The Physiological Mechanism of Exogenous Melatonin Regulating Salt Tolerance in Eggplant Seedlings

Abstract

There is little study on melatonin’s ability to prevent salt damage in eggplants, despite the fact that it is a strong antioxidant in plants that has been found to help mitigate a variety of adverse challenges. In this study, we used “Anhui Eggplant No.8” as the test material and simulated salt stress by irrigating the roots with 150 mmol·L NaCl solution. Subsequently, we treated the eggplants with different concentrations of exogenous melatonin (0, 50, 100, 150, 200, 250 μmol·L) and assessed the plant traits and an array of physiological and biochemical indices following melatonin application to observe the impact of salt stress. Our study results indicate that exogenous melatonin at a concentration of 200 μmol·L can significantly alleviate the inhibition of eggplant photosynthesis under salt stress by increasing the content of chlorophyll in leaves and the activity of antioxidant enzymes. This leads to a notable increase in the levels of non-enzyme antioxidants and osmotic regulatory substances. As a result, the antioxidant capacity of the eggplants is enhanced, the degree of membrane lipid peroxidation is reduced, and the growth of eggplant seedlings under salt stress is effectively promoted, thereby strengthening the salt tolerance of eggplant seedlings. Fluorescence quantitative data analysis indicates that SmCAT4 is indeed a gene that positively regulates salt stress. However, in the SmPPO family, we did not find any genes that respond to salt stress. This research provides a theoretical foundation for improving the yield productivity and quality of eggplants under protected farming by clarifying the physiological mechanism by which melatonin controls the salt tolerance of eggplant seedlings.

1. Introduction

Soil salinization is one of the significant challenges faced by global agriculture, severely limiting land usage and adversely affecting stable crop production and income [1]. In recent years, with the continuous development of the socio-economy and the improvement of the technological level, China’s greenhouse agriculture has developed rapidly, with the area of greenhouse cultivation increasing annually and becoming an important part of modern Chinese agriculture [2,3]. However, greenhouse agriculture, due to its unique environmental characteristics, unreasonable farming and fertilization and irrigation practices, and the monoculture and continuous cropping, leads to an unbalanced soil micro-ecological environment, imbalanced soil pH and nutrients, and excessive salt accumulation, resulting in severe secondary salinization of greenhouse soil, which greatly limits the efficient utilization of Chinese greenhouse agriculture [4,5,6,7]. The occurrence of soil salinization hinders the effective absorption of water and nutrients by crop roots, slows down the growth rate of crops, disrupts the related physiological mechanisms of photosynthesis and respiration, and severely affects the growth and development of crops [8,9,10].

Eggplant (Solanum melongena L.) originated from the tropical regions of Southeast Asia and is a tropical annual herb [11]. As the fifth largest cash crop within the Solanaceae family, it is globally cultivated for its rich nutritional value and is favored by consumers [12]. Currently, it has become one of the most extensively cultivated eggplant and fruit vegetables under greenhouse conditions in China [13,14]. Eggplant, an essential component of greenhouse vegetables, is influenced by salinity and progresses through all stages, from seedling to maturity. Salinity can lead to symptoms such as yellowing and necrosis of eggplant leaves, severely affecting the normal functioning of photosynthesis [15]. Moreover, high salinity conditions limit the water absorption by eggplant roots, causing physiological drought and impeding the normal physiological metabolic activities of the plant, thus significantly impacting yield and quality [16]. Therefore, enhancing the salt tolerance of eggplant is an urgent issue that requires resolution [17,18].

When plants are subjected to salt damage, they can mitigate the injury caused by salt stress by regulating ion influx and segregation to maintain intracellular ion homeostasis, increasing the levels of osmotic regulators and antioxidants, activating endogenous hormones, and upregulating specific genes and transcription factors in response to salt stress [19,20]. However, plants’ inherent regulatory capacity is still limited, necessitating the enhancement of their salt tolerance through alternative means. The application of exogenous hormones, such as ethylene, abscisic acid, jasmonic acid methyl ester, and oleoresinolactone, has been shown to effectively address this issue [21]. Melatonin (N-acetyl-5-methoxytryptamine, melatonin, MT), a novel plant growth regulator and an important class of indole analogs structurally and functionally akin to indole-3-acetic acid (IAA) [22], plays a vital role in various physiological functions of plants, including modulating root morphology and structure, regulating plant seed germination, flowering, leaf senescence, and fruit development. Furthermore, as potent antioxidants in plants, phytomelatonin and its precursors and metabolites alleviate adversity stress-induced damage through direct (scavenging reactive oxygen species and chelating heavy metals) and indirect (activating the plant antioxidant system, enhancing antioxidant enzyme activities, mitigating photosynthesis inhibition, and regulating phytohormone functions, among others) mechanisms [23,24,25,26]. External melatonin has been found to mitigate the adverse effects of various stresses, such as temperature extremes, drought, heavy metals, and flooding [27,28,29,30]. Additionally, there has been extensive research on the role of melatonin in enhancing salt resistance, with external melatonin spraying shown to significantly improve salt tolerance in crops such as wheat, tomatoes, and cucumbers [31,32,33]. However, there is a relative lack of systematic studies on the use of exogenous melatonin spraying to enhance salt tolerance in eggplant.

To screen for the appropriate melatonin concentration for alleviating salt stress in eggplants and to explore the physiological mechanisms by which exogenous melatonin enhances the salt tolerance of eggplant seedlings, this study used “Anhui Eggplant No.8” as the test material. By analyzing the biomass, the content of osmotic regulatory substances, antioxidant enzyme activities, and other indicators between different treatments, and using qRT-PCR to verify the key genes responsive to salt stress, a systematic study was conducted. The aim was to provide a theoretical basis for improving the yield and quality of greenhouse eggplants.

2. Materials and Methods

2.1. Test Materials

The experiment was conducted at the Vegetable Research Institute of Anhui Academy of Agricultural Sciences in Hefei, Anhui, China, in September 2023. The eggplant variety used in the experiment was “Anhui Eggplant No. 8”, which is the primary cultivar cultivated in Anhui Province and its neighboring areas. This variety was selected and bred by the Vegetable Research Institute of Anhui Academy of Agricultural Sciences. The melatonin used was sourced from Shanghai Aladdin Biochemical Technology Co., Ltd. (Shanghai, China) The melatonin (chemical formula: C₁₂H₁₆N₂O₂) purchased from this supplier has a relative molecular mass of 232.28 and a purity level exceeding 98%. NaCl was purchased from biosharp Biotechnology Co., Ltd. (Hefei, China) with a relative molecular mass of 58.44 and a purity of >99.5%.

