Caveolin-1 rs1997623 Single Nucleotide Polymorphism Creates a New Binding Site for the Early B-Cell Factor 1 That Instigates Adipose Tissue CAV1 Protein Overexpression

Abstract

Caveolin-1 (CAV1) is implicated in the pathophysiology of diabetes and obesity. Previously, we demonstrated an association between the CAV1 rs1997623 C > A variant and metabolic syndrome (MetS). Here, we decipher the functional role of rs1997623 in CAV1 gene regulation. A cohort of 38 patients participated in this study. The quantitative MetS scores (siMS) of the participants were computed. CAV1 transcript and protein expression were tested in subcutaneous adipose tissue using RT-PCR and immunohistochemistry. Chromatin immunoprecipitation assays were performed using primary preadipocytes isolated from individuals with different CAV1 rs1997623 genotypes (AA, AC, and CC). The regulatory region flanking the variant was cloned into a luciferase reporter plasmid and expressed in human preadipocytes. Additional knockdown and overexpression assays were carried out. We show a significant correlation between siMS and CAV1 transcript levels and protein levels in human adipose tissue collected from an Arab cohort. We found that the CAV1 rs1997623 A allele generates a transcriptionally active locus and a new transcription factor binding site for early B-cell factor 1 (EBF1), which enhanced CAV1 expression. Our in vivo and in vitro combined study implicates, for the first time, EBF1 in regulating CAV1 expression in individuals harboring the rs1997623 C > A variant.

1. Introduction

Caveolin-1 (CAV1) is an integral protein of caveolae. Caveolae are cholesterol-rich, smooth invaginations of the plasma membrane that partition into raft fractions. They are implicated in several essential cellular functions, such as endocytosis, transcytosis, maintenance of plasma membrane integrity, lipid homeostasis, signal transduction, and mechanoprotection [1]. The roles of caveolae and CAV1 in physiological and pathophysiological homeostasis have been extensively discussed [1,2]. CAV1 expression in adipose tissues (AT) is augmented in obese individuals with or without diabetes [3]. Moreover, elevated levels of CAV1 expression are seen in individuals with high abdominal circumference and obesity compared to healthy individuals [4].

The CAV1 gene is 36 kb long and has three exons that produce eight transcripts. The default transcript, which is biologically relevant and highly conserved, encodes an active 178 aa protein. Multiple long noncoding RNAs are transcribed upstream or downstream of the CAV1 gene, but their effects on CAV1 gene regulation or expression are unknown at this time. CAV1 is differentially regulated depending on the cell type. Boopathi et al. found that GATA-6 might exert transcriptional repression of CAV1 gene expression in human samples and murine models of bladder smooth muscle hypertrophy [5]. Park et al. showed that prolactin, via a Ras-dependent mechanism, negatively regulates CAV1 gene expression in the mammary gland during lactation [6]. TLR signaling was also shown to be important for CAV1 gene expression in human umbilical vein endothelial cells [7]. CAV1 expression can also be regulated by a variety of microRNAs. MiR-124a has been shown to activate CAV1 in podocytes [8], miR-375 to downregulate CAV1 gene expression, and miR-204 to target CAV1 mRNA and decrease its expression in endothelial cells [9]. CAV1 was identified as a target gene for miR103 and miR107 by Trajkovski et al. [10]. Their inactivation increases CAV1 expression in adipocytes, which improves IR maintenance, insulin signaling, adipocyte size, and glucose uptake.

Little is known about CAV1 regulation in adipocytes; single nucleotide polymorphisms (SNPs) in the CAV1 gene have been associated with metabolic syndrome (MetS), which is a major risk factor for diabetes and coronary artery disease. Several CAV1 SNPs were found to be associated with MetS, including rs926198 in Caucasians and Hispanics [11], rs3807989 in Han Chinese [12], rs11773845 in Latin Americans [13], rs3807992 in Persians [14], and rs1997623 in Kuwaiti children, as shown in our previous study [15], and as found in another adult population [16]. Although central obesity is a landmark trait for the diagnosis of MetS, the full spectrum of traits relating to MetS includes various other metabolic factors related to hypertension, diabetes, and dyslipidemia. Thus, evaluating the levels of CAV1 protein expression in individuals with varying MetS scores, and not just central obesity, could be insightful.

