Effects of Green-Synthesised Copper Oxide–Zinc Oxide Hybrid Nanoparticles on Antifungal Activity and Phytotoxicity of Aflatoxin B1 in Maize (Zea mays L.) Seed Germination

Abstract

Maize contamination with aflatoxin B1 (AFB1) is of significance on a global scale due to its major contribution to food security. It is very probable that substantial amounts of AFB1 may be absorbed by germinating seeds grown in contaminated soil and cause deleterious effects on the growth and development of maize. In this study, the effect of green-synthesised ZnO-CuO hybrid nanoparticles (NPs) on antifungal activity and reducing the toxic effects of AFB1 on seed germination was examined. A notable inhibitory effect of green-synthesised ZnO-CuO nanoparticles (NPs) on A. flavus was observed at a concentration of 0.5 ppm, resulting in 13.1% inhibition, which was more effective than the higher concentration of 1.0 ppm and the control. The results showed that the final germination percentage of the seeds that were inoculated with 320 ppb was significantly increased by the treatment with 125 mg/mL of green ZnO-CuO hybrid NPs. This study indicated the potential of green-synthesised ZnO-CuO hybrid NPs as alternative antifungal agents to control aflatoxin production in maize to improve food security and safety by supressing the threat posed by AFB1.

1. Introduction

Aflatoxins are a group of structurally related toxic secondary metabolites [1,2,3,4], produced by the Aspergillus group of fungi, including Aspergillus flavus or Aspergillus parasiticus [5,6]. This fungal group also produces other mycotoxins such as ochratoxin A (OTA), patulin (PAT), citrinin (CIT), and aflatrem (AT), to name a few [7]. AFs are synthesised through the polyketide route from difuranocoumaric chemicals, and their biosynthesis shows a fluorescent colour only when exposed to ultraviolet light [8]. There are four major naturally occurring aflatoxins (AFs), namely aflatoxin B1 (AFB1), aflatoxin B2 (AFB2), aflatoxin G1 (AFG1), and aflatoxin G2 (AFG2) [9]. According to the International Agency for Research on Cancer (IARC), AFB1 is classified under carcinogenic compounds (Group 1); thus, aflatoxins have carcinogenic, teratogenic, mutagenic, and hepatotoxic effects [10,11,12]. They are also regarded as a primary problem in tropical and subtropical areas [13] as they are estimated to have a population-attributable risk of 11–19% for liver cancer [14]. In the human liver, the action of cytochrome P450 (CYP genes) 3A4 and CYP1A2 starts when the level of AFB1 elevates. These CYP genes (especially CYP3A4) are important because they are found in all living organisms, and they predominantly facilitate the formation of AFBO, primarily generating the exo isomer of AFBO [15,16]. The toxic effects of AFB1 are principally brought on by bioactivated AFB1-8,9-epoxide’s adsorption by cellular macromolecules, particularly mitochondrial and nuclear nucleic acids and nucleoproteins, which have cytotoxic effects in general [17,18]. This AFB1-exo-epoxide has a half-life of about 1 s in an aqueous buffer. Despite its short lifespan, it can react with high concentrations of DNA, leading to the formation of AFB1–DNA adducts [19]. These aflatoxins affect a various range of important crops, including maize, sorghum, fillet, millet rice, and peanuts, alongside products such as spices and nuts [20,21]. The acceptable levels of aflatoxin B1 (AFB1) in foods meant for human consumption typically range from around 0 to 40 parts per billion (ppb). In contrast, the permissible concentrations in animal feed can be significantly higher, allowing levels of up to 300 ppb [15].

Maize (Zea mays L.) is one of the major cereal grains, ranked the second most produced crop worldwide [22,23]. It is consumed globally as a staple food or feed for livestock and is widely used in a variety of commercial products, including syrup and corn starch [24,25]. It is a critical food source in many developing countries, providing essential nutrition [26]. Its economic importance to food security is paramount, influencing market stability, prices, and access to food [27]. Maize is moderately sensitive to biotic and abiotic stresses, and it is extremely vulnerable to Aspergillus fungus species contamination in the field at silking stage and during storage as a grain [28,29,30]. These types of fungi are species that are hemibiotrophic pathogens: they produce AFB1 toxins that attack maize pre harvest and during harvest, post-harvest handling, and storage under inappropriate temperature and humidity conditions, thus disrupting their host secondary metabolic pathways [31]. Maize is grown in soils which are home to these aflatoxigenic types of fungi. Thus; it is very probable that substantial amounts of toxin may be adsorbed by the root systems of subsequent crops and translocated to above-ground stems, leaves, and other tissues [32,33,34]. Therefore, this could be harmful to both the health of the consumer and the growth and development of the plant [35]. These factors may reduce seed germination, which is a physiological process which initiates and develops a seedling by triggering a cascade of biological and biochemical reactions, such as phytohormones [24]. Germination begins with the dry seed absorbing water (imbibition) and ends when a part of the seed emerges from the surrounding structure (the embryonic axis in dicotyledons or the radicle in monocotyledons or gymnosperms), which is referred to as the emergence phase [36,37,38]. Seed germination, one of the most significant stages in a plant’s life, is sensitive to the chemical and physical conditions of the rhizosphere. Although the seed coat can act as a principle barrier, limiting the harmful effects of pathogenic fungi, most seeds and seedlings show a decline in germination and vigour due to AFB1’s phytotoxicity [39]. Meanwhile, seed vigour in plant growth indicates the overall health and robustness of a plant, which contributes to resistance against pests and diseases, as well as tolerance to abiotic stresses [40].