2.2. Experimental Design

“Anhui Eggplant No. 8” seeds were disinfected and germinated after soaking and then sown in a fifty-hole seedling tray and placed in a controlled multi-span greenhouse (the greenhouse has a photoperiod of 15 h, a temperature of 27 ± 2 °C, and a humidity of 65% ± 5%) for routine management. When the seedlings grew to three leaves and one heart, healthy eggplant seedlings with consistent growth were transplanted into 10 cm × 12 cm plastic nutritional pots for continued routine management. When the seedlings grew to four leaves and one heart, the plants were divided into two groups and subjected to salt stress treatment (based on the results of the preliminary experiment and the experience of previous studies, to avoid excessive salt solution concentration harming the eggplant seedlings, on the first day of salt stress treatment, root irrigation was performed with 60 mL of 120 mmol·L NaCl solution; thereafter, on the 3rd, 5th, and 7th days, each plant was root irrigated with 60 mL of 150 mmol·L NaCl solution, resulting in a soil salt concentration of 150 mmol·L after four salt treatments). After salt treatment, external MT was applied to the two groups at the following concentrations: 0 (M1), 50 (M2), 100 (M3), 150 (M4), 200 (M5), and 250 (M6) μmol·L (the preparation method of melatonin solution involves dissolving melatonin in ethanol and adding 0.01% v/v Tween-20 as a surfactant to prepare the stock solution, which is then diluted as needed. The experiment used a complete random block design; the non-saline control group (CK) was treated with distilled water, and the salt-stressed groups were treated with different concentrations of external MT. The treatment was applied twice a day for three consecutive days, with a spray volume of 150 mL per treatment, ten plants per treatment, and three replicates per treatment). After the melatonin treatment, samples were taken and related indicators were measured on the 1st, 3rd, and 5th days post-treatment (for sampling, the fourth leaf of the plant was chosen and placed in a 50 mL centrifuge tube with liquid nitrogen for temporary storage, and then the samples were placed in a −80 °C refrigerator for future use).

2.3. Measurement of Growth Indicators

In the morning of the first, third, and fifth days after melatonin treatment, the height, width, leaf length, leaf width, and root length of three plantlets from each treatment group were accurately measured using a caliper. Additionally, the stem diameter was measured with a micrometer. For each treatment, three plants are randomly selected, and three replicates are set. In total, nine plants are measured to ensure the accuracy of the data. After measurement, the plantlets were carefully rinsed with deionized water to remove any residues and allowed to air dry. Subsequently, the fresh weights of the aboveground parts and roots were determined using an electronic balance. The plantlets were then placed in a constant temperature oven and dried at 105 °C for 30 min to kill any remaining green tissue. Afterward, the drying process was continued at 80 °C, and the dry weights of the aboveground parts and roots were recalculated [34].

2.4. Measurement of Photosynthetic Indicators

Determination of Chlorophyll Content. In the morning of the first, third, and fifth days after melatonin treatment, three eggplant seedlings were randomly selected from each treatment group using a SPAD-520 (Zhejiang Top Instrument Co., Hangzhou, China) handheld chlorophyll meter to measure the chlorophyll content in the middle of the fourth leaf, with three replications set up for each measurement [35]. Measurement of Photosynthetic Parameters. Measurements were conducted with an LI-6800 photosynthesizer (LI-COR, Lincoln, NE, USA) between 9:00 and 11:00 on the 1st, 3rd, and 5th days after melatonin treatment (light intensity set at 500 µmol·m⁻²·s⁻¹, relative humidity 50%, temperature 22 °C). The net photosynthetic rate (Pn), transpiration rate (Tr), stomatal conductance (Gs), and intercellular carbon dioxide concentration (Ci) of the fourth leaf of seedlings from each treatment were determined under natural light. Three plants were randomly selected for each treatment, and three replications were established for each measurement [36].

2.5. Measurement of Physiological Indicators

The measurement of soluble proteins in eggplant plants was conducted using the BCA protein content assay kit (Solarbio, Beijing, China) following the manufacturer’s instructions. The oxygen free radical (O²⁻), hydrogen peroxide (H₂O₂), malondialdehyde (MDA), superoxide dismutase (SOD), polyphenol oxidase (PPO), peroxidase (POD), and catalase (CAT) kits were purchased from Solarbio (Beijing, China). Extraction and determination were performed in accordance with the manufacturer’s instructions. Briefly, each sample of fresh leaves (around 0.1 g) was supplemented with 1 mL of extraction solution and ground into a homogenate in an ice bath. After centrifugation at 8000× g for 20 min at 4 °C, the supernatant was collected and stored at 4 °C for activity analysis. The histochemical analysis of O²⁻ and H₂O₂ was performed using nitroblue tetrazolium (NBT) and 3,3-diaminobenzidine (DAB), respectively [37,38]. For the measurement of proline (Pro) content, tissues were first homogenized in an ice bath at the same 1:5 ratio. The homogenate was then subjected to a water bath at 95 °C with shaking for 10 min, followed by centrifugation at 10,000× g for 10 min at 25 °C. The supernatant was collected, cooled, and prepared for analysis using the proline content assay kit, following the instructions provided. To determine soluble sugars, a sample weighing 0.1 to 0.2 g was ground with 1 mL of distilled water to create a homogenate, which was transferred to a capped centrifuge tube and incubated in a 95 °C water bath for 10 min (ensuring the lid was tight to prevent moisture loss). After cooling, the mixture was centrifuged at 8000× g for 10 min at 25 °C, and the supernatant was transferred to a 10 mL test tube and was then diluted to 10 mL with distilled water and mixed thoroughly. The soluble sugar content was subsequently measured using the plant soluble sugar content assay kit (Solarbio, Beijing, China), following the indicated protocol. To determine ASA content, 0.5 g of the leaf sample was homogenized in 5.0 mL of an ice-cold 50 mM phosphate buffer (pH 7.0). The homogenate was centrifuged at 8000× g for 10 min at 4 °C, and the supernatant was used as a sample for further analysis. The ASA content was then determined using the Plant ASA Content Assay Kit (Solarbio, Beijing, China) as indicated. All samples from different stages were tested in triplicate to minimize errors [39,40].

