (Shimadzu Corporation, Kyoto, Japan) equipped with an ESI interface. A Waters BEH Shield RP18 column (50 × 2.1 mm, 1.7 μm) was used. Chromatography was carried out at a temperature of +50 °C and a flow rate of 0.3 mL/min. The injection volume was 5 µL. Compounds were analyzed in positive electrospray ionization mode. The mobile phases were 0.1% formic acid (A) and acetonitrile + 0.1% formic acid (B). The gradient was as follows: 0.0–10.0 min, 10% → 50% B; 10.0–10.5 min, 50 → 90% B; 10.5–14.0 min, 90% B; and 14.0–14.5 min, 90% → 10% B. The IT-TOF/MS analysis was carried out in the selected mass ranges, which were (m/z) 317.0000–318.5000 Da; 331.0000–332.5000 Da; and 347.0000–348.5000 Da with a scan rate of 2 spectra/s. The operating parameters of the electrospray ionization sources were as follows: nebulizing gas (N2) flow rate, 1.5 L/min; drying gas pressure, 100 kPa; CDL temperature, 200 °C; and heat block temperature, 200 °C. The probe voltage was +1.5 kV. The ion accumulation time was 100 ms; detector voltage—1.6 kV. All the acquisitions and analyses of data were controlled by LabSolutions LCMSSolution software (release 3.80, Shimadzu Corporation, Kyoto, Japan). A standard solution of sodium trifluoroacetic acid (TFA) was used to calibrate the TOF–MS to increase mass accuracy.
Oranbochol ((±)2′-epi-orobanchol, Olchemim, Olomouc, Czech Republic) was used as a standard and was analyzed using HPLC-MS analysis under the same experimental conditions.

3. Results

3.1. Identification and Phylogenetic Analysis of NSP Transcription Factors in Sunflowers

Five NSP1-like (HaNSP1a-e) genes and one NSP2-like (HaNSP2) gene were identified in the genome of Helianthus annuus (Figure 1, see also Supplementary Figure S1). All of them contained a GRAS domain (see Supplementary Figure S2). Based on sequence similarity and chromosomal localization, we suggest that HaNSPc-e arose from duplication events. Supplementary Figure S3 shows the alignment of nucleotide sequences of HaNSP1a-e genes.

3.2. Expression Analyses of HaNSP Genes in Sunflower Roots

In order to estimate the expression levels of the HaNSP-like genes, we analyzed the transcriptomes of sunflower roots [26]. Among five HaNSP1-like and HaNSP2-like genes, HaNSP1a demonstrates the highest expression levels in the roots, both after broomrape (O. cumana) infection and in the absence of O. cumana (Figure 2).
Based on this finding, the HaNSP1a gene was selected for further functional analysis in sunflower.

3.3. Construction of a Vector for CRISPR/Cas9-Mediated Editing of the NSP1-like Gene in Sunflowers and Selection of Transgenic Roots

The target sequence for CRISPR/Cas9-mediated editing (see Section 2 (Material and Methods)) specific to the HaNSP1a gene (see Supplementary Figures S4 and S5) was inserted into the pKSEe401R vector and the resulting vector (pKSEe401R-HaNSP1a) was used for A. rhizogenes-mediated transformation in order to obtain composite plants with genetically-modified roots (Figure 3). The selection of transgenic roots was performed based on DsRed fluorescence under a fluorescent binocular (SteREO Discovery.V12, Carl Zeiss, Oberkochen, Germany) (Figure 3, Supplementary Figure S6).

3.4. Identification of the HaNSP1a Gene Editing Events in Transgenic Roots

DsRed-positive transgenic roots obtained after A. rhizogenes-mediated transformation were further checked for editing events in the HaNSP1a gene. A fragment of the HaNSP1a gene including the target sequence was amplified from the DsRed-positive root samples. The obtained PCR products were sequenced and sequencing chromatograms were analyzed using the Synthego ICE program (see Supplementary Figure S7). In total, 25 transgenic roots were genotyped. Among them, 9 roots did not demonstrate any changes in HaNSP1-like sequence (see Figure 4A), whereas 16 roots had deletions and/or insertions of different lengths next to the target sequence in the HaNSP1a gene, which should lead to a frameshift and loss of functional HaNSP1-like protein (see Supplementary Figure S8). Among these 16 roots, 5 root samples demonstrated changes in nucleotide sequences three bp upstream of the PAM sequence in more than 90% of DNA sequences identified by the Synthego ICE program (Figure 4B,C). Such roots, therefore, should have knock-out (KO) of the HaNSP1a gene (KO root samples). Eleven roots had partial knock-out (PKO) of the HaNSP1a gene since they had both native (wildtype) and 30–90% sequences with insertion and deletion of different lengths in the HaNSP1a gene sequence (Figure 4D,E). Among them, samples containing multiallelic changes in the HaNSP1a sequence were found (Figure 4D,E). Such multiallelic changes could be explained by the chimeric origin of transgenic roots taken into analysis. The transgenic root obtained after A. rhizogenes-mediated transformation could be chimeric (not being originated from a single cell) and, therefore, could include cells with different editing events [23,27]. DNA samples extracted from such chimeric roots should demonstrate multiallelic changes in a target gene. In several cases, in addition to wildtype HaNSP1a sequences, multiple mutated alleles were identified with different types of editing events, which should result in partial knock-out of the HaNSP1a gene.
Therefore, all root samples were subdivided into three groups with native (wt), knock-out (KO) and partial knock-out (PKO) of the HaNSP1a gene.