Current studies suggests that green nanocomposites are a possible solution to the problem of the phytotoxicity of aflatoxins (AFs) through their adsorption mechanisms around the toxins [41]. Green nanocomposites are also called green hybrid nanoparticles. They exhibit improved properties, such as increased strength, stiffness, thermal stability, and resistance to degradation, and are synthesised using renewable resources and biodegradable components, which makes them environmentally friendly [42]. These green hybrid nanoparticles could be synthesised using spent mushroom substrate (SMS) extract. The mycelium of the SMS secretes abundant metabolites, proteins, and biodegradative enzymes like laccase, lignin peroxidase, and manganese peroxidase [43,44,45]. The SMS is simple to grow and handle, has a high binding capacity, and produces more biomass [46,47]. Mushrooms also produce antioxidants and have antiviral and anti-cancer properties [48]. These enzymes from the SMS directly reduce bulk metals into nanoparticles and then stabilise the formed NPs [49]. Due to their small particle size (1–100 nm), distinctive optical properties, and high surface area-to-volume ratio, nanoparticles have generally demonstrated great utility in relation to the protection of plants against soil-bound toxins, including heavy metals [50,51] and arsenate toxicity in maize [52]. Green-synthesised CuO/ZnO hybrid NPs have proven to have antifungal properties and antioxidant activities, but they have not been synthesised using Pleurotus ostreatus spent substrate extract. Thus, the aim of this study was three-fold. Firstly, the study aimed to identify Aspergillus flavus fungus (aflatoxin B1-producing fungus) using PCR. Secondary to this, the study evaluated the antifungal activity of green-synthesised zinc oxide–copper oxide (ZnO-CuO) hybrid nanoparticles in four different fungal species—Aspergillus flavus, Aspergillus niger, Aspergillus parasiticus, and Fusarium graminearum. Lastly, this study evaluated the effects of green-synthesised ZnO-CuO hybrid nanoparticles on maize seed germination among specimens contaminated with AFB1 and A. flavus fungus, as well as its concentration on radicle and plumules after germination.

2. Methods and Materials

2.1. Fungus and Reagents

Pleurotus ostreatus fungus spawns, perforated plastic mushroom substrate bags, and mushroom biofortificants were purchased from Eco-Agro Enterprise (Pty) Ltd. in Nelspruit, Mpumalanga Province (Nelspruit, South Africa). Sterile plastic ware for cell culturing was purchased from Corning Inc. (New York, NY, USA). Sodium chloride NaCl (Sigma-Aldrich, in Darmstadt in Germany), potato dextrose agar (PDA) medium (Oxoid, Basingstoke, UK) (Sigma-Aldrich), ethanol (Sigma-Aldrich), 20% (phosphate-buffered saline) tween 20- PBS (Sigma-Aldrich), dimethyl sulfoxide (DMSO), and all other chemical reagents used were of analytical grade, purchased from (Sigma-Aldrich, in Darmstadt in Germany) and supplied by Merck Pty Ltd. (Lethabong, South Africa). A previously characterised aflatoxigenic strain of Aspergillus flavus (ND32-MG659626) isolated from animal feed was collected from the Toxicological/Biochemistry Laboratory of the Department of Animal Health, North-West University, Mafikeng Campus, (South Africa). Purified AFB1, AFB2, AFG1, AFG2, and AF total standards was purchased from Sigma Aldrich Pty (Sigma-Aldrich, in Darmstadt in Germany). Immunoaffinity columns were purchased from R-Biopharm (Glasgow, UK), while HPLC-grade methanol was purchased from (Sigma-Aldrich, in Darmstadt in Germany). Maize seeds of PAN 5R-590R were sourced from Molelwane Farm, North-West University, Mafikeng campus (South Africa).

2.2. ZnO-CuO Hybrid Nanoparticle Synthesisation and Characterisation

ZnO-CuO hybrid nanoparticles were synthesised by Pleurotus ostreatus spent mushroom substrate extract using a method by [53], with minor modifications in the chemistry laboratory at the North-West University. A total of 2.5 g of copper acetate and 2 g of zinc acetate were mixed in 30 mL of distilled water. To this solution, 20 mL extract of the P. ostreatus spent mushroom substrate was added, and the pH of the solution was adjusted to 10 with sodium hydroxide (NaOH) and then heated up to 80 °C for 2 h. After the reaction, the solution was centrifuged, dried overnight in an oven, and calcinated at 650 °C for 2 h. The powdered ZnO-CuO hybrid NPs were then characterised with the Bruker D8 Advanced X-ray diffraction (XRD) instrument (Karlsruhe, Germany) for structural phase identification. A morphological analysis was performed using A TECNAI G2 (ACI) Transmission Electron Microscopy (TEM) equipment (Hillsboro, OR, USA), with an accelerating voltage of 200 kV, and FEI Quanta FEG 250 scanning electron microscopy (SEM).

2.3. Identification of A. flavus Fungus Spores Using Polymerase Chain Reaction (PCR)

Standard fungal isolate of Aspergillus was used for molecular identification in this study following the method of [54], with minor modifications. The strain was cultured in potato dextrose agar (PDA), and then, from the respective Petri dishes, genomic DNA was extracted by aseptically scraping the mycelia of the spores. Mycelial DNA was extracted using the Quick-DNA^TM fungal/bacterial Miniprep Kit (Zymo Research, Catalogue No. D3024). PCR amplification of the target genes was performed in 25 μL containing 12.5 μL of 2 × PCR mix (OneTaq^®Quick Load, Biolabs Inc, NE, USA), 0.5 μL comprising 25 μM of each primer (Inqaba Biotech, South Africa), 5 μL of the extracted DNA, and adequate nuclease-free water to produce a final volume of 25 µL. Molecular identification of the isolates was undertaken by PCR amplification of the molecular marker internal transcribed spacer (ITS) region of the DNA, with [5′ GGGAAGTTGTTGCGTAAATAGA 3′ (forward)] and [5′ CTGCGTCCTTCATCGAT 3′(reverse)]. Genes aflD, aflM, aflP, and aflR were amplified by PCR using the primer pairs and conditions listed in Annex S1 in Supplementary Material. The PCR products were electrophoresed on 1% agarose gel, then undergoing ethidium bromide staining and visualisation using the gel documentation system. The amplicons were sent for sequencing at Inqaba Biotech, South Africa. Editing of the amplicon sequences was undertaken using BioEdit software v7.2.5. Similarities in the amplicon sequences were compared with those already deposited in the gene bank of the National Centre for Biotechnology and Information (NCBI) through the Basic Local Alignment Search Tool. Species identification was based on the best score (≥99% similarity).