Herein, we suggest how a single nucleotide change in the 5′ untranslated region of CAV1 can affect lipid metabolism. The variant rs1997623 is located within transcription factors’ binding sites in the upstream regulatory region of the CAV1 gene. According to in silico analysis, this locus is targeted by multiple transcription factors, with the top two hits being activating protein-2 alpha (AP-2α) and early B-cell factor 1 (EBF1). Aside from the fact that AP-2α is expressed in preadipocytes and is suppressed during adipogenesis [17], little is known about its role in obesity or the metabolic syndrome. Meanwhile, EBF1 is known to play an important role in lipid metabolism [18] and is highly expressed in adipose tissue [19], but no link between EBF1 and CAV1 has ever been established prior to this study.

None of the earlier studies have attempted to elucidate the mechanism by which CAV1 variants induce MetS; therefore, in this study, we first evaluated the expression levels of CAV1 in AT from adult individuals with differing MetS scores. Second, we investigated the mechanism by which the rs1997623 SNP regulates CAV1 gene expression using functional assays for transcription factor binding, chromatin accessibility, and gene knockdown.

2. Materials and Methods

2.1. Ethics Statement

The study protocol was approved by the Ethical Review Committee of the Dasman Diabetes Institute, ensuring compliance with the guidelines of the Declaration of Helsinki and the US Federal Policy for the Protection of Human Subjects (project # RA CB-2021-007). Written informed consent was obtained from the participants prior to the collection of blood samples. The identities of the participants were protected from public exposure, and samples and data were processed anonymously.

2.2. Collection of Subcutaneous Adipose Tissue Biopsies

A cohort of 38 individuals participated in this study. AT samples (approximately 500 mg) were collected via abdominal subcutaneous fat pad biopsy using the standard surgical procedure, as described previously [20,21]. Briefly, the periumbilical area was decontaminated using alcohol gauze and was then locally anesthetized by injecting 2 mL of 2% lidocaine. A subcutaneous AT sample was collected through a small skin incision of 0.5 cm in length. The collected fat sample was further incised, rinsed in cold phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde (Fisher Scientific, Pittsburgh, PA, USA) for 24 h, and embedded in paraffin or processed for DNA extraction using the DNAeasy Blood and Tissue Kit (Qiagen, Hilden, Germany). Simultaneously, freshly collected fat samples of 50–100 mg each were also preserved in RNAlater (Invitrogen, Burlington, ON, Canada) and stored at −80 °C until use [22].

2.3. Derivation of MetS Status and siMS Score

We adopted the adult diagnosis criteria defined by the International Diabetes Federation [23] to derive the MetS status of every study participant. To be diagnosed with MetS, the patients were required to have central obesity along with two or more of the following criteria: high triglycerides (TG), low high-density lipoprotein (HDL), hypertension, or a raised fasting blood glucose (FBG) level. An individual was considered to have (i) central obesity if the waist circumference (WC) was ≥94 cm in men or ≥80 cm in women; (ii) high TG if the serum TG level was ≥1.7 mmol/L (151 mg/dL), or if the patient was taking medication to lower TG; (iii) low HDL if the serum HDL cholesterol level was <1.03 mmol/L (40 mg/dL) in men or <1.29 mmol/L (50 mg/dL) in women, or if the patient was taking medication to restore HDL levels; (iv) hypertension if systolic blood pressure (SBP) was ≥130 mm Hg, diastolic blood pressure was ≥85 mm Hg, or if the patient was undergoing treatment for hypertension; and (v) diabetes if FBG was ≥5.6 mmol/L (100 mg/dL), or if the patient had been previously diagnosed with type 2 diabetes. Furthermore, we calculated the siMS score, which is a simple and accurate method for quantifying MetS in adults, using the formula described by Soldatovic [24]: siMS score = 2 × WC/Height + FBG/5.6 + TG/1.7 + SBP/130-HDL/1.02 for men, or HDL/1.28 for women.