3.5. Strigolactone Contents in Transgenic HaNSP1a-Edited Sunflower Roots

Previously, it was shown that NSP1 is indispensable for SL biosynthesis in Medicago truncatula and in rice [12]. We hypothesized that knockout of the HaNSP1a gene in sunflowers could also lead to a decrease in SL production. To test our hypothesis, we assessed the level of SLs and related substances in the extracts of control (wildtype) and transgenic sunflower roots with knockout (PKO or KO) of the HaNSP1a gene using HPLC-IT-TOF/MS. Oranbochol (2′-epi-orobanchol) was used as a standard. Using this approach, it was possible to differentiate three types of SLs in chromatographic profiles of sunflower root extracts: orobanchol (calculated m/z [M + H]+ 347.1416, found 347.1550), 5-deoxystrigol (calculated m/z [M + H]+ 331.1467, found 331.1517), and sorgolactone (calculated m/z [M + H]+ 317.1311, found 317.1321). These types of SLs were previously detected in sunflower roots [6].
Next, we performed HPLC-IT-TOF/MS analysis of root extracts in the selected mass ranges, which were (m/z) 317.0000–318.5000 Da; 331.0000–332.5000 Da; and 347.0000–348.5000 Da to detect sorgolactone, 5-deoxystrigol, and orobanchol, respectively (Figure 5). For (±)2′-epi-orobanchol, used as a standard, a single peak with a retention time (RT) 8.57 min was observed under these experimental conditions (see Supplementary Figure S9). For wildtype roots, we observed several peaks with RT 3.9, 8.70, 9.60, and 10.80 min for orobanchol-type substances (mass-range 347.0000–348.5000), several peaks with relatively low signal intensities for the 5-deoxystrigol-related substance (mass-range 331.0000–332.5000, RT 5.90, 8.30, 11.20, and 11.80 min), and sorgolactone-related substances (mass range 317.0000–318.5000, RT 5.50, 7.80, 10.00, and 10.20 min) (Figure 5A). Interestingly, in the root extracts with PKO and KO of the HaNSP1a gene, signal intensities for orobanchol-related peaks (RT = 8.7) were significantly lower (Figure 5B,C and Figure 6). Moreover, in the root extracts with KO of the HaNSP1a gene, increased signals corresponded to 5-deoxystrigol (RT = 11.80 min) (Figure 5C and Figure 6), which were barely visible in wildtype (Figure 5A) and PKO (Figure 5B) root extracts. Therefore, our data suggest that HaNSP1a knock-out impairs SL biosynthesis in sunflower roots.