2.4. Antifungal Activity of ZnO-CuO Hybrid NPs

In a 5 [no fungi (control), Aspergillus flavus, Aspergillus parasiticus, Aspergillus niger and Fusarium graminearum] × 3 [copper oxide–zinc oxide (ZnO-CuO) nanoparticles (NPs) 0, 0.5 ppm, 1 ppm] × 3 (replicates) design, giving a total of 45 experimental units, a randomised complete design (RCD) was used to determine the antifungal activity of the ZnO-CuO hybrid NPs. The method employing a potato dextrose agar (PDA) medium supplement following [55]’s protocol with minor modifications was used for the antifungal evaluation. In this study, about 20 μL of green-synthesised ZnO-CuO nanoparticles was poured in 15 mL of PDA medium plate. Then, fungal spores of each fungus were placed at the centre of each plate. The plates were incubated at 28 ± 2 °C, and media supplemented with corresponding levels of dimethyl sulfoxide (DMSO) and sterile distilled water without nanoparticles were used as the control plates. Fungal growth was monitored for a week at 3-day intervals, and the percentage inhibition rate was calculated according to Equation (1).

$$\mathrm{Inhibition} \mathrm{rate}\%={\displaystyle \frac{Dc-Dt}{Dc}}\times 100$$

(1)

where

Dt = diameter of fungal growth in nanoparticle-supplemented PDA plate;

Dc = diameter of fungal growth in PDA plate not supplemented with nanoparticles.

2.5. Seed Germination Test

The seed germination capacity was determined using the standard germination test under laboratory conditions. Maize seeds were first sterilised with 0.1% H₂O₂ (hydrogen peroxide) for 10 min, rinsed three times with distilled water, and evenly placed in Petri dishes with 4 layers of Whatman no. 1 filter paper dampened with 15 mL of distilled water. The aflatoxin-producing strain of A. flavus was reactivated in PDA. Fungus mycelia were harvested by scraping them into tubes with sterilised distilled water. For the spore count, the suspension was thoroughly blended, and 100 µL was placed on a slide for spore quantification using a haemocytometer and then viewed under a Zeiss microscope (×10). The treatments were 4 [zinc oxide–copper oxide (ZnO-CuO) nanoparticles (NPs) (0, 5 mg/mL, 25 mg/mL, and 125 mg/mL)] × 5 [aflatoxins (AFs) (0, 40 ppb and 320 ppb of AFB1; 40 and 320 of A. flavus spores/mL)] × 5 replicates of 15 seeds per Petri dish, giving a total of 100 experimental units. A completely randomised design was used in this experiment. The experimental units were incubated in the germination chamber with a constant temperature of 28 °C for 10 days. An additional 5 mL of sterilised water was added to the Petri dishes every 24 h to ensure water saturation throughout the seed germination period. Germination counts were taken daily for 10 days, and, on day 10, the final germination was calculated. Thereafter, measurements of the following growth parameters were measured i.e., root length (mm) (RL), shoot length (mm) (SL) and chlorophyll content index (CCI) using chlorophyll meter SPAD-502Plus were measured. Then, germination indices such as the final germination percentage (germination%), the seedling vigour index, and the shoot–root ratio were calculated [56].

$$\mathrm{Germination} \mathrm{percentage} (\%)={\displaystyle \frac{Germinated seeds}{Total no.seeds}}\times 100$$

(2)

$$\mathrm{Vigour} \mathrm{index}=[Seedling length (mm)+Root length (mm)]\times Germination \%$$

(3)

$$\mathrm{Root}\text{–}\mathrm{shoot} \mathrm{ratio}={\displaystyle \frac{Root length}{Shoot length}}$$

(4)

2.6. Aflatoxin B1 (AFB1) Concentration

AFB1 uptake by radicle and plumule cytoplasm was determined; whereby, one gram of the germinated radicle and the plumule were ground in 5 mL of 80% methanol: 20% distilled water for 10 min using a mortar and pestle. The sample was filtered through Whatman no. 4 filter paper, 2 mL from the filtrate was used and diluted with 14 mL phosphate buffered saline (PBS) solution, then allowed to pass through the column at a flow rate of 2 mL per minute to capture the toxins by the antibody. The column was further washed using 20 mL of PBS to remove any residual liquid. Lastly, 2 mL of 99.9% methanol was used to elute the toxins from the column, which were then collected in an amber glass vial. The samples were kept in a fridge, and 40 µL was injected into the high-performance liquid chromatography (HPLC) system for aflatoxin detection. The HPLC system was equipped with a Jasco FP-920 fluorescence detector set at an excitation wavelength of 362 nm and a 425 nm emission wavelength. The AFB1 was inherently physiologically structured to be detected at an excitation wavelength of 362 nm. A Hichrom column (4.6 mm × 150 mm) with a dimension of 5 μm was used, while the derivatisation reactor was a KOBRA Cell programme, at 100 μA. Separations of the chromatographic peaks were performed in a Hichrom column to which a pre-column of a similar stationary phase had been fitted. Inertsil ODS-3 and ODS-3 V were used as the guard cartridge and the analytical cartridge, respectively, while the injector was made of an autosampler with a rheodyne valve.

About 10 µL of the samples was injected into the HPLC system, while aflatoxin standards (AFB1, AFB2, AFG1, AFG2, and AF total) were spiked at varied concentrations (0.0005, 0.005, 0.05, 0.5, 5, and 50 ppb) for calibration and validation purposes. The mobile phase used was composed of water–methanol (55:45, v/v), potassium bromide (119 mg), and 3 mL nitric acid per litre of the mobile phase and was pumped at a 1.0 mL/min flow rate in an isocratic programme. Aflatoxin detection was regarded as positive for each peak at a retention time similar to each standard and at a height five times higher than the baseline noise [9]. The recovery of AFB1 and its metabolites was determined by spiking in triplicates the negative radicle and plumule control samples with 100 µL of total aflatoxin standards (AFB1, AFB2, AFG1, and AFG2) and analysing them using the HPLC following the methods described above. Equation (2) was used in this study:

$$\% \mathrm{Recovery}=\left({\displaystyle \frac{Amount recovered}{Amount spiked}}\right)\times 100$$

(5)

2.7. Statistical Analysis

The data were subjected to an analysis of variance (ANOVA) using Genstat statistical package 18th edition software (VSN International, Hemel Hempstead, UK, 2011). The means were separated using Tukey’s least-significant difference at a 5% level of significance. Antifungal evaluation data means were compared using multiple comparisons of least-squares means and Tukey’s honestly significant difference (HSD) test at a 5% level of significance [57].