2.4. Immunohistochemistry

Paraffin-embedded sections (4 μm thick) of subcutaneous AT were deparaffinized in xylene and rehydrated through descending grades of ethanol (100%, 95%, and 75%) to water. Antigen retrieval was performed by placing slides in a target retrieval solution (pH 6.0; Dako, Glostrup, Denmark) in a pressure cooker, boiling for 8 min, and cooling for 15 min. After washing in PBS, endogenous peroxidase activity was blocked with 3% H₂O₂ for 30 min, and nonspecific antibody binding was blocked with 5% fat-free milk for 1 h, followed by 1% bovine serum albumin solution for 1 h. The slides were incubated at room temperature overnight with primary antibody (1:100 dilution of rabbit polyclonal anti-Caveolin-1 antibody; Cell Signaling Technology #3238s). After washing with PBS (0.5% Tween), slides were incubated for 1 h with a secondary antibody, namely, goat anti-rabbit conjugated with horseradish peroxidase (HRP) polymer chain Dako EnVision Kit from (Dako, Glostrup, Denmark) and color was developed using 3,3′-diaminobenzidine (DAB) chromogen substrate. Specimens were washed, counterstained, dehydrated, cleared, and mounted, as described elsewhere [25]. For analysis, digital photomicrographs of the entire AT sections (20X; PannoramicScan, 3DHistech, Hungary) were used to quantify the immunohistochemical staining using ImageJ software (NIH, Bethesda, MD, USA).

2.5. RNA Extraction, cDNA Synthesis, and Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR)

Total RNA was extracted from AT using the RNeasy kit (Qiagen, Valencia, CA, USA), as per the manufacturer’s instructions. cDNA was synthesized from 0.5 µg of RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA, USA). Real-time RT-qPCR was performed as previously described [26,27,28]. cDNA samples (50 ng) were amplified using TaqMan Gene Expression Master Mix (Applied Biosystems, Foster City, CA, USA) and gene-specific 20× TaqMan gene expression assays (Cav1, Hs00971716_m1; EBF1, Hs01092694_m1; GAPDH, Hs03929097_g1; Applied Biosystems, Foster City, CA, USA) on a 7500 Fast Real-Time PCR System (Applied Biosystems). Relative gene expression was calculated using the comparative cycle threshold (C_T) method, as previously described [20,29]. Results were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Mean ± standard error of the mean (SEM) values are shown expressed as fold changes in expression relative to controls, as indicated [30].

2.6. DNA Constructs and Mutagenesis

Human DNA fragments of the CAV1 regulatory fragment locus (250 bp) were amplified using PCR with the Advantage–GC cDNA PCR kit (Clontech, TakaraBio, Mountain View, CA, USA). They were sub-cloned into the appropriate restriction sites of the eukaryotic expression plasmids pRMT-Luc reporter vector (Origene, Rockville, MD, USA) and were verified by Sanger sequencing. The mutant relative to the CAV1 rs1997623 variant was generated by site-directed mutagenesis (Stratagene, La Jolla, CA, USA) following protocols previously described [31,32].

2.7. Cell Culture, DNA Transfections, and Reporter Assays

Preadipocytes, isolated from individuals with AA, CC, or AC genotypes, were purchased from (ZenBio, New York, NC, USA). Cells were plated at a density of 2000 cells/well in 96-well plates and were transiently transfected using lipofectamine LTX (ThermoFisher, Waltham, MA, USA) with pRMT-Luc-CAV1-C, pRMT-Luc-CAV1-A, or pRMT-Luc control vector with or without an EBF1 mammalian expression vector (Origene, Rockville, MD, USA). Transfection efficiency was monitored by analyzing Renilla luciferase activity, as described previously [33]. After 24 h, the cells were washed twice with ice-cold PBS, lysed, and assayed as per the Dual-Luciferase Kit protocol (Promega, Madison, WI, USA). Luciferase activity was detected using the GloMax Navigator Microplate Luminometer (Promega, Madison, WI, USA) assay. The value denoting the activity of the luciferase reporter vector in the presence of EBF1 was normalized by subtracting the value denoting the activity of the luciferase reporter alone, in the absence of EBF1. Relative luciferase units (RLUs) represent luciferase activity normalized to Renilla activity [34].