4. Discussion

Here, we described the CRISPR-Cas9-mediated HaNSP1a gene editing in sunflowers using hairy root transformation protocol. In this system, we obtained transgenic roots gaining the cassette for CRISPR-Cas9-mediated editing of the target gene through transformation using A. rhizogenes. A. rhizogenes-mediated transformation allows us to induce transgenic roots in a relatively short time (several weeks), which takes much less time compared to the generation of stable transgenic plants using A. tumefaciens. This approach is widely used in functional studies of genes related to biological processes occurring in the root, such as symbiotic nodulation in legume roots [28]. Moreover, a hairy root system could be used to check the efficiency of gRNA sequences designed for genome editing [23]. Recently, CRISPR-Cas9-mediated gene editing in hairy roots was used to study the regulation of root development in cucumbers [27]. We demonstrated that this approach could be useful for functional studies of genes responsible for sunflower resistance to O. cumana. The sunflower–broomrape interaction is initiated and established in the roots as well as genetic modification of the roots via A. rhizogenes-mediated transformation; therefore, genetic modification of sunflower roots could allow the identification of the genetic factors responsible for the development of resistance to broomrape. Using A. rhizogenes-mediated transformation, we managed to obtain transgenic roots expressing the cassette for CRISPR-Cas9-mediated editing of the HaNSP1a gene in sunflower, which were selected based on DsRed fluorescence. Transgenic roots were genotyped by PCR amplification and subsequent sequencing analysis of the HaNSP1a gene fragment, which allowed us to select root samples with partial or full knock-out of the HaNSP1a gene due to CRISPR-Cas9-mediated editing.
Using HPLC-IT-TOF/MS analysis, we managed to identify three types of SLs in sunflower extracts: orobanchol, 5-deoxystrigol, and sorgolactone, which were previously detected as major SLs in sunflower roots [6]. In contrast to the root extracts from wildtype roots, in the root extracts with KO of the HaNSP1a gene, signal intensities for orobanchol-related peak (RT = 8.7) were significantly lower, whereas signals corresponding to 5-deoxystrigol (RT = 11.80 min) were significantly increased. Therefore, our data suggest that HaNSP1a knock-out impairs SL biosynthesis in sunflower roots, resulting in a significant decrease in orobanchol-related compounds and an increase in 5-deoxystrigol-related compounds. Although SL biosynthetic steps and the relation between different types of SLs in sunflowers have not been characterized in detail, it was postulated that 5-deoxystrigol is a precursor of different types of SLs, including orobanchol [29]. Therefore, we could speculate that the HaNSP1a transcription factor could regulate the expression of genes involved in the biosynthesis of SL compounds, including orobanchol, from 5-deoxystrigol as a precursor substance (Figure 7). Thus, knock-out of the HaNSP1a gene should result in the accumulation of 5-deoxystrigol and the decrease in orobanchol, as we observed in this study.
This result suggests that HaNSP1a is required for the regulation of SL biosynthesis in sunflowers. Since SLs secreted by plants stimulate the germination of seeds of parasitic plants, one could expect that downregulation of SL production in the root due to knockout of the HaNSP1a gene may reduce the efficiency of germination of broomrape seeds and, as a result, may contribute to the formation of sunflower resistance to this parasitic plant. Future research is needed to test this assumption.
NSP1 is known as a key regulator of symbiotic nodule development in legumes: it is essential for the early symbiotic signaling pathway induced by rhizobia [10]. Moreover, it was shown that NSP1 is a component of the Myc signaling pathway, necessary for the development of arbuscular mycorrhiza symbiosis [11]. Moreover, NSP1 is required for SL biosynthesis in M. truncatula and rice [12]. Recently, NSP1 was shown to regulate rice tiller number by promoting the biosynthesis of SLs in response to Pi starvation [30]. Therefore, the recent finding suggests that NSP1 has a broader role in the regulation of plant development, which is not limited by its involvement in the Nod-factor signaling pathway induced by rhizobia. Since NSP1 TF is a component of a common symbiotic pathway, necessary both for plant symbiosis with rhizobia and AM fungi [11], it is attractive to speculate that this TF could be a candidate regulator involved in one more type of interaction between plants and other organisms—the interaction between host plants and parasitic weeds. Future studies should consider the role of the HaNSP1a gene in the control of broomrape seed germination and resistance to this parasite in sunflowers.
The molecular mechanisms of sunflower resistance to broomrape have not yet been sufficiently studied. To date, only one gene, HaOr7, has been cloned, which determines resistance to broomrape race F [31]. HaOr7 encodes a receptor kinase with leucine-rich repeats, which has high similarity to the previously characterized immune receptor in rice, XA21 [32]. For other resistance loci, only candidate genes colocalizing with them were identified, whereas specific genes have not been cloned yet. Among these candidate genes, multiple genes encoding receptor-like proteins and NLR proteins, which could act as possible immune receptors, were found [33,34,35]. Thus, at least some of the broomrape-resistant forms of sunflower selected during breeding are characterized by changes in genes encoding immune receptors, which probably perceive broomrape effector proteins, triggering specific immunity that underlies the “vertical” resistance of sunflower that develops to certain races of O. cumana. In such O. cumana-resistant sunflower varieties, the development of resistance is observed at the stage of haustorium growth and its attachment to the vascular system of the host plant (reviewed in [4]), whereas early stages of sunflower–broomrape interactions, including broomrape seed germination influenced by sunflower root exudates, are not affected. In this regard, obtaining sunflower forms with disruption of the genes that regulate the biosynthesis of SLs, acting as specific inducers of germination of broomrape seeds, and the study of their interaction with different races of broomrape is of both fundamental and practical interest. We assume that suppressing the sunflower–broomrape interaction at the very early stage, at the stage of induction of germination of broomrape seeds, will make it possible to obtain forms of sunflower that are simultaneously resistant to many broomrape races. The genetic engineering approach described in this work can be used to solve this problem.