3. Results

3.1. ZnO-CuO NP Characterisation

The structural phase and purity of the ZnO-CuO nanoparticles was confirmed from the XRD pattern in Annex S2 in Supplementary Materials,which showed peaks which indicated the presence of ZnO and CuO NPs. SEM and TEM analyses were used to study the microstructural properties of the ZnO-CuO powder, which showed a composite of the morphological architecture of both ZnO and CuO NPs (Annex S3 in Supplementary Materials). Through these studies, the presence of a spherical morphology and a tightly packed structure of NPs was identified.

3.2. Identification and Characterisation of A. flavus Spores Using PCR

The results indicated that there was no difference between the tested Aspergillus isolates on the molecular–genetic level. The aflM-ver PCR amplicons were of the expected size for the region (600 bp) in all four replicates (Figure 1A). Also, the amplification of the aflD/Nor region produced a 400 bp product in all the isolates, as shown in Figure 1B. The fragment size obtained by PCR using the primer pair AflD and Bt2b was 400 bp, while the fragment size amplified by primer ITS 2 was 550 bp. All four sample sequences were of good-enough quality for the BLAST query.

The BLAST query of the ITS genes of the four sequences of Aspergillus isolates revealed that they had 99–100% similarity to the following species: A. flavus and A. oryzae (Annex S4 in Supplementary Materials). The phylogenetic tree obtained clearly shows that the A. flavus strains clustered into six major clades. The isolates were given GenBank accession numbers PQ182929–PQ182934.

3.3. Antifungal Activity of ZnO-CuO Hybrid Nanoparticles

On the third day after incubation, mycelium growth for all fungi was rapid on the plates that did not have green-synthesised ZnO-CuO hybrid NPs (Figure 2A). The inhibitory effect of ZnO-CuO hybrid NPs was most significant (p < 0.01) on the third day, measuring 1 ppm (45.5%) (Figure 2B). The results also showed a significant (p < 0.05) inhibitory effect of ZnO-CuO NPs in A. flavus (13.1%) on media with 0.5 ppm concentration. There was no significant (p > 0.05) difference between the different fungal strains at the higher concentration of ZnO-CuO NPs (1 ppm). However, the percentage inhibition of ZnO-CuO NPs against A. niger (15.8%) on the seventh day was most significant (p < 0.05) at a 0.5 ppm concentration of hybrid NPs (Figure 2C). The interaction effect of the ZnO-CuO NPs at 1 ppm was non-significant (p > 0.05) in all fungi throughout the experiment, but 0.5 ppm ZnO-CuO NPs had a significant (p < 0.05) inhibitory effect on A. flavus (13.1%) and A. niger (15.8, 16.5%) on days 3, 5, and 7, respectively (

Table 1. Interaction effect of ZnO-CuO green hybrid nanoparticles on different fungal strains. Different letters indicate significant differences across the treatments.

Fungus	Day 3			Day 5			Day 7
	0.5 ppm	1 ppm	LSD	0.5 ppm	1 ppm	LSD	0.5 ppm	1 ppm	LSD
A. niger	12.1 b ± 3.34	43.8 a ± 4.52	8	15.8 b ± 2.62	43.0 a ± 2.43	8.28	16.5 b ± 1.86	43.2 a ± 1.0	8.28
A. parasiticus	9.35 a ± 6.49	24.2 a ± 10.1	28.6	3.16 b ± 1.16	22.8 a ± 4.42	11.8	5.65 a ± 3.99	13.7 a ± 4.24	23.4
A. flavus	13.1 b ±3.07	58.4 a ± 9.17	24	0.0 b ± 0	58.5 a ± 14.1	11.8	0.0 a ± 0	48.8 a ± 19.9	63.3
F. graminearum	11.3 b ± 2.85	55.8 a ± 4.56	15.6	13.5 a ± 1.33	57.5 a ± 14.89	44.3	11.2 a ± 7.07	50.3 a ± 21.6	77.5

Note: ± standard deviation (n = 3).

).

3.4. Seed Germination Test

3.4.1. Effects of AFB 1 and A. flavus Spores on Seed Germination

The results showed that seeds under the control conditions showed rapid germination compared to those that had been treated (Annex S5 in Supplementary Materials). The seeds that had not been exposed to AFB1 and fungal spores (control) reached a germination percentage of 8% over two days, while those which had been treated with a higher concentration of AFB1 (320 ppb) and fungal spores (320 spores/mL) remained at 1.3% (Figure 3). The final germination percentage for all treatments was significantly (p < 0.05) reduced compared to the control (Annex S6 in Supplementary Materials). For example, the final germination percentages for the 320 spores/mL and 320 ppb/mm AFB1 treatments were 61.3% and 58.7%, respectively, compared to the 95.3% measured for the control treatment. The seedling length for the seeds that had been treated with 320 spores/mL was 70.3 mm shorter than the control. The seeds that had been exposed to AFB1 also showed a significant (p < 0.05) decrease in plumule strength. For seeds under the AFB1 treatments of 320 ppb and 320 spores/mL, the seedling vigour indices were 12.4 and 13.6 lower than the control. Also, the doses of 320 ppb and 320 A. flavus spores/mL had a negative effect on the chlorophyll content index (0.74 and 0.81), which was 9 and 41.7% less than the control, respectively.

3.4.2. Effect of ZnO-CuO Hybrid NPs on Seed Germination

The seeds that had been treated with 125 mg/mL ZnO-CuO NPs reported the highest germination percentage on day 6 (83.5%) and day 7 (84%), as shown in Figure 4. The statistical analysis also reported that the shoot length, seedling vigour index, and root–shoot ratio were significantly (p < 0.01) increased in the seeds exposed to the 125 mg/mL treatment (

Table 2. The main effect of ZnO-CuO NPs on seed performance.