2.6. RNA Extraction and Reverse Transcription of cDNA with qRT-PCR Gene Expression

Prior to mRNA extraction, samples were manually ground in liquid nitrogen using a mortar and pestle. Total RNA was extracted using the TIANGEN RNAprep pure kit (Tiangen, Beijing, China) according to the manufacturer’s instructions. Proteins and cellular debris were removed using the buffer solution provided in the kit, DNA removal was performed with DNAse, and finally, a purification column was used to obtain a high-quality total RNA. The easyScript One-Step gDNA Removal and cDNA Synthesis SuperMix kit (TransGen Biotech, Beijing, China) was used for reverse transcription. Nucleic acids were quantified using an ultra-micro-nucleic acid protein spectrophotometer (Mona, Suzhou, China).

All RT-qPCR primers were designed using Beacon Designer 7 software, and primer sequences are shown in Table S1. The qRT-PCR system consisted of 10 μL SYBR^® Premix Ex TaqTM II (2×), 6.4 μL water, 0.8 μL upstream and downstream primers, and 2 μL cDNA (20 μL total). The RT-qPCR program was as follows: 95 °C, 10 min and 40 cycles of 95 °C, 10 s; 55–65 °C, 10 s; and 72 °C, 30 s. RT-qPCR was performed with a CFX96 TouchTM Real-Time PCR Detection System (BIO-RAD, Hercules, CA, USA), with three biological replicates for each sample. Primer sequences are shown in

Table 1. The primer pair sequences used in this study.

Primer Name	Forward Primer Sequences (5′ to 3′)	Reverse Primer Sequences (5′ to 3′)
SmCAT1	TTACTATTCGGAGGATAAG	GATGATTGTTGTGATGAG
SmCAT2	TTCTCCTACTCTGATACC	ATAGTGATTGTTGTGATGA
SmCAT3	CAGGAGAGCATTACAGAT	TCGGATAGAGCATCAATC
SmCAT4	CACTTAGCACCTTCCAGCAGATGT	TCTCTATTAAATGATAATCCTC
SmPPO1	TTATTGTGATGGTGCTTATGAC	AACGATGGAACGGAAGAA
SmPPO2	CTTCTTCTTCTACTACTACTCTA	TTGGCTACGACTTCTATG
SmPPO3	TCTCAACTATTCCTCCAT	TTAGCAACACCATACATC
SmPPO4	TGAATGTGGACAGTAATG	GTGGCAGATTAGTATAGC
SmPPO5	ATGTATGGTGCTGCTAAT	TTCGGTAATCTTGGCTATA
SmPPO6	CTTCTTCTGCTACTCTACC	TTGGCTACGACTTCTATG
SmPPO7	CTGTTGATAGGAGGAATGT	GATGCCGCTAATGGTATA
SmPPO8	TTCTCAGTCACCATCCAA	GACATTACGCCTATCAAGTT
SmPPO9	AATGGATTGGCAGATGATGA	TTGGATGGAGAGCAGTTG
SmPPO10	CTGTTGATAGGAGGAATGT	GATGCCGCTAATGGTATA
SmPPO11	TGGCGATAATAATACTCA	ATTCTCAATGGATATACCT
SmPPO12	GCTTCGTCAAGGACTCAA	ACTGGCTATCATCGTATTGTAT
SmActin	CACTTAGCACCTTCCAGCAGATGT	GTACAACAGCAGACCTGAGTTCACT

. SmActin (Smechr1100649) was regarded as the reference gene to normalize the target gene expression. The relative gene expression levels were calculated using the 2^−∆∆CT method [41].

2.7. Data Processing

The experimental data were analyzed by one-way ANOVA using SPSS 25.0 software, multiple comparisons were performed using Duncan’s method (p < 0.05), and graphs were created using GraphPad Prism 8.0.2 software.

3. Results

3.1. Effect of Exogenous MT on the Growth of Eggplant Seedlings Under Salt Stress

In

Table 2. Growth indices after 1 day of exogenous melatonin treatment.

Growth Indexes After 1 Day of Melatonin Treatment
Treatment	Plant Height	Stem Width	Stem Girth	Leaf Length	Blade Width	Root Length	Aboveground Part Fresh Weight	Aboveground Dry Weight	Underground Fresh Weigh	Underground Dry Weight
	cm	cm	mm	cm	cm	cm	g	g	g	g
CK	13.27 ± 0.85 a	37.33 ± 1.56 a	5.08 ± 0.55 a	15.6 ± 0.44 a	10.93 ± 0.55 a	27.6 ± 2.39 a	15.53 ± 0.98 a	1.86 ± 0.63 a	3.94 ± 0.53 a	0.46 ± 0.12 a
M1	9.1 ± 0.4 d	20.63 ± 2.01 d	3.16 ± 0.13 d	9.70 ± 0.40 c	7.43 ± 0.67 d	14.50 ± 2.11 d	5.02 ± 0.34 e	0.48 ± 0.06 b	1.50 ± 0.41 d	0.12 ± 0.03 c
M2	10.53 ± 1.14 c	21.73 ± 1.72 cd	3.42 ± 0.29 cd	10.13 ± 0.67 bc	7.63 ± 0.21 d	15.67 ± 1.66 cd	5.20 ± 0.18 de	0.53 ± 0.05 b	1.83 ± 0.29 cd	0.15 ± 0.03 bc
M3	11.63 ± 0.81 bc	23.30 ± 2.45 bcd	3.48 ± 0.23 cd	10.53 ± 1.26 bc	8.23 ± 0.15 cd	18.17 ± 1.38 c	5.63 ± 0.30 cde	0.60 ± 0.02 b	2.13 ± 0.13 c	0.16 ± 0.03 bc
M4	11.80 ± 0.60 bc	23.93 ± 1.27 bc	3.98 ± 0.23 bc	10.87 ± 0.47 bc	9.20 ± 0.46 b	23.03 ± 1.36 b	6.17 ± 0.36 de	0.65 ± 0.10 b	2.21 ± 0.21 c	0.19 ± 0.02 bc
M5	12.23 ± 0.64 ab	24.70 ± 1.28 b	4.11 ± 0.37 b	11.23 ± 1.06 b	9.93 ± 0.81 b	24.63 ± 1.10 ab	7.5 ± 0.50 b	0.82 ± 0.06 b	2.83 ± 0.35 b	0.22 ± 0.04 b
M6	11.73 ± 0.42 bc	23.90 ± 0.26 bc	3.96 ± 0.25 bc	10.80 ± 0.96 bc	9.17 ± 0.67 bc	22.47 ± 2.66 b	6.0 ± 0.08 cd	0.64 ± 0.04 b	2.17 ± 0.15 c	0.18 ± 0.02 bc

Note: In the table, CK represents the control, and M1-M6 represent treatments with 0 (M1), 50 (M2), 100 (M3), 150 (M4), 200 (M5), and 250 (M6) μmol·L of melatonin, respectively, after stress with 150 mmol·L NaCl solution. Data in this table are the mean ± standard error of at least three replicates. According to Duncan’s multiple range tests, different lowercase letters indicate significant differences at the five percent significance level within each column.