5. Conclusions

The HaNSP1a gene was efficiently knocked out by CRISPR-Cas9-mediated editing using a hairy root transformation protocol in sunflower. The results of HPLC-IT-TOF/MS analysis of root extracts suggest that HaNSP1a knock-out impairs the strigolactone biosynthetic pathway. The approach described here can be used for functional gene studies and genome editing in sunflowers, in particular, with the aim of obtaining sunflower varieties resistant to broomrape.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy15010129/s1: Supplementary Figure S1: Phylogenetic tree of the NSP1/2 genes from sunflower (HaNSP), Arabidopsis (AtNSP), M. truncatula (MtNSP), and rice (OsNSP) constructed based on nucleotide sequences. Supplementary Figure S2: Domain structures of NSP1-like (HaNSP1a-e) and NSP2-like (HaNSP2) transcription factors identified in H. annuus. The presence of the GRAS domain (shown in a grey box) was checked using the Pfam database. Pink rectangles mark low complexity regions. Supplementary Figure S3: Multiple alignment of HaNSP1a-e nucleotide sequences. Supplementary Figure S4: Structure of the HaNSP1a coding sequence. Supplementary Figure S5: Fragment of multiple sequence alignment of HaNSP1a-e gene regions including target sequence selected for CRISPR-Cas9-mediated editing (highlighted in pink) and the PAM sequences (marked with a red box). Supplementary Figure S6: DsRed fluorescence in sunflower roots. (A,B) Transgenic roots demonstrating DsRed fluorescence; (C,D) Non-transgenic control roots exhibiting faint autofluorescence signal in the red spectrum. (A,C) Brightfield images, (B,D) Fluorescence microscopic images. Supplementary Figure S7: The representative raw chromatograms and their decoding by Synthego ICE program. Target sequence is marked with a red line. Supplementary Figure S8: The comparison of amino acid sequence of the wild-type HaNSP1a protein and the representative proteins resulted from the translation of two HaNSP1a alleles with 8 bp deletion (−8 bp) and 1-bp insertion (+1 bp) observed in transgeni root due to CRISPR-Cas9-mediated gene editing. Premature stop codons are shown with red asterisks. The fragment of amino acid sequences presented here is located within the GRAS domain of the HaNSP1a protein. Supplementary Figure S9: HPLC–MS analysis of (±)2′-epi-orobanchol (Olchemim, Czech Republic) used as a standard.

Author Contributions

Conceptualization, M.A.L. and M.S.G.; methodology, M.A.L., M.S.G., S.V.S. and O.S.Y.; investigation, M.A.L., M.S.G., M.R.L., S.V.S., O.S.Y. and A.A.K.; writing—original draft preparation, M.A.L., M.S.G. and M.R.L.; writing—review and editing, M.A.L., M.S.G. and A.A.K.; supervision, M.A.L. and L.A.L.; project administration, M.A.L., A.A.K. and K.V.P.; funding acquisition, L.A.L. and K.V.P. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Ministry of Science and Higher Education of the Russian Federation in accordance with the agreement according to contract no. 075-15-2022-322 date 22 April 2022 on providing a grant in the form of subsidies from the Federal Budget of the Russian Federation. The grant was provided for the creation and development of a World-class Scientific Center “Agrotechnologies for the Future”.

Data Availability Statement

All the data obtained are contained within the article and Supplementary Material.