NPs (mg/mL)	Final Germination Percentage (%)	Root Length (mm)	Shoot Length (mm)	Seedling Length (mm)	Seedling Vigour Index	Root–Shoot Ratio	Chlorophyll Content Index
0	74.1 b	128.5 c	98.8 a	227.2 b	17,353.3 b	1.3 b	1.15 a
5	71.7 b	136.4 a	97.2 a	233.5 a	17,052.8 b	1.41 a	0.8 b
25	75.2 b	128.5 c	97.2 a	225.7 b	16,800.1 b	1.34 ab	0.7 c
125	84.0 a	131.0 b	94.8 a	225.8 b	19,083.8 a	1.4 a	0.6 d
Significance	**	**	NS	**	**	**	**
HSD	5.15	2.11	4.14	4.98	1316.7	0.07	0.05
CV%	9.08	2.17	5.74	2.94	10.1	7.04	8.63

Note: Mean values within the same column followed by different letters indicate significant differences (p < 0.05; Tukey’s HSD). NS = not significant at p > 0.05; ** significant at p < 0.01; CV% = coefficient of variance; and HSD = honestly significant difference.

) compared to the control and the 5 mg/mL and 25 mg/mL treatments. However, green-synthesised ZnO-CuO hybrid NPs caused a significant (p < 0.01) decrease in the seedling length and chlorophyll content index, such that there was a difference of 0.55 between the chlorophyll content of the control and that of the seeds which had been treated with 125 mg/mL ZnO-CuO NPs. The interaction effect of AFB1 and ZnO-CuO NPs on daily germination indicated that the seeds that had been exposed to 320 spores/mL had the lowest germination percentage from day 1 to day 5 (0, 0, 10.7, 26.7, and 44%) (

Table 3. Interaction effects of AFB1 and ZnO-CuO NPs on daily germination.

NPS (mg/mL)	AFB1/Spores	Day
		2	3	4	5	6	7
0	0	8 abc	53.3 a	73.3 a	86.7 a	97.3 a	100 a
	40 ppb	8 abc	37.3 bc	53.3 bcd	68 abcde	89.3 abc	89.3 ab
	320 ppb	0 d	42.7 ab	28 fgh	44 f	48 i	48 h
	40 spores	9.3 ab	36 bcd	48 bcde	70.7 abcd	77.3 bcdef	80 bcde
	320 spores	0 d	10.7 ij	26.7 gh	44 f	49.3 hi	53.3 gh
5	0	10.7 a	37.3 bc	53.3 bcd	72 abcd	88 abc	88 abc
	40 ppb	6.67 abcd	33.3 bcde	46.7 bcde	61.3 cdef	76 bcef	77.3 bcde
	320 ppb	0 d	12 hij	26.7 gh	50.7 def	56 ghi	57.3 fgh
	40 spores	8 abc	30.7 bcdef	44 cdef	65.3 bcde	80 bcde	82.7 bcd
	320 spores	0 d	9.33 j	25.3 h	44 f	50.7 hi	57.3 fgh
25	0	0 d	42.7 ab	62.7 ab	82.7 ab	89.3 abc	90.7 ab
	40 ppb	8 abc	29.3 cdefg	48 bcde	61.3 cdef	74.7 bcdef	76 bcde
	320 ppb	0 d	22.7 efghi	45.3 cde	62.7 cdef	73.3 cdef	76 bcde
	40 spores	8 abc	17.3 ghij	34.7 efgh	54.7 def	65.3 efgh	69.3 defg
	320 spores	2.67 bcd	20 fghij	41.3 cdefgh	58.7 cdef	61.3 fghi	80 bcde
125	0	10.7 a	32 bcdef	57.3 bcd	77.3 abc	86.7 abc	86.7 abc
	40 ppb	9.33 ab	24 defgh	44 cdef	61.3 cdef	88 abc	88 abc
	320 ppb	8 abc	26.7 cdefg	44 cdef	64 bcde	90.7 ab	90.7 ab
	40 spores	8 abc	24 defgh	42.7 cdefg	62.7 cdef	82.7 abcd	82.7 bcd
	320 spores	1.33 cd	24 defgh	40 defgh	58.7 cdef	69.3 defg	72 cdef
Significance		*	**	**	**	**	**
HSD		2.18	13	6	4.01	10.7	11.1
CV%		50.9	19.6	15.7	13.4	9.29	9.08

Note: Mean values within the same column followed by different letters indicate significant differences (p < 0.05; Tukey’s HSD). * significant at p < 0.05; ** significant at p < 0.01; CV% = coefficient of variance; and HSD = honestly significant difference.

). The germination percentage of maize with no AFB1 but treated with 5 mg/mL (10.7%) and 125 mg/mL (10.7a) was the highest on the first day of germination counting. The interaction effects of AFB1 and ZnO-CuO NPs showed that the seeds that had been exposed to 320 A. flavus spores and had been treated with 125 mg/mL ZnO-CuO NPs had the shortest root length (104 mm), and the chlorophyll content index of these seeds was the lowest (0.54) (

Table 4. Effects of AFB1 and ZnO-CuO NPs on seed performance.