,

Table 3. Growth indices after 3 days of exogenous melatonin treatment.

Growth Indexes After 3 Days of Melatonin Treatment
Treatment	Plant Height	Stem Width	Stem Girth	Leaf Length	Blade Width	Root Length	Aboveground Part Fresh Weight	Aboveground Dry Weight	Underground Fresh Weigh	Underground Dry Weight
	cm	cm	mm	cm	cm	cm	g	g	g	g
CK	14.20 ± 0.26 a	37.43 ± 0.78 a	5.21 ± 0.18 a	16.07 ± 0.99 a	11.30 ± 0.70 a	34.5 ± 2.86 a	16.17 ± 0.52 a	1.69 ± 0.11 a	5.67 ± 0.61 a	0.48 ± 0.05 a
M1	9.83 ± 1.35 d	22.23 ± 3.02 d	3.16 ± 0.08 d	10.10 ± 1.20 d	7.77 ± 0.45 d	18.83 ± 3.42 d	5.2 ± 0.65 f	0.46 ± 0.10 e	2.17 ± 0.33 e	0.16 ± 0.01 e
M2	11.20 ± 0.53 cd	24.50 ± 1.15 cd	3.92 ± 0.44 c	10.90 ± 0.78 cd	8.07 ± 0.59 cd	21.13 ± 2.89 cd	6.00 ± 0.21 e	0.55 ± 0.08 de	2.67 ± 0.61 de	0.20 ± 0.04 de
M3	12.00 ± 0.72 bc	25.37 ± 1.68 bcd	4.18 ± 0.51 bc	11.90 ± 2.09 bcd	8.80 ± 0.70 bcd	22.67 ± 1.43 cd	6.83 ± 0.45 d	0.71 ± 0.03 cd	3.33 ± 0.31 cd	0.25 ± 0.03 cd
M4	13.07 ± 1.63 ab	27.00 ± 0.70 bc	4.32 ± 0.19 bc	12.20 ± 1.18 bc	9.27 ± 0.75 b	25.17 ± 2.12 bc	8.05 ± 0.44 c	0.88 ± 0.10 c	3.85 ± 0.17 bc	0.27 ± 0.02 c
M5	13.77 ± 1.10 ab	28.47 ± 3.10 b	4.67 ± 0.19 b	13.07 ± 0.71 b	9.70 ± 0.80 b	28.77 ± 2.47 b	9.83 ± 0.30 b	1.18 ± 0.16 b	4.57 ± 0.55 b	0.41 ± 0.02 b
M6	12.27 ± 1.10 bc	26.87 ± 1.16 bc	4.26 ± 0.26 bc	12.17 ± 0.83 bcd	9.23 ± 0.70 bc	24.83 ± 1.95 bc	7.97 ± 0.40 c	0.87 ± 0.15 c	3.83 ± 0.46 bc	0.27 ± 0.04 c

Note: In the table, CK represents the control, and M1-M6 represent treatments with 0 (M1), 50 (M2), 100 (M3), 150 (M4), 200 (M5), and 250 (M6) μmol·L of melatonin, respectively, after stress with 150 mmol·L NaCl solution. Data in this table are the mean ± standard error of at least three replicates. According to Duncan’s multiple range tests, different lowercase letters indicate significant differences at the five percent significance level within each column.

and

Table 4. Growth indices after 5 days of exogenous melatonin treatment.

Growth Indexes After 5 Days of Melatonin Treatment
Treatment	Plant Height	Stem Width	Stem Girth	Leaf Length	Blade Width	Root Length	Aboveground Part Fresh Weight	Aboveground Dry Weight	Underground Fresh Weigh	Underground Dry Weight
	cm	cm	mm	cm	cm	cm	g	g	g	g
CK	17.30 ± 1.24 a	36.63 ± 1.11 a	5.43 ± 0.47 a	16.17 ± 0.35 a	11.80 ± 0.46 a	38.03 ± 1.55 a	19.33 ± 0.76 a	2.18 ± 0.21 a	6.16 ± 0.26 a	0.60 ± 0.03 a
M1	11.70 ± 0.37 e	25.03 ± 0.24 f	4.02 ± 0.43 d	10.60 ± 0.70 d	8.60 ± 0.30 c	20.87 ± 2.42 e	8.63 ± 1.67 e	0.90 ± 0.07 e	3.32 ± 0.48 d	0.29 ± 0.06 e
M2	12.67 ± 0.49 d	27.20 ± 0.54 e	4.28 ± 0.19 cd	11.13 ± 0.21 d	8.77 ± 0.15 c	24.67 ± 2.54 de	9.83 ± 1.53 de	1.02 ± 0.14 de	3.96 ± 1.01 cd	0.30 ± 0.04 de
M3	13.27 ± 0.33 cd	27.67 ± 0.66 de	4.52 ± 0.20 bcd	11.77 ± 1.38 cd	9.17 ± 1.00 c	26.10 ± 2.80 cd	10.83 ± 0.76 cde	1.22 ± 0.13 cd	4.24 ± 0.32 c	0.34 ± 0.03 de
M4	13.53 ± 0.17 bc	28.53 ± 0.53 cd	4.60 ± 0.20 bc	12.57 ± 0.65 bc	9.40 ± 0.79 bc	28.23 ± 1.79 cd	11.67 ± 1.26 cd	1.31 ± 0.15 c	4.37 ± 0.18 c	0.36 ± 0.02 cd
M5	14.33 ± 0.39 b	31.10 ± 1.59 b	4.91 ± 0.27 b	13.33 ± 0.47 b	10.27 ± 0.71 b	33.40 ± 2.52 b	14.50 ± 1.32 b	1.66 ± 0.19 b	5.24 ± 0.11 b	0.49 ± 0.04 b
M6	13.63 ± 0.12 bc	29.27 ± 0.70 c	4.67 ± 0.09 bc	12.60 ± 0.56 bc	9.60 ± 0.26 bc	28.87 ± 1.45 c	12.33 ± 1.76 bc	1.34 ± 0.04 c	4.39 ± 0.14 c	0.40 ± 0.03 c