Acknowledgments

The authors thank the Research Resource Center for Molecular and Cell Technologies of Saint-Petersburg State University and personally, Anna E. Romanovich, for the sequencing.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Cvejić, S.; Radanović, A.; Dedić, B.; Jocković, M.; Jocić, S.; Miladinović, D. Genetic and Genomic Tools in Sunflower Breeding for Broomrape Resistance. Genes 2020, 11, 152. [Google Scholar] [CrossRef] [PubMed]
  2. Antonova, T.S.; Araslanova, N.M.; Saukova, S.L.; Ivebor, M.V. On the issue of fileds weediness with seeds of broomrape (Orobanche cumana Wallr.), an obligate parasite of sunflower in Russian Federation. Vestn. Russ. Agric. Sci. 2020, 4, 29–32. (In Russian) [Google Scholar] [CrossRef]
  3. Antonova, T.S.; Araslanova, N.M.; Pitinova, J.V. Racial belonging of broomrape (Orobanche cumana Wallr.) seeds, collected on the fields of different regions of the Russian Federation in 2019. Agrar. Sci. 2020, 6, 62–65. [Google Scholar] [CrossRef]
  4. Lebedeva, M.A.; Gancheva, M.S.; Losev, M.R.; Krutikova, A.A.; Plemyashov, K.V.; Lutova, L.A. Molecular and Genetic Bases for Sunflower Resistance to Broomrape. Russ. J. Plant Physiol. 2023, 70, 92. [Google Scholar] [CrossRef]
  5. Yoneyama, K.; Xie, X.; Kisugi, T.; Nomura, T.; Sekimoto, H.; Yokota, T.; Yoneyama, K. Characterization of Strigolactones Exuded by Asteraceae Plants. Plant Growth Regul. 2011, 65, 495–504. [Google Scholar] [CrossRef]
  6. Bharti, N.; Tripathi, S.; Bhatla, S.C. Photomodulation of Strigolactone Biosynthesis and Accumulation during Sunflower Seedling Growth. Plant Signal Behav. 2015, 10, e1049792. [Google Scholar] [CrossRef]
  7. Joel, D.M.; Chaudhuri, S.K.; Plakhine, D.; Ziadna, H.; Steffens, J.C. Dehydrocostus Lactone Is Exuded from Sunflower Roots and Stimulates Germination of the Root Parasite Orobanche Cumana. Phytochemistry 2011, 72, 624–634. [Google Scholar] [CrossRef] [PubMed]
  8. Raupp, F.M.; Spring, O. New Sesquiterpene Lactones from Sunflower Root Exudate as Germination Stimulants for Orobanche Cumana. J. Agric. Food Chem. 2013, 61, 10481–10487. [Google Scholar] [CrossRef] [PubMed]
  9. Ueno, K.; Furumoto, T.; Umeda, S.; Mizutani, M.; Takikawa, H.; Batchvarova, R.; Sugimoto, Y. Heliolactone, a Non-Sesquiterpene Lactone Germination Stimulant for Root Parasitic Weeds from Sunflower. Phytochemistry 2014, 108, 122–128. [Google Scholar] [CrossRef]
  10. Smit, P.; Raedts, J.; Portyanko, V.; Debellé, F.; Gough, C.; Bisseling, T.; Geurts, R. NSP1 of the GRAS Protein Family Is Essential for Rhizobial Nod Factor-Induced Transcription. Science 2005, 308, 1789–1791. [Google Scholar] [CrossRef]
  11. Delaux, P.; Bécard, G.; Combier, J. NSP 1 Is a Component of the Myc Signaling Pathway. New Phytol. 2013, 199, 59–65. [Google Scholar] [CrossRef] [PubMed]
  12. Liu, W.; Kohlen, W.; Lillo, A.; Op den Camp, R.; Ivanov, S.; Hartog, M.; Limpens, E.; Jamil, M.; Smaczniak, C.; Kaufmann, K.; et al. Strigolactone Biosynthesis in Medicago Truncatula and Rice Requires the Symbiotic GRAS-Type Transcription Factors NSP1 and NSP2. Plant Cell 2011, 23, 3853–3865. [Google Scholar] [CrossRef] [PubMed]
  13. Goodstein, D.M.; Shu, S.; Howson, R.; Neupane, R.; Hayes, R.D.; Fazo, J.; Mitros, T.; Dirks, W.; Hellsten, U.; Putnam, N.; et al. Phytozome: A Comparative Platform for Green Plant Genomics. Nucleic Acids Res. 2012, 40, D1178–D1186. [Google Scholar] [CrossRef]
  14. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
  15. Babraham Bioinformatics—FastQC A Quality Control Tool for High Throughput Sequence Data. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 13 May 2024).
  16. Ewels, P.; Magnusson, M.; Lundin, S.; Käller, M. MultiQC: Summarize Analysis Results for Multiple Tools and Samples in a Single Report. Bioinformatics 2016, 32, 3047–3048. [Google Scholar] [CrossRef] [PubMed]
  17. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
  18. Badouin, H.; Gouzy, J.; Grassa, C.J.; Murat, F.; Staton, S.E.; Cottret, L.; Lelandais-Brière, C.; Owens, G.L.; Carrère, S.; Mayjonade, B.; et al. The Sunflower Genome Provides Insights into Oil Metabolism, Flowering and Asterid Evolution. Nature 2017, 546, 148–152. [Google Scholar] [CrossRef]
  19. Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A Fast Spliced Aligner with Low Memory Requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed]
  20. Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. 1000 Genome Project Data Processing Subgroup The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
  21. Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.-C.; Mendell, J.T.; Salzberg, S.L. StringTie Enables Improved Reconstruction of a Transcriptome from RNA-Seq Reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef]
  22. Xing, H.-L.; Dong, L.; Wang, Z.-P.; Zhang, H.-Y.; Han, C.-Y.; Liu, B.; Wang, X.-C.; Chen, Q.-J. A CRISPR/Cas9 Toolkit for Multiplex Genome Editing in Plants. BMC Plant Biol. 2014, 14, 327. [Google Scholar] [CrossRef] [PubMed]
  23. Kiryushkin, A.S.; Ilina, E.L.; Guseva, E.D.; Pawlowski, K.; Demchenko, K.N. Hairy CRISPR: Genome Editing in Plants Using Hairy Root Transformation. Plants 2022, 11, 51. [Google Scholar] [CrossRef]
  24. Parks, T.; Yordanov, Y.S. Composite Plants for a Composite Plant: An Efficient Protocol for Root Studies in the Sunflower Using Composite Plants Approach. Plant Cell Tissue Organ. Cult. 2020, 140, 647–659. [Google Scholar] [CrossRef]
  25. Lullien, V.; Barker, D.G.; de Lajudie, P.; Huguet, T. Plant Gene Expression in Effective and Ineffective Root Nodules of Alfalfa (Medicago sativa). Plant Mol. Biol. 1987, 9, 469–478. [Google Scholar] [CrossRef] [PubMed]
  26. Sisou, D.; Tadmor, Y.; Plakhine, D.; Ziadna, H.; Hübner, S.; Eizenberg, H. Biological and Transcriptomic Characterization of Pre-Haustorial Resistance to Sunflower Broomrape (Orobanche cumana W.) in Sunflowers (Helianthus annuus). Plants 2021, 10, 1810. [Google Scholar] [CrossRef]