NPS (mg/mL)	AFB1/Spores	Final Germination Percentage (%)	Root Length (mm)	Shoot Length (mm)	Seedling Length (mm)	Seedling Vigour Index	Root–Shoot Ratio	Chlorophyll Content Index
0	0	100 a	147.3 ab	114.1 a	261.4 a	26,138 a	1.29 bcde	1.57 a
	40 ppb	89.3 ab	142.2 bc	101.4 abcde	243.5 bc	23,195 ab	1.4 abcd	1.18 b
	320 ppb	48 h	109 gh	90.7 def	199.7 def	23,277 ab	1.21 de	0.67 def
	40 spores	80 bcde	135.7 cd	101.3 abcde	236.9 c	22,313 ab	1.34 bcde	1.19 b
	320 spores	53.3 gh	108.2 gh	86.4 f	194.6 ef	21,766 bc	1.27 cde	1.15 b
5	0	88 abc	153.4 a	110.8 ab	263.9 a	18,720 cd	1.39 abcd	0.79 cd
	40 ppb	77.3 bcde	144.6 b	97.6 bcd	242.2 bc	18,616 cd	1.48 abc	0.78 cd
	320 ppb	57.3 fgh	128.1 e	86.5 f	214.6 d	21,447 bc	1.49 abc	0.77 cd
	40 spores	82.7 bcd	143 b	102.1 abcd	245.4 bc	9552 f	1.4 abcd	0.88 c
	320 spores	57.3 fgh	112.8 g	88.8 ef	201.6 de	12,314 f	1.39 abcd	0.72 cde
25	0	90.7 ab	145.9 b	110.8 ab	256.7 ab	13,659 ef	1.32 bcde	0.55 fg
	40 ppb	76 bcde	140.9 bc	104.1 abc	245 bc	18,738 cd	1.35 bcde	0.8 cd
	320 ppb	76 bcde	108.4 gh	94.1 cdef	202.5 de	18,929 cd	1.15 e	0.83 cd
	40 spores	69.3 defg	133.8 de	105.1 abc	238.9 c	20,289 bcd	1.27 bcde	0.61e fg
	320 spores	80 bcde	113.5 g	72 g	185.5 fg	16,558 de	1.58 a	0.85 c
125	0	86.7 abc	144.2 b	113 a	257.2 ab	20,234 f	1.28 bcde	0.49 g
	40 ppb	88 abc	143 b	101.4 abcde	243.8 bc	10,381 f	1.41 abcd	0.61 efg
	320 ppb	90.7 ab	120.7 f	86 f	206.7 de	10,746 f	1.41 abcd	0.68 def
	40 spores	82.7 bcd	142.9 b	102.1 abcd	244.9 bc	11,891 f	1.4 abcd	0.68 def
	320 spores	72 cdef	104.9 h	71.5 g	176.4 g	12,314 f	1.5 ab	0.54 fg
Significance		**	**	**	**	**	**	**
HSD		11.1	12.3	3.97	3.46	1316.7	6.31	41.6
CV%		9.08	2.17	5.74	2.94	10.1	7.04	8.63

Note: Mean values within the same column followed by different letters indicate significant differences (p < 0.05; Tukey’s HSD). ** significant at p < 0.01; CV% = coefficient of variance; and HSD = honestly significant difference.

). However, the seeds that had been exposed to 320 ppb AFB1 and had been treated with 25 mg/mL ZnO-CuO NPs had the highest root–shoot ratio (1.58). In the interaction effects of AFB1 and ZnO-CuO NPs on seed performance, highly significant differences (p < 0.05) were found. The seeds that had been exposed to 320 ppb and had been treated with 125 mg/mL ZnO-CuO NPs showed the highest final germination percentage (90.7%), while the lowest final germination percentage (48%) was observed in the seeds that had been exposed to 320 ppb AFB1 and had not been treated with ZnO-CuO NPs. Highly significant differences (p < 0.05) were also found in the chlorophyll content index and seedling vigour index of the seeds without AFB1 but treated with 25 mg/mL ZnO-CuO NPs, which showed the lowest chlorophyll content index and seedling vigour index of 1.4 and 95.6, respectively.

3.5. AFB1 Concentration in Plumule and Radicle

The results showed that AFB1 and A. flavus spores significantly (p < 0.05) influenced the individual and total AF concentrations in the plumule and radicle.

Table 5. The main effects of AFB1 and A. flavus fungus spores on the distribution of AFs in the plumule and radicle cytoplasm of maize.

AFB1/Spores	Radicle				AFB1/Spores	Plumule
	AFG1 (ppb)	AFB2 (ppb)	AFB1 (ppb)	AF Total (ppb)		AFG2 (ppb)	AFG1 (ppb)	AFB2 (ppb)	AFB1 (ppb)	AF Total (ppb)
0	0.0 b	0.37 c	17.9 c	18.3 c	0	0.01 ab	0.32 a	0.0 a	0.39c	0.72c
40 ppb	0.0 b	1.51 b	50.1 b	51.6 b	40 ppb	0.07 a	0.66 a	0.17 a	1.99 a	2.88 a
320 ppb	0.0 b	1.96 a	67.5 a	69.5 a	320 ppb	0.03 ab	0.30 a	0.16 a	1.28 b	1.77 b
40 spores	0.13 a	1.61 b	52.8 b	54.6 b	40 spores	0.0 b	0.67 a	0.27 a	1.91 a	2.84 a
320 spores	0.0 b	1.64 b	49.9 b	51.5 b	320 spores	0.0 b	0.50 a	0.23 a	0.94 a	1.66 b
Significance	**	**	**	**	Significance	**	NS	NS	**	**
f-value	440.0	156.7	99.0	154.5	f-value	2.83	8.69	1.78	13.1	18.4
HSD	0.01	0.21	6.42	6.55	HSD	0.06	0.41	0.31	0.56	0.61

Note: Mean values within the same column followed by different letters indicate significant differences (p < 0.05; Tukey’s HSD). NS = not significant at p > 0.05; ** p < 0.01; HSD = honestly significant difference.

shows the presence of all major types of aflatoxins (AFs)—AFB1, AFB2, AFG1, and AFG2—and this was indicated in our study by the peaks in the chromatograms compared to the one for the aflatoxin total standard (Annex S7 in Supplementary Materials). AFG2 was not detected in the radicle, whereas it was detected in the plumule which had been treated with AFB1 (0.07 and 0.03 ppb) and in the control (0.01 ppb). The HPLC analysis also showed that AFB1 was significantly (p < 0.05) dominant in the radicle (67.5 ppb) treatments, as well as in the control (17.9 ppb). Although AFG2 was not detected in the radicle, the total AF in the radicle was significantly (p < 0.05) more than the total AF in the plumule.

Table 6. The main effect of green-synthesised ZnO-CuO NPs on the distribution of AFs in the plumule and radicle cytoplasm of maize.

NPs (mg/mL)	Radicle				NPs (mg/mL)	Plumule
	AFG1 (ppb)	AFB2 (ppb)	AFB1 (ppb)	AF Total (ppb)		AFG2 (ppb)	AFG1 (ppb)	AFB2 (ppb)	AFB1 (ppb)	AF Total (ppb)
0	0.0 b	2.33 a	67.2 a	69.5 a	0	0.02 b	0.17 c	0.66 a	1.83 a	2.68 a
5	0.10 a	1.20 b	37.2 c	38.4 c	5	0.07 a	0.43 bc	0.0 b	1.41 ab	1.91 b
25	0.0 b	1.07 b	40.6 c	41.7 c	25	0.0 b	0.84 a	0.0 b	1.11 b	1.96 b
125	0.0 b	1.20 b	47.8 b	49.1 b	125	0.01 b	0.54 ab	0.0 b	0.95 b	1.5 b
Significance	**	**	**	**	Significance	**	**	**	**	**
f-value	444.8	169.0	150.8	102.6	f-value	6.06	9.65	24.1	9.40	14.2
HSD	0.01	0.18	5.38	5.50	HSD	0.05	0.34	0.26	0.47	0.51

Note: Mean values within the same column followed by different letters indicate significant differences (p < 0.05; Tukey’s HSD). ** significant at p < 0.01; HSD = honestly significant difference.

shows that the control had the highest concentration of AFB1 (67.2 ppb) compared to the seeds that had been treated with ZnO-CuO NPs in the radicle. The interaction effects of AFB1 and ZnO-CuO NPs indicated that no AFG2 had been detected in neither the plumule nor the radicle (Figure 5 and Figure 6). Highly significant differences (p < 0.05) were also found in the concentration of AFB2, AFB1, and AF total in the plumule, and the highest concentration was found in the plumule of the seeds that had been exposed to 40 spores/mL and not treated with ZnO-CuO NPs; the values were 1.06 ppb (AFB2), 3.88 ppb (AFB1), and 4.95 ppb (AF total). However, in the radicle, the seeds that had been exposed to 320 spores/mL and not treated with ZnO-CuO NPs reported the highest concentration of AFB2 (5.81 ppb), AFB1 (163.8 ppb), and AF total (169.6 ppb). It is worth noting that AFG2 and AFG1 were not detected on the radicle. The percentage recovery of AF in the radicle (93.6%) was higher than in the plumule (37.3%) (Annex S8 in Supplementary Materials).

4. Discussion

4.1. ZnO-CuO NP Characterisation

A considerable fall in the peak intensity of ZnO-CuO in the X-ray diffraction pattern, relative to the pristine samples, was visible, which could be indicative of a reduction in the crystallinity of the sample due to compositing. Similarly, in the pure nanoparticle, the patterns of the nanocomposite show no foreign peaks, thereby verifying the purity of ZnO-CuO hybrid NPs [58]. In addition, the elemental evaluation derived from the EDX spectrum and the mapping spectra of ZnO-CuO hybrid NPs provided essential information on the composite, therefore indicating the presence of Cu, Zn, and O. These analyses confirmed the successful synthesis of the Pleurotus ostreatus spent mushroom substrate extract, obtaining ZnO-CuO hybrid NPs, to form a heterojunction system.

4.2. Molecular Identification and Characterisation of A. flavus Spores Using PCR

An internal transcribed spacer (ITS) is a segment of the nuclear ribosomal repeat unit that has emerged as the principal genetic marker in numerous fungal species for molecular identification and other species-level investigations. In this study, all four analysed samples were identified as 99–100% similarity to A. flavus and A. oryzae, confirming that the fungal strain used in this study was indeed Aspergillus flavus. In a similar manner, Refs. [59,60] recorded aflM-ver PCR amplicons of an appropriate size for the region (600 bp), also indicating similarity to A. flavus.

4.3. Antifungal Activity

The results showed that the inhibitory effect of ZnO-CuO hybrid NPs was most significant at a 0.5 ppm concentration. This means that Pleurotus ostreatus substrate extract-synthesised ZnO-CuO hybrid NPs had a profound effect on four fungal strains—Aspergillus flavus, Aspergillus parasiticus, Aspergillus niger, and Fusarium graminearum. Similarly, Ref. [61] reported that CuO NPs synthesised from a leaf extract of Ligustrum lucidum had an inhibitory effect against antifungal activity that was most significant at higher concentrations (1 ppm) on these fungal strains (A. flavus, A.niger, F. oxysporum, and T. harzianum). This is due to CuO from the ZnO-CuO nanohybrid, which interacts with microbes in several different ways. Some of these include cell death-causing processes such as membrane lipid peroxidation, protein modification, nucleic acid denaturation, and cell membrane permeabilisation [61]. The percentage inhibition of hybrid ZnO-CuO NPs against A. niger was most significant at a 0.5 ppm concentration of the former. In addition, fused mycelium inhibition was higher at a 1 ppm concentration, as opposed to 0.5 ppm, for all fungal species examined. These results agree with the authors of Ref. [62], who reported that the minimum inhibitory concentrations observed for Ce-doped Fe₂O₃ NPs and amphotericin indicated greater efficacy in inhibiting the growth of fungal organisms in the mycelium. This might have been caused by the ZnO NPs in the hybrid ZnO-CuO NPs, which produced an excessive amount of ROS, demonstrating greater antifungal activity against A. flavus mycelium growth [63].

4.4. Effects of AFB 1 and A. flavus Spores on Seed Germination

The results showed a significant increase in the number of days taken by the maize seeds to germinate. This insightful effect was caused by the application of 320 ppb AFB1 and 320 fungal spores/mL, which resulted in a reduction in the germination percentage. Similarly, Ref. [64] found that the highest inhibition (50%) of Glycine max seed germination occurred after 72 hr at a concentration of 10 µg AFB1/mL. This was also similar to the findings of [65], who reported an observable decrease in the percentage of maize seed germination and a decline in the shoot and root lengths of maize seedlings planted in soil contaminated with 20 mL/pot A. flavus. The results also showed that, in terms of plant physiological processes, the seeds that had been exposed to 320 ppb AFB1 presented significantly decreased plumule strength and seedling vigour indices. This was similar to the findings of [66], who reported that the root length for soy bean seeds sown for 48 h in 11.60 μg/mL AFB1 was decreased by 35% compared to the control. This study agrees with [67], who reported that a concentration of 10 μg AFB1 per ml inhibited the in vivo synthesis of RNA by less than 10% and the RNA polymerase reaction by about 30%, thus decreasing the germination of maize seeds. The AFB1 exposure of contaminated seedlings could have interfered with pyrimidine and purine nucleosides and hindered the production of proteins by creating conjugates with DNA, RNA, and proteins, resulting in the inhibition of seed germination, specifically root and hypocotyl elongation [68,69,70]. This could be due to an increase in dictyosomes and their byproducts in plant cells, which are known to play a role in the development of cell walls; hence, cell wall disintegration caused by aflatoxin may explain the decrease in the seed germination percentage and the reduction in the shoot length [71].