Note: In the table, CK represents the control, and M1-M6 represent treatments with 0 (M1), 50 (M2), 100 (M3), 150 (M4), 200 (M5), and 250 (M6) μmol·L of melatonin, respectively, after stress with 150 mmol·L NaCl solution. Data in this table are the mean ± standard error of at least three replicates. According to Duncan’s multiple range tests, different lowercase letters indicate significant differences at the five percent significance level within each column.

and Figure 1, it is evident that all treatment groups exhibited significantly reduced growth indices compared to the CK of the same period. Among them, the M1 treatment showed the lowest growth indices, with a plant height that decreased by 31.42%, 30.77%, and 32.37% compared to the CK of the same period; root length decreased by 53.51%, 45.42%, and 45.12%; aboveground fresh weight decreased by 67.87%, 67.84%, and 55.12%; and underground fresh weight decreased by 61.93%, 61.72%, and 46.1%, respectively. The remaining growth indices also showed decreases compared to the CK, indicating that salt stress indeed led to a reduction in plant growth parameters, affecting the normal growth and development of plants. After spraying exogenous melatonin, there were improvements in growth parameters across all treatments compared to the same period of M1, with the M2 treatment showing the smallest improvement and the M5 treatment demonstrating the largest improvement. The plant height of M5 increased by 34.39%, 40.08%, and 22.48% compared to the CK during the same period; root length increased by 91.97%, 52.79%, and 60.04%; aboveground fresh weight increased by 49.4%, 52.79%, and 60.04%; and underground fresh weight increased by 49.4%, 52.79%, and 60.04%, respectively. This suggests that exogenous melatonin can effectively alleviate the growth inhibition caused by salt stress and promote the recovery of normal plant growth.

3.2. Effect of Exogenous MT on the Photosynthesis of Eggplant Seedlings Under Salt Stress

Figure 2a illustrates that the chlorophyll content in the control group (CK) and M1 group remained largely unchanged over 1–5 days. Groups treated with exogenous melatonin exhibited a trend of increasing chlorophyll content with prolonged treatment, reaching a peak on the fifth day. At all time periods, the chlorophyll content in the treated groups was significantly lower compared to the CK, with M1 consistently showing the lowest chlorophyll content across all periods. The chlorophyll content in M1 was reduced by 21.76%, 21.28%, and 17.72% compared to the CK at all respective time periods. This reduction may be attributed to the ionic imbalance caused by salt stress, which hindered the uptake of essential ions for chlorophyll synthesis in eggplants and severely inhibited chlorophyll production. The remaining treated groups showed a gradual increase in chlorophyll content with the extension of treatment time following exogenous melatonin application, indicating that melatonin promoted chlorophyll synthesis under salt stress and mitigated the damage to the photosynthetic system. Among these treatments, the chlorophyll content of the M5 treatment was significantly higher compared to other melatonin treatment groups, while the chlorophyll content in the M2 treatment was the lowest. The M5 treatment enhanced the chlorophyll content of M1 by 17.8%, 19.14%, and 17.6% in the respective periods compared to M1. This suggests that the M5 treatment was the most effective in increasing the chlorophyll content of eggplant seedlings, while the M2 treatment was the least effective.

As depicted in Figure 2c–e, it is observed that the Ci value was significantly higher, while the Tr, Gs, and Pn values were significantly lower in each treatment group compared to the control (CK) throughout the experiment. Notably, the M1 treatment exhibited the highest Ci value, concurrent with the lowest levels of Tr, Gs, and Pn. When compared to CK, the Ci values in each period for M1 increased by 63.71%, 47.47%, and 43.06%, respectively. Conversely, the Tr values decreased by 53%, 52%, and 48%; the Gs values decreased by 57.5%, 55.98%, and 50%; and the Pn values decreased by 56.12%, 51.33%, and 48.62%. This result suggests that salt stress significantly impacts the photosynthetic efficiency of eggplant seedlings. Following the application of exogenous melatonin, the Tr, Gs, and Pn values of each treatment were significantly enhanced when compared to the M1 treatment, with the exception of the Ci value, which decreased. Particularly, the M5 treatment exhibited the lowest Ci value and the highest Tr, Gs, and Pn values. In comparison to M1, the Ci value decreased by 21.47%, 22%, and 26.43%, respectively; the Tr value increased by 59.76%, 64.77%, and 74.43%; the Gs value increased by 64.71%, 96.53%, and 84.21%; and the Pn value increased by 49.9%, 68.8%, and 63.38%. This indicates that the application of exogenous melatonin can improve the photosynthetic characteristics of eggplant seedlings under salt stress, thereby mitigating the inhibitory effects of salt stress on the seedlings’ photosynthesis.

3.3. Effect of Exogenous MT on the Rate of O²⁻ Production, MDA, and H₂O₂ Content of Eggplant Seedlings Under Salt Stress

As depicted in Figure 3, the rates of O²⁻ production, as well as the levels of malondialdehyde (MDA) and hydrogen peroxide (H₂O₂) content, in the control group (CK) and M1 treatment group progressively increased from day 1 to day 5. The treatment groups sprayed with exogenous melatonin exhibited a trend of initial increases followed by decreases in the rates of O²⁻ production, MDA, and H₂O₂ content with the extension of the treatment duration, with peaks occurring on the third day. Each treatment group demonstrated significant improvements compared to the CK, particularly the M1 treatment, which exhibited the highest levels in each timeframe. The O²⁻ production rate of the M1 treatment increased by 106.45%, 96.2%, and 89.02% versus the CK in the corresponding periods, while the MDA content increased by 62.17%, 66.08%, and 60.91%; the H₂O₂ content increased by 31.88%, 57.51%, and 58.39%, respectively. Following treatment with exogenous melatonin, the rates of O²⁻ production and the contents of MDA and H₂O₂ in all treatment groups significantly decreased compared to the M1. Among them, the M5 treatment exhibited the most pronounced reductions, where the O²⁻ production rate decreased by 34.65%, 22.57%, and 58.39%; the MDA content decreased by 27.44%, 29.81%, and 35.3%; and the H₂O₂ content decreased by 18.91%, 27.57%, and 38.73% in the same periods versus the M1. This indicates that exogenous melatonin can effectively inhibit the rate of O²⁻ production and the accumulation of MDA and H₂O₂ during salt stress, reduce the degree of membrane lipid peroxidation, and maintain the integrity of the cell membrane.

3.4. Effect of Exogenous MT on Antioxidants in Eggplant Seedlings Under Salt Stress

According to Figure 4a–d, it is observed that the activities of superoxide dismutase (SOD), catalase (CAT), peroxidase (POD), and polyphenol oxidase (PPO) are significantly elevated in all treatment groups compared to the control (CK). Specifically, the CAT activity in the M1 treatment exhibits a trend of gradual decrease, while the POD activity shows a gradual increase. In contrast, the SOD and PPO activities initially increase and then decrease, reaching their peak on the third day. When compared to the CK, the SOD activity of the M1 treatment shows increases of 2.64%, 10.19%, and 16.21% at respective time points; the CAT activity increases by 69.23%, 51.9%, and 48.94%; the POD activity by 24.83%, 24.20%, and 16.87%; and the PPO activity by 18.72% and 5.04% in the same intervals. For the treatments supplemented with exogenous melatonin, the activities of SOD, CAT, and POD display an initial increase followed by a decrease, with peak enzyme activities occurring on the third day, except for a decreasing trend in PPO activity. Notably, the activities of SOD, CAT, POD, and PPO are significantly higher in all melatonin-treated groups compared to the M1 treatment, with the highest enzyme activity observed in the M5 treatment and the lowest in the M2. The M5 treatment shows increases in SOD activity of 27.17%, 28.5%, and 21.33% compared to the M1 treatment at respective time points; CAT activity increases by 54.47%, 88.3%, and 86.04%; POD activity by 48.93%, 63.32%, and 42.66%; and PPO activity by 32.85%, 20.52%, and 21.63%, respectively. This suggests that exogenous melatonin can effectively enhance the antioxidant enzyme activities of eggplant seedlings, with the M5 treatment demonstrating the most favorable effects.

As depicted in Figure 4e, the ascorbic acid content in CK and M1 exhibited minimal changes within the first five days. However, the treatments supplemented with exogenous melatonin demonstrated a pattern of initial increase followed by a decline in ascorbic acid content as the treatment duration prolonged, reaching a peak on the third day. In comparison to CK, the ascorbic acid content of the melatonin-treated groups significantly rose at each interval, with M1 showing increases of 41.6%, 33.55%, and 23.23% in each respective period when compared to CK. Upon application of different concentrations of exogenous melatonin, the ascorbic acid content of the eggplant seedlings was further enhanced, with the highest boost observed in M5. The ascorbic acid content in M5 was increased by 92.42%, 137.55%, and 90.53% compared to M1 at the same periods, respectively. This indicates that exogenous melatonin can effectively elevate the ascorbic acid content in eggplant seedlings under salt stress, with the M5 treatment yielding the most favorable results.

3.5. Effect of Exogenous MT on the Content of Osmoregulatory Substances in Eggplant Seedlings Under Salt Stress

Based on the data in Figure 5a, it can be observed that the soluble protein content of the control group CK and M1 did not significantly change within the first 5 days. The treatments applied with exogenous melatonin showed a trend of initially increasing and then decreasing in soluble protein content as the treatment duration prolonged, with the peak value appearing on the third day. The soluble protein content of each treatment was significantly higher compared to CK. The soluble protein content of M1 increased by 16.96%, 19.14%, and 22.92% in each respective period when compared to CK. After applying different concentrations of exogenous melatonin, the soluble protein content of the eggplant seedlings increased again, with M5 showing the highest level among all treatments at all periods. The soluble protein content of M5 increased by 22.94%, 40.54%, and 12.88% in each respective period when compared to M1.

The data in Figure 5b show that the soluble sugar content in the CK group decreased over the first 5 days, while the M1 group exhibited a gradual increase. The treatments that received exogenous melatonin also demonstrated a pattern of increasing soluble sugar content followed by a decrease, reaching a peak on the third day. Throughout the study period, the soluble sugar content in all melatonin-treated groups was significantly higher than that in the CK group. Specifically, the M1 treatment showed increases in soluble sugar content of 11.35%, 20.46%, and 26.81% compared to CK in all periods. The application of different concentrations of exogenous melatonin further increased the soluble sugar content in eggplant seedlings. The M5 treatment yielded the highest soluble sugar content, while the M2 treatment showed the lowest. The soluble sugar content in the M5 treatment increased by 23.98%, 42.31%, and 22.71% compared to the M1 treatment in the same periods. This suggests that exogenous melatonin can effectively elevate the soluble sugar content in eggplant seedlings, with the M5 treatment being the most effective and the M2 treatment the least effective in this regard.

Figure 5c indicates that the proline content in the control group (CK) and the M1 treatment remained relatively stable during the first 5 days. However, the proline content in the treatments that received exogenous melatonin demonstrated an initial increase followed by a decrease, reaching a peak on the third day. Throughout this study, the proline content in all melatonin-treated groups was significantly higher than that in the CK group. Specifically, the M1 treatment showed increases in proline content of 103.04%, 85.16%, and 83.83% compared to CK in all periods. After the application of exogenous melatonin, the proline content in all treatments was significantly higher than that in the M1 treatment, with the M5 treatment showing the highest proline content and the M2 treatment showing the lowest. The M5 treatment increased by 115.94%, 140.46%, and 78.05% in all periods compared to M1. This suggests that exogenous melatonin can effectively elevate the proline content in eggplant seedlings under salt stress, with the M5 treatment being the most effective and the M2 treatment the least effective in this regard. Proline is often associated with stress tolerance, and its increase may be a physiological response to counteract the negative effects of salt stress on plants.

3.6. Effect of Exogenous MT on the Expression of Relevant Genes in Eggplant Seedlings Under Salt Stress

The data in Figure 6 indicate that the relative expression levels of SmCAT1, SmCAT2, and SmCAT3 were significantly increased in the M1 treatment at day 5 compared to the control (CK). This upregulation suggests that the catalase (CAT) enzyme activity may have been enhanced in the M1 treatment, which is beneficial for scavenging reactive oxygen species (ROS) and reducing oxidative stress in the plant cells. For SmCAT4, the relative expression level in the M1 treatment showed a gradual decrease from day 1 to day 5, which could imply a regulatory mechanism where the plant adjusts the expression of this particular CAT gene in response to the initial salt stress. However, in the M2-M6 treatments, the relative expression level of SmCAT4 exhibited a trend of an initial increase followed by a decrease, reaching a peak at day 3. This pattern suggests that the salt stress response might be more complex, with a transient upregulation of SmCAT4 expression that could be associated with the initial response to salt stress. The significant upregulation of SmCAT4 expression in the M2-M6 treatments from day 1 to day 5, with the most pronounced increase in the M5 treatment, indicates that salt stress alone and especially in combination with exogenous melatonin can significantly increase the expression of this gene. Melatonin is known to have regulatory effects on plant gene expression and stress responses. The consistent pattern between the changes in SmCAT4 expression and CAT enzyme activity suggests that the upregulation of SmCAT4 by melatonin is functionally significant and could contribute to the enhanced salt tolerance of eggplant seedlings. The increased expression of SmCAT4 would lead to higher CAT enzyme activity, which in turn helps to protect the plant from oxidative damage caused by salt stress. This implies that melatonin not only directly activates the CAT enzyme but also indirectly enhances its expression, thereby improving the plant’s ability to resist salt stress.

According to Figure 7, compared to the CK, the relative expression levels of the SmPPO1, SmPPO8, SmPPO11, and SmPPO12 genes were significantly upregulated in the M1 treatment from 1 to 3 days, after which they decreased on the fifth day, exhibiting a pattern of an initial increase followed by a decline, with the peak occurring on the third day. This trend is largely consistent with the changes observed in PPO enzyme activity in the M1 treatment. Specifically, M3, M5, and M6 in SmPPO8, as well as M5 in SmPPO12, exhibited correlations with the fluctuation pattern of PPO enzyme activity in terms of gene expression following exogenous melatonin application. However, in the SmPPO family, no genes were found in this experiment that fully conformed to the rule of altered PPO enzyme activity.

4. Discussion

4.1. Effect of Exogenous Melatonin on the Growth Parameters of Eggplant Seedlings Under Salt Stress

Salt stress causes difficulties in water uptake by plant roots, interferes with the uptake or metabolism of other essential ions, causes osmotic stress and ionic imbalance, and allows a large amount of ROS to be produced, which inhibits many physiological processes in the plant, resulting in a slowdown of plant growth, which seriously affects the growth and development of crops [42,43]. Exogenous melatonin (MT), as a plant growth regulator that has been the subject of extensive research, can effectively alleviate salt injury [44]. Previous studies have shown that salt stress causes seedling growth slowdown and plant shortening in cotton, kidney bean, tomato, melon, sweet corn, and soybean, which seriously interferes with normal plant growth and development. Treatment with appropriate concentrations of exogenous melatonin, on the other hand, can effectively reduce the growth inhibition caused by salt stress and restore the plants to normal growth [45,46,47,48,49,50].

The results of the experiment showed that the plant height and root length of eggplant seedlings were significantly inhibited after salt stress treatment. However, the application of exogenous melatonin could effectively enhance the growth indices, such as plant height, root length, and the dry and fresh weights of both the aboveground and belowground parts of the eggplant. This beneficial effect may be attributed to the regulatory function of melatonin on signaling molecules, which influences the growth hormone signaling pathway in eggplant and increases the content of indole-3-acetic acid (IAA) within the plant. The elevated IAA levels activate the growth process of the eggplant seedlings. Therefore, foliar application of exogenous melatonin exhibits a positive regulatory effect on the morphological indices of eggplant seedlings, promoting their growth and biomass accumulation, and effectively mitigating the inhibitory effects of salt stress on the development of eggplant seedlings.

Salt stress significantly inhibited photosynthesis in eggplant seedlings, but the chlorophyll content and photosynthetic parameters of the seedlings were significantly enhanced following the application of exogenous melatonin. This suggests that exogenous melatonin can alleviate the suppression of photosynthesis caused by salt stress by increasing the chlorophyll content. The observed effects may be attributed to the fact that exogenous melatonin application enhances the accumulation of endogenous melatonin in eggplant seedlings, which in turn reduces the activity of chlorophyll-degrading enzymes and chlorophyll peroxidase, thus helping to preserve the integrity of chloroplasts. Furthermore, melatonin may also regulate stomatal opening in eggplant seedlings under salt stress, which promotes the efficient utilization of carbon dioxide and increases the values of transpiration rate (Tr), stomatal conductance (Gs), and net photosynthetic rate (Pn). These physiological adjustments ensure the normal functioning of photosynthesis in the presence of salt stress. In summary, spraying exogenous melatonin can indeed promote the growth of eggplant under salt stress and improve the resistance of eggplant seedlings to salt damage. However, there was an obvious concentration effect of exogenous melatonin on the alleviation of salt stress, in which 200 μmol·L melatonin had the best effect, which is consistent with the results of melatonin studies on blueberry, rice, and buttercup [51,52,53].

4.2. Effect of Exogenous Melatonin on the Cell Membrane of Eggplant Seedlings Under Salt Stress

Under stress from adversity, reactive oxygen species (ROS) are released and accumulated in large quantities within the photosynthetic and respiratory systems of plants. This results in or exacerbates lipid peroxidation in cell membranes and generates peroxidation products such as malondialdehyde (MDA), hydrogen peroxide (H₂O₂), and superoxide anions (O²⁻). These products inflict severe oxidative damage on plants, significantly impacting their growth and development [54,55,56,57,58]. Exogenous melatonin has been found to be effective in mitigating ROS-induced oxidative damage [59]. For instance, salt stress significantly increased the contents of MDA, H₂O₂, and O²⁻ in seedlings of sugar beet, dichromatic tonic grass, banana, and olive. This increase greatly enhanced electrolyte leakage, causing severe oxidative damage to the plants. However, exogenous spraying of melatonin at appropriate concentrations could effectively reduce the levels of lipid peroxides and decrease the electrolyte leakage in these seedlings [60,61,62,63].

In this study, we demonstrated that the contents of malondialdehyde (MDA), hydrogen peroxide (H₂O₂), and superoxide anion (O²⁻) in eggplant seedlings were significantly increased after treatment with 150 mmol·L salt stress. The application of exogenous melatonin resulted in varying degrees of reduction in lipid membrane peroxides in the eggplant seedlings. This may be attributed to the fact that melatonin can enhance the cellular capacity to scavenge peroxides by stimulating the entire antioxidant system, thereby protecting the eggplant seedlings from oxidative damage induced by salt stress. The present results are in agreement with those of the aforementioned studies, indicating that exogenous melatonin can alleviate lipid peroxidation and maintain cell membrane stability to some extent.

4.3. Effect of Exogenous Melatonin on Antioxidant Enzyme Activities and ASA in Eggplant Seedlings Under Salt Stress

When plants perceive high reactive oxygen species (ROS) levels under environmental stress, in order to prevent oxidative damage, plant cells initiate rapid regulatory mechanisms to scavenge reactive oxygen species, and many enzymes (oxidative enzymes (POD), superoxide dismutase (SOD), catalase (CAT), etc.) along with non-enzymatic antioxidants (ascorbic acid (AsA), glutathione (GSH), vitamins, etc.) restore the endogenous antioxidant levels or counteract oxidative stress by direct detoxification of excess ROS, thereby increasing plant tolerance to oxidative stress [64,65,66,67]. Numerous studies have shown that after crops suffer from salt damage, the activity of antioxidant enzymes and the content of AsA in their bodies significantly increase [68,69,70,71,72,73].

The application of suitable concentrations of exogenous melatonin can further increase the activities of these enzymes and antioxidants and effectively alleviate the damage caused by salt stress to plant seedlings. The results of the experiment suggest that eggplant seedlings treated with salt stress exhibit enhanced activities of antioxidant enzymes (SOD, POD, CAT, PPO) and increased ASA content compared to the control. This indicates that plants have a rapid response mechanism to mitigate the damage caused by adverse conditions. The application of exogenous melatonin further increased the activity and ASA content of these enzymes. The potential mechanism is that melatonin, as an antioxidant, upregulates the expression of antioxidant-related genes, thereby stimulating the activity of major antioxidant enzymes under salt stress and reducing the production of reactive oxygen species. These findings imply that melatonin can improve the scavenging ability of eggplant seedlings against reactive oxygen species by enhancing the activity of antioxidant enzymes under stress, maintaining the intracellular reactive oxygen species metabolism as much as possible, and alleviating the damage caused by adverse stress.

4.4. Effect of Exogenous Melatonin on Osmoregulatory Capacity of Eggplant Seedlings Under Salt Stress

Salt stress imposes three types of stresses on plants by affecting water uptake, stomatal movement, and ionic balance: osmotic stress, ionic imbalance, and oxidative damage. Osmotic stress, in particular, leads to a reduction in a plant’s water absorption capacity, resulting in cellular dehydration, a decrease in cell turgor pressure, and interference with normal physiological functions [74,75]. Small molecules, such as proline and soluble sugars, regulate cellular osmolality and perform diverse functions, including maintaining cell membrane stability and redox balance [76]. Research indicates that under salt stress conditions, the application of appropriate concentrations of exogenous melatonin can significantly increase the levels of soluble sugars, soluble proteins, and free proline in crops, thereby enhancing their salt tolerance [77,78,79,80].

In this study, we observed that the levels of proline, soluble sugar, and soluble protein in eggplant seedlings under salt stress significantly increased compared to the control. Furthermore, these contents were enhanced even more after the seedlings were sprayed with exogenous melatonin. This suggests that exogenous melatonin can mitigate osmotic stress by reducing the cellular osmotic potential, enhancing osmotic regulation, and increasing the accumulation of osmoprotectants, such as proline and soluble sugars. This beneficial effect may be attributed to melatonin’s ability to induce osmoregulation within the cells. Additionally, melatonin’s promotion of normal photosynthesis could lead to a greater accumulation of photosynthetic products, which in turn increases the content of these regulatory substances and reduces the cellular osmotic potential, thereby improving osmoregulation and increasing the water content in eggplant seedlings. Overall, the application of exogenous melatonin can further stimulate the accumulation of osmoprotective substances, thereby enhancing the salt tolerance of eggplant seedlings.

4.5. Effect of Exogenous Melatonin on the Expression of Relevant Genes in Eggplant Seedlings Under Salt Stress

The previous study results indicated that SmCAT4 has a notable ability to scavenge H₂O₂ in vitro and plays a positive role in the eggplant salt stress response [81]. To verify whether SmCAT4 is indeed a crucial player in the eggplant’s response to salt stress, the expression of four genes, SmCAT1, SmCAT2, SmCAT3, and SmCAT4, was examined via qRT-PCR in this research. The experiment revealed that the SmCAT4 gene was significantly upregulated in eggplant seedlings under salt stress. Furthermore, the relative expression of the SmCAT4 gene was significantly increased following treatment with exogenous melatonin. After exposure to exogenous melatonin, the relative expression of the SmCAT4 gene initially increased and then decreased with the increasing concentrations of exogenous melatonin, aligning with our findings. This suggests that SmCAT4 might be a key gene in the mitigation of salt stress-induced damage by melatonin.

In this study, we validated the 12 SmPPO (peroxidase) gene families through qRT-PCR based on the PPO genes previously identified [82]. The results revealed that four genes, SmPPO1, SmPPO8, SmPPO11, and SmPPO12, were significantly upregulated in eggplant under salt stress, indicating that these genes may contribute positively to the plant’s response to salt stress. Subsequently, we analyzed the expression of these four gene groups after treatment with exogenous melatonin. Unexpectedly, we did not observe any consistent changes in PPO enzyme activity that corresponded to the activity measurements we had determined earlier. Therefore, we did not find key genes responsive to salt stress in the SmPPO family.

5. Conclusions

Under high salinity conditions, the content of antioxidants and osmoregulators in eggplant seedlings increases significantly in a short period of time to counteract the oxidative damage caused by salt stress. However, as the duration of the stress extends, there is a substantial accumulation of reactive oxygen species (ROS) and membrane lipid peroxides in the seedlings, which exacerbates the damage caused by salt stress and leads to a slowing down of the seedlings’ growth. The application of 200 μmol·L⁻¹ exogenous melatonin effectively promotes the growth of eggplant seedlings under salt stress, enhances the chlorophyll content and antioxidant enzyme activity in the leaves, and significantly increases the content of non-enzyme antioxidants and osmoregulators. This effectively mitigates the inhibition of photosynthesis by salt stress, improves the antioxidant capacity of eggplant, reduces membrane lipid peroxidation, and enhances the tolerance of eggplant seedlings to salt stress. To further demonstrate that exogenous melatonin can effectively alleviate the damage caused by salt stress to eggplant seedlings, we referred to previous research and conducted quantitative real-time PCR (qRT-PCR) validation. The results showed that under salt stress, the expression of the SmCAT4 gene in eggplant seedlings increased significantly, indicating that the SmCAT4 gene might be a key gene in the process of melatonin alleviating salt stress damage. However, we did not find a key gene responsive to salt stress in the SmPPO gene family. In addition, this study also found that the growth of eggplant seedlings basically recovered after 5 days of melatonin treatment. In the future, we need to validate its effectiveness in large-scale field trials and study the precise mechanism of melatonin in alleviating adversity stress, optimize its application strategy, and provide a basis for its future application in alleviating adversity stress.