  27. Kiryushkin, A.S.; Ilina, E.L.; Kiikova, T.Y.; Pawlowski, K.; Demchenko, K.N. Do DEEPER ROOTING 1 Homologs Regulate the Lateral Root Slope Angle in Cucumber (Cucumis sativus)? Int. J. Mol. Sci. 2024, 25, 1975. [Google Scholar] [CrossRef] [PubMed]
  28. Boisson-Dernier, A.; Chabaud, M.; Garcia, F.; Bécard, G.; Rosenberg, C.; Barker, D.G. Agrobacterium Rhizogenes-Transformed Roots of Medicago Truncatula for the Study of Nitrogen-Fixing and Endomycorrhizal Symbiotic Associations. Mol. Plant Microbe Interact. 2001, 14, 695–700. [Google Scholar] [CrossRef] [PubMed]
  29. Ruyter-Spira, C.; Al-Babili, S.; van der Krol, S.; Bouwmeester, H. The Biology of Strigolactones. Trends Plant Sci. 2013, 18, 72–83. [Google Scholar] [CrossRef] [PubMed]
  30. Yuan, K.; Zhang, H.; Yu, C.; Luo, N.; Yan, J.; Zheng, S.; Hu, Q.; Zhang, D.; Kou, L.; Meng, X.; et al. Low Phosphorus Promotes NSP1–NSP2 Heterodimerization to Enhance Strigolactone Biosynthesis and Regulate Shoot and Root Architecture in Rice. Mol. Plant 2023, 16, 1811–1831. [Google Scholar] [CrossRef]
  31. Duriez, P.; Vautrin, S.; Auriac, M.-C.; Bazerque, J.; Boniface, M.-C.; Callot, C.; Carrère, S.; Cauet, S.; Chabaud, M.; Gentou, F.; et al. A Receptor-like Kinase Enhances Sunflower Resistance to Orobanche Cumana. Nat. Plants 2019, 5, 1211–1215. [Google Scholar] [CrossRef] [PubMed]
  32. Pruitt, R.N.; Joe, A.; Zhang, W.; Feng, W.; Stewart, V.; Schwessinger, B.; Dinneny, J.R.; Ronald, P.C. A Microbially Derived Tyrosine-Sulfated Peptide Mimics a Plant Peptide Hormone. New Phytol. 2017, 215, 725–736. [Google Scholar] [CrossRef] [PubMed]
  33. Fernández-Aparicio, M.; del Moral, L.; Muños, S.; Velasco, L.; Pérez-Vich, B. Genetic and Physiological Characterization of Sunflower Resistance Provided by the Wild-Derived OrDeb2 Gene against Highly Virulent Races of Orobanche Cumana Wallr. Theor. Appl. Genet. 2022, 135, 501–525. [Google Scholar] [CrossRef] [PubMed]
  34. Louarn, J.; Boniface, M.-C.; Pouilly, N.; Velasco, L.; Pérez-Vich, B.; Vincourt, P.; Muños, S. Sunflower Resistance to Broomrape (Orobanche cumana) Is Controlled by Specific QTLs for Different Parasitism Stages. Front. Plant Sci. 2016, 7, 590. [Google Scholar] [CrossRef]
  35. Radwan, O.; Gandhi, S.; Heesacker, A.; Whitaker, B.; Taylor, C.; Plocik, A.; Kesseli, R.; Kozik, A.; Michelmore, R.W.; Knapp, S.J. Genetic Diversity and Genomic Distribution of Homologs Encoding NBS-LRR Disease Resistance Proteins in Sunflower. Mol. Genet. Genom. 2008, 280, 111–125. [Google Scholar] [CrossRef] [PubMed]
Agronomy 15 00129 g001
Figure 1. Phylogenetic tree of NSP1/2 proteins from sunflower (HaNSP) (highlighted in green), Arabidopsis (AtNSP), M. truncatula (MtNSP), and rice (OsNSP) plants. Bootstrap values are indicated at each node. The AtSCL32 protein was used as an outgroup.
Figure 1. Phylogenetic tree of NSP1/2 proteins from sunflower (HaNSP) (highlighted in green), Arabidopsis (AtNSP), M. truncatula (MtNSP), and rice (OsNSP) plants. Bootstrap values are indicated at each node. The AtSCL32 protein was used as an outgroup.
Agronomy 15 00129 g001
Agronomy 15 00129 g002
Figure 2. Expression (transcripts per kilobase million) of the HaNSP1/2-like genes in sunflower roots before infection (“roots”), five days after O. cumana infection (“with O. cumana”), and in control roots not infected with O. cumana infection on the 5th day of the experiment (“without O. cumana”). Raw reads were obtained from the NCBI PRJNA706194 project [26]. TPM (transcript per million) values are shown. Two-way ANOVA and Tukey’s multiple comparisons tests were used to test for the statistical differences between TPM values. Different letters indicate statistically significant differences (p ≤ 0.05).
Figure 2. Expression (transcripts per kilobase million) of the HaNSP1/2-like genes in sunflower roots before infection (“roots”), five days after O. cumana infection (“with O. cumana”), and in control roots not infected with O. cumana infection on the 5th day of the experiment (“without O. cumana”). Raw reads were obtained from the NCBI PRJNA706194 project [26]. TPM (transcript per million) values are shown. Two-way ANOVA and Tukey’s multiple comparisons tests were used to test for the statistical differences between TPM values. Different letters indicate statistically significant differences (p ≤ 0.05).
Agronomy 15 00129 g002
Agronomy 15 00129 g003
Figure 3. Composite sunflower plants obtained after A. rhizogenes-mediated transformation with the pKSEe401R-HaNSP1a construct. (A) General view of representative composite plants; (B,C) Transgenic roots demonstrating DsRed fluorescence. Transgenic roots demonstrating DsRed fluorescence are marked with red arrows, whereas non-transgenic roots exhibiting faint autofluorescence signal in the red spectrum are shown with white arrows.
Figure 3. Composite sunflower plants obtained after A. rhizogenes-mediated transformation with the pKSEe401R-HaNSP1a construct. (A) General view of representative composite plants; (B,C) Transgenic roots demonstrating DsRed fluorescence. Transgenic roots demonstrating DsRed fluorescence are marked with red arrows, whereas non-transgenic roots exhibiting faint autofluorescence signal in the red spectrum are shown with white arrows.
Agronomy 15 00129 g003
Agronomy 15 00129 g004