4.5. Effect of ZnO-CuO Hybrid NPs on Seed Germination and Growth Indices

Maize seeds’ exposure to 125 mg/mL green-synthesised ZnO-CuO nanoparticles had a significant (p < 0.05) effect on the final seed germination%, shoot length, seedling vigour index, and root–shoot ratio. These results were similar to the findings of [72], which indicated a significant increase in the shoot length and enhanced seed germination after Hordeum vulgare L. seeds’ exposure to 4.65 µg/mL selenium nanoparticles. Instead, Ref. [73] reported a significantly decrease in the germination of crops like cucumber, lettuce, rice, and radish, caused by CuO NPs. This effect might have been the result of the hydroxyl group and hydrogen bond achieved by ZnO/CuO hybrid nanoparticles due to being green-synthesised [41]. These featured enhanced the nanoparticles, allowing AFB1 to be adsorbed in seedling plant tissues through -OH [41]. Asghar et al. [74] also reported that the rate of AFB1 adsorption improved with increasing amounts of NPs. The mycelium and fruiting bodies of Pleurotus ostreatus contain various metabolites, such as polysaccharides, proteins, and phenolics, which can act as effective reducing agents in the synthesis of nanoparticles [75]. These bioactive compounds facilitate the reduction of metal ions into nanoparticles, which then increase these hybrid nanoparticles’ ability to adsorb AFs [76]. Surprisingly, the results reported a significant (p < 0.05) decrease in the root length of the seeds treated with 125 mg/mL green-synthesised ZnO/CuO hybrid nanoparticles after being exposed to 320 A. flavus spores/mL. These findings disagreed with the authors of [77], who showed the inhibitory effect of 180 μg/mL silver NPs on A. parasiticus growth in a micro-bioassay. This could indicate that growth and aflatoxin production by aflatoxigenic spores was not inhibited by the application of 125 mg/mL green-synthesised ZnO/CuO hybrid nanoparticles. In addition, the chlorophyll content of the plumule that had been exposed both to AFB1 and the spores was significantly decreased by the treatment with 125 mg/kg green-synthesised ZnO/CuO hybrid nanoparticles. This study agrees with the authors of [78], whose findings indicated that a concentration of magnetite nanoparticles between 20 and 50 mg/L significantly increased growth and chlorophyll content in Pseudostellaria heterophylla plants. This might have been caused by enhanced exposure to green-synthesized hybrid NPs concomitant to a decrease in the chlorophyll content, in a concentration-dependent manner, possibly resulting from the polymerisation of chromosomal nucleic acid by ZnO-CuO hybrid nanoparticles [79].

4.6. Effect of AFB1 and A. flavus Spores on AF Concentration in Plumule and Radicle

The objective of this study was to evaluate the effects of green-synthesised ZnO-CuO hybrid nanoparticles on maize germination for seeds contaminated with AFB1 and A. flavus fungus, alongside their concentration on the radicle and plumules after germination. The results showed that more AFB1 was detected on the radicles and plumules that had been exposed to 320 ppb AFB1 compared to 320 A. flavus spores/mL. These finding correspond to those of [31], reporting that, after 14 days of placing maize seeds into AFB1, this substance was was extracted and detected in the roots. This may be due to the fact that the radicle serves several important functions in germination and early seedling development that are influential for maize establishment and seedling vigour, such as absorption and nutrient uptake [80,81]. These results were also in line with the ones in [82], where plants’ apoplastic mechanism of translocation were demonstrated to play a crucial role in providing seedlings with the necessary resources for growth and development. Thus, this could be the reason why the radicle had higher AFB1 and AF total concentrations than the plumule. The results showed that 125 mg/mL green-synthesised ZnO-CuO NPs significantly increased the concentration of AFB1 and total AFs detected in the radicle. These results are similar to those in [83], showing the effects of the adsorption of 100 ng/mL AFB1 on the interaction with 5 mg/mL synthesised metal NPs, which was found to gradually decrease as the initial concentration of AFB1 increased. The reduction in the AF concentration in the radicle after the application of the ZnO-CuO green nanoparticles may have been caused by particular functional groups from plants, present on the surface of the NPs and possibly responsible for the higher effectiveness [84]. Furthermore, the NPs’ reduced size made it easier for them to pass through the fungal cell wall, ultimately causing the cells to die, thus reducing the number of spores producing AFB1 [84]. Aflatoxin identification, determination, well-performed extraction, and recovery outcomes were determined to be between 37.3 and 93.6%, which is an acceptable level [85].

5. Conclusions

The results of this study indicated that maize seeds’ exposure to AFB1 at a 40 ppb concentration does not have a significant effect on their germination performance; however, their exposure to 320 ppb AFB1 has a deleterious effect on the seed quality. Also, exposing maize seeds to Aspergillus flavus spores compromises their quality if green-synthesised, thus decreasing the germination percentage and seedling growth. AFs, especially AFB1, were detected in the radicle and plumule that had been exposed to 320 ppb AFB1; this means that AFB1 can be absorbed from the soil into plant tissues. Thus, the findings of this study provide hope that this problem could be solved by the use of green-synthesised ZnO-CuO hybrid NPs. This is important, especially since maize seeds’ exposure to green-synthesised ZnO-CuO nanoparticles at a concentration of 125 mg/mL had a significant effect on the final seed germination%, shoot length, seedling vigour index, and root–shoot ratio. ZnO-CuO nanoparticles also had an inhibitory effect on four fungal strains, thus presenting a viable strategy for enhancing maize seed germination, crop growth, and development under aflatoxin contamination, combining antifungal action with potential phyto-protective benefits. This research emphasises the importance of innovative biocontrol solutions in ensuring food safety and security, although there is a need to conduct further tests on the effect of AFB1 and A. flavus and determine how the use of green-synthesised ZnO-CuO nanoparticles could control AFs throughout the lifecycle of maize.