2.8. Chromatin Immunoprecipitation (ChIP) Assays

ChIP assays were performed as described previously [32], with the following minor modifications: Preadipocytes were seeded on three 175 mm tissue culture flasks at 0.5 × 10⁶ cells per flask. After 48 h, 50 mg of chromatin from each cell line was immunoprecipitated using 0.5 ug of anti-AP-2α antibodies (C83E10, 3215, Cell Signaling, Danvers, MA, USA), anti-EBF1 specific antibodies (ab221033, Abcam, Branford, CT, USA), anti-Histone-3 acetyl K14 antibodies (H3K14^ac, ab176799, Abcam, Branford, CT, USA), or nonspecific Rabbit IgG control antibodies (ab172730, Abcam, Branford, CT, USA). Briefly, cells were cross-linked with 4% formaldehyde and sonicated using a sonic dismembrator for a total of 30 times with 15-s pulses (1-min rest between the pulses), and lysates were cleared by centrifugation at 13,000 rpm for 30 min at 4 °C. The sheared chromatins were incubated with the described antibodies, and the immune complexes were captured using protein G-sepharose Dynabeads (Invitrogen, Oslo, Norway), as described previously [31]. AP-2α, EBF1, H3K14^ac, or IgG-bound chromatins were quantified as a percent of chromatin input. Quantitative PCR (qPCR) analyses were performed using the forward 5′- GAGGTGAAGAGAAGCCAGGAAT-3′ and reverse 5′- CCCAATCTCAGGACCCCAAT-3′ primers. To be considered a true association, each ChIP sample was examined for the enrichment of a chromatin locus immunoprecipitated with a specific antibody and compared with the same chromatin locus immunoprecipitated with a nonspecific IgG (p-value < 0.05). Data are presented as mean ± SEM from three independent biological experiments.

2.9. Small Interfering RNA (siRNA) Transfection and Western Blotting

Before siRNA transfection, the pre-adipose cells were seeded on 6-well cell culture plates to achieve 70–80% confluency. After 24 h, combination EBF1 or scramble siRNAs (Santa Cruz, Dallas, TX, USA) were transfected with the lipofectamine LTX transfection reagent (1.5 μL/well). In each well, siRNAs were mixed to produce a final concentration of 100 pmol/well. Appropriate controls for treatment and nontreatment were also included, followed by 24 h of incubation. Total RNA was isolated and real-time qPCR was performed, as previously described, using the following primers: EBF1 Primers 5′-GTTTGTGGGGTTCGTGGAGA-3′, and 5′-CTGGGTTCTTGTCTTGGCCT-3′; CAV1 primers 5′-CGACCCTAAACACCTCAACGATG-3′ and 5′-GCAGACAGCAAGCGGTAAAACC-3′; and GAPDH1 primers 5′-CACTGGCGTCTTCACCACCATG-3′ and 5′-GCTTCACCACCTTCTTGATGTCA-3′.

Western blot analysis was performed, as described previously [30]. Briefly, cells were harvested and lysed in RIPA buffer. Cell lysates were quantified using the Quickstart Bradford assay (Bio-Rad Laboratories, Hercules, CA, USA), and equal amounts of protein were resolved on 8–12% polyacrylamide gels and transferred to nitrocellulose membranes (Bio-Rad Laboratories, Hercules, CA, USA). After blocking, the membranes were blotted with the following primary antibodies: EBF1 (ab108369, Abcam, Branford, CT, USA), CAV1 (3238s, Cell Signaling, Danvers, MA, USA), and b-actin (4970L, Cell Signaling, Danvers, MA, USA), and the corresponding HRP-linked secondary antibody (7074P2, Cell Signaling, Danvers, MA, USA). Proteins were visualized using the SuperSignal West Femto ECL kit (Thermo Scientific, Rockford, IL, USA). Images were captured using the ChemiDoc MP imaging system (Bio-Rad Laboratories, Hercules, CA, USA).

2.10. Pyrosequencing and Sanger Sequencing

Bisulfite conversion of genomic DNA (≥30 ng/µL) was performed using the EpiTect Fast Bisulfite Conversion Kit (Qiagen, Hilden, Germany), following the manufacturer’s protocol. Site-specific amplification of converted DNA was carried out using custom-designed CAV1 primers (F1: AGGTGAACAGAAGTTAGGAATGTTT; R1: CCAATCTCAAAACCCCAATCC; sequencing primer: AAGTTAGGAATGTTTTATGT), and a Pyromark PCR kit on a thermal cycler programmed for an initial denaturation of 15 min at 95 °C, 45 cycles of (94 °C for 30 s, 56 °C for 30 s, and 72 °C for 30 s), followed by a final extension of 10 min at 72 °C. The resulting biotinylated PCR product (10 µL) and magnetic beads (3 µL) were pipetted into Q48 discs, and pyrosequencing was performed using the PyroMark Q48 Autoprep (Qiagen, Hilden, Germany), as per the manufacturer’s instructions. The same converted DNA was amplified and sequenced using conventional Sanger sequencing (ABI Prism 3730XL Genetic Analyzer, Applied Biosystems, Foster City, CA, USA), as previously described [35].

3. Results

3.1. MetS Score Correlates with CAV1 Transcript and Protein Levels in Human AT

We aimed to examine whether in vivo CAV1 expression is associated with MetS; therefore, we evaluated the mRNA and protein levels of CAV1 in subcutaneous ATs isolated from 38 individuals with differing MetS scores (siMS). As observed in Figure 1A, a moderately positive and statistically significant correlation was observed between CAV1 mRNA expression levels in AT and the MetS score status of the individuals studied. Using immunohistochemistry, we demonstrated that CAV1 proteins are in parallel with their mRNA expression in subcutaneous ATs isolated from individuals with a high siMS score [2,3,4] and a BMI > 30 (obese), as compared to individuals with a low siMS score [1,2] and a BMI < 25 (lean) (Figure 1B,C). Unfortunately, we did not have enough material from these individuals to perform SNP genotyping. Therefore, we directly proceeded to functionally assess the role of SNPs in CAV1 expression.

3.2. CAV1 rs1997623 Alters the Transcription Factor Binding Site Motif and Mediates EBF1 Binding

Given the potential significance of these findings, we studied the association between the CAV1 variant rs1997623 and CAV1 transcriptional regulation in adipocytes in greater detail. It is worth noting that the transcriptional regulation of CAV1 is complex. Locus mapping analysis revealed that the CAV1 rs1997623 C > A variant spans the CAV1 proximal regulatory region (Supplementary Figure S1). Therefore, we hypothesized that the rs1997623 variant modifies CAV1 gene regulation by altering the transcription factor binding site.

To identify the transcriptional regulation factor(s), we examined the immediate 21 bp flanking the variant locus using the bioinformatic database for transcription factor finder (TFBIND INPUT) [36]. The software predicted that the transcription factor AP-2α was a likely candidate that binds to the cis-element spanning the rs1997623-C wild-type variant (Supplementary Figure S1). Next, we evaluated the binding of AP-2α to the wild-type rs1997623-C or the variant rs1997623-A using ChIP performed on preadipocytes isolated from individuals with either homozygous AA, homozygous wild-type CC, or heterozygous AC genotypes at the rs1997623 locus. Antibodies directed against AP-2α showed 8-fold chromatin enrichments in cells with the CC genotype relative to nonspecific IgG (Figure 2A). In contrast, no precipitation was observed using chromatins from cells with AA and AC genotypes, indicating the absence of AP-2α protein binding. We then wondered if any other transcription factor favored the binding of the cis-element spanning rs1997623-A. Similar bioinformatics analyses suggested EBF1 as a possible candidate (Supplementary Figure S1). We tested this premise via ChIP analysis using a specific antibody directed against EBF1. The data showed significant enrichment in chromatin from cells with AA or AC genotypes but not the wild-type CC (Figure 2B). Collectively, these results suggest that EBF1 replaced AP-2α in the presence of the rs1997623-A variant.

The binding of either of the transcription factors to the corresponding DNA cis-element indicates a transcriptionally active site. Therefore, we next determined if histone acetylation levels were changed at the rs1997623 locus. ChIP assays were performed with antibodies against acetylated lysine 14 at histone 3 (H3K14^ac), indicative of actively transcribed chromatin. Notably, the binding of AP-2α to the rs1997623-C locus or EBF1 to the rs1997623-A locus correlated with elevated H3K14 acetylation, suggesting a putative active transcription in this region (Figure 2C). We then tested CAV1 promoter methylation by pyrosequencing; the analysis showed nonsignificant (2–5%) methylation independent of the genotype. This indicates that the rs1997623-C locus is unmethylated and excludes this cytosine as a methylation-based regulated nucleotide (Supplementary Figure S2).

3.3. CAV1 rs1997623 Causes Induced Promoter Activity at its Locus

Next, we studied the effect of this SNP on promotor activation by cloning 250 bp of the CAV1 regulatory region flanking the rs1997623 variant into a luciferase reporter construct (named wild-type, CAV1-C-Luc) and generating a single mutation C > A (named CAV1-A-Luc) equivalent to the CAV1 rs1997623-A variant, as described in the Materials and Methods section (Figure 3A). Preadipocytes were transfected with CAV1-C-Luc or CAV1-A-Luc constructs separately. As shown in Figure 3B, luciferase reporter activity was detected in both constructs (dashed bars); however, the expression was significantly higher in CAV1-A-Luc (1.6-fold relative to CAV1-C-Luc, p = 0.003). To demonstrate the influence of EBF1 on driving the expression further, we co-transfected CAV1-C-Luc or CAV1-A-Luc with constructs that overexpressed EBF1. Our data showed a 2.5-fold increase in the reporter activity of construct CAV1-A-Luc compared to CAV1-C-Luc alone (p = 0.001; Figure 3B, black bars).

Taken together, the above results indicate that the promoter located in the 250 bp of the CAV1 regulatory region is transcriptionally active in preadipocytes and that its activity is further enhanced in the presence of the CAV1 rs1997623-A construct that attracted endogenous or overexpressed exogenous EBF1.

3.4. EBF1 siRNA Reduces the Expression of CAV1 in PreAdipocytes

Having shown that EBF1 binds the rs1997632-A allele and induces a more rigorous expression, we next sought to determine whether silencing EBF1 could reduce CAV1 gene expression in the preadipocyte model. To investigate this, we studied the expression of CAV1 before and after lowering EBF1 levels using siRNA technology (Figure 4). Transfection with EBF1 siRNA reduced both EBF1 and subsequently the CAV1 gene transcripts by 50–60% compared to the control cells (Figure 4A). These data were further confirmed using Western blot analysis. EBF1 siRNA specifically reduced CAV1 expression in preadipocytes with AA and AC genotypes at the CAV1 rs1997623 variant locus, as shown in Figure 4B,C, implying a direct association between EBF1 and CAV1 expression levels in these cells.

4. Discussion

CAV1 is known to regulate hepatic lipid accumulation, lipid and glucose metabolism, mitochondrial energy homeostasis, and hepatocyte proliferation by modulating several molecular pathways [37]. Thus, the dysregulated expression of CAV1 has several avenues that could lead to MetS. Our study examines, for the first time, the promoter regulatory feature of the rs1997623 variant of CAV1 through functional assays. Our results demonstrate that the CAV1 SNP, located in the gene regulatory region, alters the transcription consensus site to favor EBF1 binding. Moreover, our functional study indicated an increase in promoter activity through the generation of an active binding site for the transcription factor EBF1 and sustained active transcription by maintaining open chromatin for the recruitment of EBF1 to the CAV1 upstream regulatory region in human adipocytes. Our findings are summarized in Figure 5.

As per the Ensembl genome annotation system [38], the studied variant overlaps nine transcript isoforms of CAV1 (Supplementary Tables S1 and S2). CAV1 has five protein isoforms of different lengths, ranging from 86 to 178 amino acids (Supplementary Table S1). Depending on the transcript and protein isoform, rs1997623 is treated as a missense (leading to amino acid change), synonymous (leading to no change in amino acid) mutation, or an intronic or an upstream gene variation. Further, the Ensembl genome annotation system annotates the studied variant as a regulatory region variant within the promoter (Supplementary Table S2).

Previously, EBF1 has been implicated in promoting adipogenesis and controlling genes involved in terminal adipocyte differentiation [39]. These functional insights into the involvement of CAV1 genetic variant rs1997623 further strengthen the concept that CAV1 contributes to MetS susceptibility and represents an attractive molecular target for the prevention and treatment of MetS. The mechanisms behind the contribution of CAV1 protein to MetS are poorly understood. An attractive model that we have previously shown suggests a link between CAV1 protein overexpression and the promotion of cellular senescence [40]. This model, along with others, is currently under investigation in our laboratory.

The following caveats should be considered when interpreting our results: First, we focused on the Kuwaiti population alone, and the results may not apply to other ethnic groups. Second, as shown in Figure 2, homozygous cells (rs1997623 AA) appear to bind less EBF1 than heterozygotes, which needs to be explained further. However, this phenotypic heterogeneity may stem from using preadipocytes from different individuals.

5. Conclusions

The current study was based on our previous discovery of a significant association between rs1997623-A and MetS in children [15]. We found that increasing MetS scores correlated with higher in vivo CAV1 expression levels in human AT. The regulation of the CAV1 rs1997623-A locus in preadipocytes could be influenced, at least partly, by the recruitment and allele-specific binding of the EBF1 transcription factor.