Figure 4. Examples of DNA sequences of the HaNSP1a gene fragment after CRISPR-Cas9-mediated editing identified by the Synthego ICE program based on sequencing chromatograms of PCR products. (A) DNA sequences from sunflower root with native HaNSP1a gene (wildtype); no mutation in HaNSP1a gene is observed: 100% DNA sequences in the sample correspond to native HaNSP1a gene; (B) DNA sequences of sunflower root with knock-out of the HaNSP1a gene due to 1 bp insertion located 3 bp upstream of the PAM sequence: 95% DNA sequences in the sample were found to have a 1 bp insertion in the HaNSP1a gene, which should lead to a frameshift mutation and loss of HaNSP1a gene function. This sample is, presumably, a homozygote with two mutated HaNSP1a gene alleles; (C) DNA sequences of the sunflower root with knock-out of the HaNSP1a gene, which lacks native (wildtype) HaNSP1a gene sequences. Overall, 54% of DNA sequences have 8-bp deletion located 3 bp upstream of the PAM sequence, whereas 37% of DNA sequences have 1 bp insertion located 3 bp upstream of the PAM sequence. This sample is, presumably, a heterozygote with two distinct mutated HaNSP1a gene alleles. Such changes should lead to the knock-out of the HaNSP1a gene. (D,E) DNA sequences of the sunflower gene from the root samples with partial knock-out of the HaNSP1a gene, which have 57% and 66% native HaNSP1a sequences, correspondingly. Samples with several alleles of the HaNSP1a gene, apparently, were obtained from chimeric transgenic roots including cells with different editing events. The PAM sequence is in a red box. The cut site located 3 bp upstream of the PAM is shown with a dotted line. For each sample, R2-values are shown, indicating how well the indel distribution proposed by ICE fits the Sanger sequence data of the edited sample. In nucleotides sequences, each color represents a different nucleotide (A, T, C or G).
Figure 4. Examples of DNA sequences of the HaNSP1a gene fragment after CRISPR-Cas9-mediated editing identified by the Synthego ICE program based on sequencing chromatograms of PCR products. (A) DNA sequences from sunflower root with native HaNSP1a gene (wildtype); no mutation in HaNSP1a gene is observed: 100% DNA sequences in the sample correspond to native HaNSP1a gene; (B) DNA sequences of sunflower root with knock-out of the HaNSP1a gene due to 1 bp insertion located 3 bp upstream of the PAM sequence: 95% DNA sequences in the sample were found to have a 1 bp insertion in the HaNSP1a gene, which should lead to a frameshift mutation and loss of HaNSP1a gene function. This sample is, presumably, a homozygote with two mutated HaNSP1a gene alleles; (C) DNA sequences of the sunflower root with knock-out of the HaNSP1a gene, which lacks native (wildtype) HaNSP1a gene sequences. Overall, 54% of DNA sequences have 8-bp deletion located 3 bp upstream of the PAM sequence, whereas 37% of DNA sequences have 1 bp insertion located 3 bp upstream of the PAM sequence. This sample is, presumably, a heterozygote with two distinct mutated HaNSP1a gene alleles. Such changes should lead to the knock-out of the HaNSP1a gene. (D,E) DNA sequences of the sunflower gene from the root samples with partial knock-out of the HaNSP1a gene, which have 57% and 66% native HaNSP1a sequences, correspondingly. Samples with several alleles of the HaNSP1a gene, apparently, were obtained from chimeric transgenic roots including cells with different editing events. The PAM sequence is in a red box. The cut site located 3 bp upstream of the PAM is shown with a dotted line. For each sample, R2-values are shown, indicating how well the indel distribution proposed by ICE fits the Sanger sequence data of the edited sample. In nucleotides sequences, each color represents a different nucleotide (A, T, C or G).
Agronomy 15 00129 g004
Agronomy 15 00129 g005
Figure 5. HPLC-IT-TOF/MS analysis of the root extracts of wildtype sunflower roots (A), roots with PKO of the HaNSP1a gene (B), and roots with KO of the HaNSP1a gene (C). The presented HPLC-MS chromatograms were obtained for bulk root extracts from each group (wt, PKO, KO), which were also analyzed separately by HPLC-MS. In total, 5 biological samples were analyzed per each experimental group (wt, PKO, KO).
Figure 5. HPLC-IT-TOF/MS analysis of the root extracts of wildtype sunflower roots (A), roots with PKO of the HaNSP1a gene (B), and roots with KO of the HaNSP1a gene (C). The presented HPLC-MS chromatograms were obtained for bulk root extracts from each group (wt, PKO, KO), which were also analyzed separately by HPLC-MS. In total, 5 biological samples were analyzed per each experimental group (wt, PKO, KO).
Agronomy 15 00129 g005
Agronomy 15 00129 g006
Figure 6. Quantitative analysis of HPLC-IT-TOF/MS data for root extracts of wildtype sunflower roots (wt), roots with partial knock-out (PKO), and knock-out (KO) of the HaNSP1a gene. Signal intensities for orobanchol correspond to a peak with RT = 8.70 min, and the 5-deoxystrigol signal corresponds to a peak with RT = 11.80 min, as shown in Figure 5. In total, 5 biological samples were analyzed per each experimental group (wt, PKO, KO). Asterisks mark statistically significant differences revealed by comparison of the values from wildtype samples (wt) to the values obtained for PKO or KO roots, using Student’s t-test (**, p < 0.01; ***, p < 0.001).
Figure 6. Quantitative analysis of HPLC-IT-TOF/MS data for root extracts of wildtype sunflower roots (wt), roots with partial knock-out (PKO), and knock-out (KO) of the HaNSP1a gene. Signal intensities for orobanchol correspond to a peak with RT = 8.70 min, and the 5-deoxystrigol signal corresponds to a peak with RT = 11.80 min, as shown in Figure 5. In total, 5 biological samples were analyzed per each experimental group (wt, PKO, KO). Asterisks mark statistically significant differences revealed by comparison of the values from wildtype samples (wt) to the values obtained for PKO or KO roots, using Student’s t-test (**, p < 0.01; ***, p < 0.001).
Agronomy 15 00129 g006
Agronomy 15 00129 g007
Figure 7. Proposed model of HaNSP1 action in the control of SL biosynthesis in sunflower roots.
Figure 7. Proposed model of HaNSP1 action in the control of SL biosynthesis in sunflower roots.
Agronomy 15 00129 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lebedeva, M.A.; Gancheva, M.S.; Losev, M.R.; Sokornova, S.V.; Yuzikhin, O.S.; Krutikova, A.A.; Plemyashov, K.V.; Lutova, L.A. CRISPR/Cas9-Mediated Editing of a NODULATION SIGNALING PATHWAY 1 Homolog Alters the Production of Strigolactones in Sunflower Roots. Agronomy 2025, 15, 129. https://doi.org/10.3390/agronomy15010129

AMA Style

Lebedeva MA, Gancheva MS, Losev MR, Sokornova SV, Yuzikhin OS, Krutikova AA, Plemyashov KV, Lutova LA. CRISPR/Cas9-Mediated Editing of a NODULATION SIGNALING PATHWAY 1 Homolog Alters the Production of Strigolactones in Sunflower Roots. Agronomy. 2025; 15(1):129. https://doi.org/10.3390/agronomy15010129

Chicago/Turabian Style

Lebedeva, Maria A., Maria S. Gancheva, Maksim R. Losev, Sofia V. Sokornova, Oleg S. Yuzikhin, Anna A. Krutikova, Kirill V. Plemyashov, and Lyudmila A. Lutova. 2025. "CRISPR/Cas9-Mediated Editing of a NODULATION SIGNALING PATHWAY 1 Homolog Alters the Production of Strigolactones in Sunflower Roots" Agronomy 15, no. 1: 129. https://doi.org/10.3390/agronomy15010129

APA Style

Lebedeva, M. A., Gancheva, M. S., Losev, M. R., Sokornova, S. V., Yuzikhin, O. S., Krutikova, A. A., Plemyashov, K. V., & Lutova, L. A. (2025). CRISPR/Cas9-Mediated Editing of a NODULATION SIGNALING PATHWAY 1 Homolog Alters the Production of Strigolactones in Sunflower Roots. Agronomy, 15(1), 129. https://doi.org/10.3390/agronomy15010129

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop