Exploring the Interactome of the Queuine Salvage Protein DUF2419 in Entamoeba histolytica
Abstract
:1. Introduction
2. Materials and Methods
2.1. E. histolytica Culture
2.2. Construction of the Myc-Tagged EhDUF2419 (MycEhDUF2419) or Truncated EhDUF2419 Vector (MycTrunEhDUF2419)
2.3. Transfection of E. histolytica Trophozoites
2.4. Quantitative Real-Time PCR (qRT-PCR)
2.5. Western Blot Analysis
2.6. Immunoprecipitation
2.7. In-Gel Proteolysis and MS Analysis
2.8. PANTHER Classification System
2.9. Ribosome Purification
2.10. Assessment of Protein Synthesis Through Surface Sensing of Translation (SUnSET)
2.11. N-Acryloyl-3-Aminophenylboronic Acid (APB) Northern Blotting for E. histolytica tRNAHisGUG
2.12. Immunofluorescence Microscopy
2.13. Statistical Analysis
3. Results
3.1. Interactome of MycEhDUF2419 in E. histolytica Trophozoites
3.2. EhDUF2419 Co-Purified with Ribosomal Proteins in the Ribosome Fraction
3.3. EhDUF2419 Interacts with Ribosomal Protein Independent of Its Catalytic Domain
3.4. EhDUF2419 Overexpression Reduces Q-tRNA Formation in Presence of Q
3.5. EhDUF2419 Is Regulated by Proteasome-Mediated Degradation Pathways
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Haque, R.; Huston, C.D.; Hughes, M.; Houpt, E.; Petri, W.A., Jr. Amebiasis. N. Engl. J. Med. 2003, 348, 1565–1573. [Google Scholar] [CrossRef] [PubMed]
- Agrawal, A.; Maitra, S.C.; Arya, A.; Sagar, P. Action of metronidazole on Entamoeba histolytica: An ultrastructural study. J. Commun. Dis. 1990, 22, 47–54. [Google Scholar] [PubMed]
- Samarawickrema, N.A.; Brown, D.M.; Upcroft, J.A.; Thammapalerd, N.; Upcroft, P. Involvement of superoxide dismutase and pyruvate:ferredoxin oxidoreductase in mechanisms of metronidazole resistance in Entamoeba histolytica. J. Antimicrob. Chemother. 1997, 40, 833–840. [Google Scholar] [CrossRef] [PubMed]
- Bansal, D.; Sehgal, R.; Chawla, Y.; Mahajan, R.C.; Malla, N. In vitro activity of antiamoebic drugs against clinical isolates of Entamoeba histolytica and entamoeba dispar. Ann. Clin. Microbiol. Antimicrob. 2004, 3, 27. [Google Scholar] [CrossRef] [PubMed]
- Katze, J.R.; Basile, B.; Mccloskey, J.A. Queuine, A modified base incorporated posttranscriptionally into eukaryotic transfer RNA: Wide distribution in nature. Science 1982, 216, 55–56. [Google Scholar] [CrossRef]
- Ott, G.; Kersten, H.; Nishimura, S. Dictyostelium discoideum: A useful model system to evaluate the function of queuine and of the Q-family of tRNAs. FEBS Lett. 1982, 146, 311–314. [Google Scholar] [CrossRef]
- Farkas, W.R. Effect of diet on the queuosine family of tRNAs of germ-free mice. J. Biol. Chem. 1980, 255, 6832–6835. [Google Scholar] [CrossRef]
- Fergus, C.; Barnes, D.; Alqasem, M.A.; Kelly, V.P. The queuine micronutrient: Charting a course from microbe to man. Nutrients 2015, 7, 2897–2929. [Google Scholar] [CrossRef]
- Nagaraja, S.; Cai, M.W.; Sun, J.; Varet, H.; Sarid, L.; Trebicz-Geffen, M.; Shaulov, Y.; Mazumdar, M.; Legendre, R.; Coppee, J.Y.; et al. Queuine Is a Nutritional Regulator of Entamoeba histolytica Response to Oxidative Stress and a Virulence Attenuator. mBio 2021, 12, e03549-20. [Google Scholar] [CrossRef]
- Muller, M.; Legrand, C.; Tuorto, F.; Kelly, V.P.; Atlasi, Y.; Lyko, F.; Ehrenhofer-Murray, A.E. Queuine links translational control in eukaryotes to a micronutrient from bacteria. Nucleic Acids Res. 2019, 47, 3711–3727. [Google Scholar] [CrossRef]
- Tuorto, F.; Legrand, C.; Cirzi, C.; Federico, G.; Liebers, R.; Muller, M.; Ehrenhofer-Murray, A.E.; Dittmar, G.; Grone, H.J.; Lyko, F. Queuosine-modified tRNAs confer nutritional control of protein translation. EMBO J. 2018, 37, e99777. [Google Scholar] [CrossRef] [PubMed]
- Zallot, R.; Yuan, Y.; De Crecy-Lagard, V. The Escherichia coli COG1738 Member YhhQ Is Involved in 7-Cyanodeazaguanine (preQ(0)) Transport. Biomolecules 2017, 7, 12. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Y.; Zallot, R.; Grove, T.L.; Payan, D.J.; Martin-Verstraete, I.; Sepic, S.; Balamkundu, S.; Neelakandan, R.; Gadi, V.K.; Liu, C.F.; et al. Discovery of novel bacterial queuine salvage enzymes and pathways in human pathogens. Proc. Natl. Acad. Sci. USA 2019, 116, 19126–19135. [Google Scholar] [CrossRef] [PubMed]
- Quaiyum, S.; Yuan, Y.; Kuipers, P.J.; Martinelli, M.; Jaroch, M.; De Crecy-Lagard, V. Deciphering the Diversity in Bacterial Transporters That Salvage Queuosine Precursors. Epigenomes 2024, 8, 16. [Google Scholar] [CrossRef]
- Patel, B.I.; Heiss, M.; Samel-Pommerencke, A.; Carell, T.; Ehrenhofer-Murray, A.E. Queuosine salvage in fission yeast by Qng1-mediated hydrolysis to queuine. Biochem. Biophys. Res. Commun. 2022, 624, 146–150. [Google Scholar] [CrossRef]
- Sarid, L.; Sun, J.; Chittrakanwong, J.; Trebicz-Geffen, M.; Ye, J.; Dedon, P.C.; Ankri, S. Queuine Salvaging in the Human Parasite Entamoeba histolytica. Cells 2022, 11, 2509. [Google Scholar] [CrossRef]
- Hung, S.H.; Elliott, G.I.; Ramkumar, T.R.; Burtnyak, L.; Mcgrenaghan, C.J.; Alkuzweny, S.; Quaiyum, S.; Iwata-Reuyl, D.; Pan, X.; Green, B.D.; et al. Structural basis of qng1-mediated salvage of the micronutrient queuine from queuosine-5′-monophosphate as the biological substrate. Nucleic Acids Res. 2023, 51, 935–951. [Google Scholar] [CrossRef]
- Zallot, R.; Brochier-Armanet, C.; Gaston, K.W.; Forouhar, F.; Limbach, P.A.; Hunt, J.F.; De Crecy-Lagard, V. Plant, animal, and fungal micronutrient queuosine is salvaged by members of the DUF2419 protein family. ACS Chem. Biol. 2014, 9, 1812–1825. [Google Scholar] [CrossRef]
- Diamond, L.S.; Harlow, D.R.; Cunnick, C.C. A new medium for the axenic cultivation of Entamoeba histolytica and other entamoeba. Trans. R. Soc. Trop. Med. Hyg. 1978, 72, 431–432. [Google Scholar] [CrossRef]
- Zhang, H.; Veira, J.; Bauer, S.T.; Yip, C.; Singh, U. RISC in Entamoeba histolytica: Identification of a Protein-Protein Interaction Network for the RNA Interference Pathway in a Deep-Branching Eukaryote. mBio 2021, 12, E0154021. [Google Scholar] [CrossRef]
- Olvera, A.; Olvera, F.; Vines, R.R.; Recillas-Targa, F.; Lizardi, P.M.; Dhar, S.; Bhattacharya, S.; Petri, W., Jr.; Alagon, A. Stable transfection of Entamoeba histolytica trophozoites by lipofection. Arch. Med. Res. 1997, 28, 49–51. [Google Scholar] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.R.; Collins, K. Physical and functional coupling of RNA-dependent RNA polymerase and Dicer in the biogenesis of endogenous siRNAs. Nat. Struct. Mol. Biol. 2007, 14, 604–610. [Google Scholar] [CrossRef] [PubMed]
- Sarid, L.; Zanditenas, E.; Ye, J.; Trebicz-Geffen, M.; Ankri, S. Insights into the Mechanisms of Lactobacillus acidophilus Activity against Entamoeba histolytica by Using Thiol Redox Proteomics. Antioxidants 2022, 11, 814. [Google Scholar] [CrossRef]
- Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008, 26, 1367–1372. [Google Scholar] [CrossRef]
- Mi, H.; Ebert, D.; Muruganujan, A.; Mills, C.; Albou, L.P.; Mushayamaha, T.; Thomas, P.D. PANTHER version 16: A revised family classification, tree-based classification tool, enhancer regions and extensive API. Nucleic Acids Res. 2021, 49, D394–D403. [Google Scholar] [CrossRef]
- Shalgi, R.; Hurt, J.A.; Krykbaeva, I.; Taipale, M.; Lindquist, S.; Burge, C.B. Widespread regulation of translation by elongation pausing in heat shock. Mol. Cell 2013, 49, 439–452. [Google Scholar] [CrossRef]
- Chavez-Rios, R.; Arias-Romero, L.E.; Almaraz-Barrera Mde, J.; Hernandez-Rivas, R.; Guillen, N.; Vargas, M. L10 ribosomal protein from Entamoeba histolytica share structural and functional homologies with QM/Jif-1: Proteins with extraribosomal functions. Mol. Biochem. Parasitol. 2003, 127, 151–160. [Google Scholar] [CrossRef]
- Hertz, R.; Tovy, A.; Kirschenbaum, M.; Geffen, M.; Nozaki, T.; Adir, N.; Ankri, S. The Entamoeba histolytica Dnmt2 homolog (Ehmeth) confers resistance to nitrosative stress. Eukaryot. Cell 2014, 13, 494–503. [Google Scholar] [CrossRef]
- Trebicz-Geffen, M.; Shahi, P.; Nagaraja, S.; Vanunu, S.; Manor, S.; Avrahami, A.; Ankri, S. Identification of S-nitrosylated (SNO) proteins in Entamoeba histolytica adapted to nitrosative stress: Insights into the role of sno actin and in vitro virulence. Front. Cell. Infect. Microbiol. 2017, 7, 192. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [PubMed]
- Igloi, G.L.; Kossel, H. Affinity electrophoresis for monitoring terminal phosphorylation and the presence of queuosine in RNA. Application of polyacrylamide containing a covalently bound boronic acid. Nucleic Acids Res. 1985, 13, 6881–6898. [Google Scholar] [CrossRef] [PubMed]
- Manders, E.M.M.; Verbeek, F.J.; Aten, J.A. Measurement of co-localization of objects in dual-colour confocal images. J. Microsc. 1993, 169, 375–382. [Google Scholar] [CrossRef] [PubMed]
- Zinchuk, V.; Grossenbacher-Zinchuk, O. Quantitative colocalization analysis of fluorescence microscopy images. Curr. Protoc. Cell Biol. 2014, 62, 4–19. [Google Scholar] [CrossRef] [PubMed]
- Hamann, L.; Nickel, R.; Tannich, E. Transfection and continuous expression of heterologous genes in the protozoan parasite Entamoeba histolytica. Proc. Natl. Acad. Sci. USA 1995, 92, 8975–8979. [Google Scholar] [CrossRef]
- Kim, T.Y.; Ha, C.W.; Huh, W.K. Differential subcellular localization of ribosomal protein L7 paralogs in Saccharomyces cerevisiae. Mol. Cells 2009, 27, 539–546. [Google Scholar] [CrossRef]
- Mccluskey, A.J.; Poon, G.M.; Bolewska-Pedyczak, E.; Srikumar, T.; Jeram, S.M.; Raught, B.; Gariepy, J. The catalytic subunit of shiga-like toxin 1 interacts with ribosomal stalk proteins and is inhibited by their conserved C-terminal domain. J. Mol. Biol. 2008, 378, 375–386. [Google Scholar] [CrossRef]
- Ren, J.; Wang, Y.; Liang, Y.; Zhang, Y.; Bao, S.; Xu, Z. Methylation of ribosomal protein S10 by protein-arginine methyltransferase 5 regulates ribosome biogenesis. J. Biol. Chem. 2010, 285, 12695–12705. [Google Scholar] [CrossRef]
- Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Zidek, A.; Potapenko, A.; et al. Highly accurate protein structure prediction with alphafold. Nature 2021, 596, 583–589. [Google Scholar] [CrossRef]
- Varadi, M.; Bertoni, D.; Magana, P.; Paramval, U.; Pidruchna, I.; Radhakrishnan, M.; Tsenkov, M.; Nair, S.; Mirdita, M.; Yeo, J.; et al. AlphaFold Protein Structure Database in 2024: Providing structure coverage for over 214 million protein sequences. Nucleic Acids Res. 2024, 52, D368–D375. [Google Scholar] [CrossRef]
- Cirzi, C.; Tuorto, F. Analysis of Queuosine tRNA Modification Using APB Northern Blot Assay. Methods Mol. Biol. 2021, 2298, 217–230. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, E.K.; Clavarino, G.; Ceppi, M.; Pierre, P. Sunset, a nonradioactive method to monitor protein synthesis. Nat. Methods 2009, 6, 275–277. [Google Scholar] [CrossRef] [PubMed]
- Makioka, A.; Kumagai, M.; Ohtomo, H.; Kobayashi, S.; Takeuchi, T. Effect of proteasome inhibitors on the growth, encystation, and excystation of Entamoeba histolytica and entamoeba invadens. Parasitol. Res. 2002, 88, 454–459. [Google Scholar] [CrossRef] [PubMed]
- Diaz-Rullo, J.; Gonzalez-Pastor, J.E. TRNA queuosine modification is involved in biofilm formation and virulence in bacteria. Nucleic Acids Res. 2023, 51, 9821–9837. [Google Scholar] [CrossRef] [PubMed]
- Perez-Arellano, I.; Gallego, J.; Cervera, J. The PUA domain—A structural and functional overview. FEBS J. 2007, 274, 4972–4984. [Google Scholar] [CrossRef]
- El Yacoubi, B.; Bailly, M.; De Crecy-Lagard, V. Biosynthesis and function of posttranscriptional modifications of transfer RNAs. Annu. Rev. Genet. 2012, 46, 69–95. [Google Scholar] [CrossRef]
- Agris, P.F.; Vendeix, F.A.; Graham, W.D. tRNA’s wobble decoding of the genome: 40 years of modification. J. Mol. Biol. 2007, 366, 1–13. [Google Scholar] [CrossRef]
- Jeltsch, A.; Ehrenhofer-Murray, A.; Jurkowski, T.P.; Lyko, F.; Reuter, G.; Ankri, S.; Nellen, W.; Schaefer, M.; Helm, M. Mechanism and biological role of Dnmt2 in Nucleic Acid Methylation. RNA Biol. 2017, 14, 1108–1123. [Google Scholar] [CrossRef]
- Muller, M.; Hartmann, M.; Schuster, I.; Bender, S.; Thuring, K.L.; Helm, M.; Katze, J.R.; Nellen, W.; Lyko, F.; Ehrenhofer-Murray, A.E. Dynamic modulation of Dnmt2-dependent tRNA methylation by the micronutrient queuine. Nucleic Acids Res. 2015, 43, 10952–10962. [Google Scholar] [CrossRef]
- Ehrenhofer-Murray, A.E. Cross-talk between Dnmt2-dependent TRNA methylation and queuosine modification. Biomolecules 2017, 7, 14. [Google Scholar] [CrossRef]
- Fuller-Pace, F.V. Dexd/H box RNA helicases: Multifunctional proteins with important roles in transcriptional regulation. Nucleic Acids Res. 2006, 34, 4206–4215. [Google Scholar] [CrossRef] [PubMed]
- Schutz, P.; Karlberg, T.; Van Den Berg, S.; Collins, R.; Lehtio, L.; Hogbom, M.; Holmberg-Schiavone, L.; Tempel, W.; Park, H.W.; Hammarstrom, M.; et al. Comparative structural analysis of human DEAD-Box RNA helicases. PLoS ONE 2010, 5, e12791. [Google Scholar] [CrossRef] [PubMed]
- Drino, A.; Konig, L.; Capitanchik, C.; Sanadgol, N.; Janisiw, E.; Rappol, T.; Vilardo, E.; Schaefer, M.R. Identification of RNA helicases with unwinding activity on angiogenin-processed tRNAs. Nucleic Acids Res. 2023, 51, 1326–1352. [Google Scholar] [CrossRef] [PubMed]
- Chimnaronk, S.; Suzuki, T.; Manita, T.; Ikeuchi, Y.; Yao, M.; Suzuki, T.; Tanaka, I. RNA helicase module in an acetyltransferase that modifies a specific tRNA anticodon. EMBO J. 2009, 28, 1362–1373. [Google Scholar] [CrossRef]
Protein | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) | Enzyme Site | Notes |
---|---|---|---|---|
EhDUF2419 | CCCCCGGGATGTGTGAATATGTTCG | CCCTCGAGTCAATAAAAAATGGTTTGTGTTCG | SmaI, XhoI | |
TrunEhDUF2419 | CCCCCGGGATGTGTGAATATGTTCG | CCCTCGAGTCAGCGATATCCTTCAATAAAT | SmaI, XhoI | |
EhDUF2419 | TCCATCTGGGTCTGAAGAAG | GTTTGTGTTCGGTGGTGTGG | qPCR | |
rDNA | TCAAAAAGCAACGTCGCTA | AGCCCGTAAGGTGATTTCT | qPCR |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ye, J.; Trebicz-Geffen, M.; Ankri, S. Exploring the Interactome of the Queuine Salvage Protein DUF2419 in Entamoeba histolytica. Cells 2024, 13, 1900. https://doi.org/10.3390/cells13221900
Ye J, Trebicz-Geffen M, Ankri S. Exploring the Interactome of the Queuine Salvage Protein DUF2419 in Entamoeba histolytica. Cells. 2024; 13(22):1900. https://doi.org/10.3390/cells13221900
Chicago/Turabian StyleYe, Jun, Meirav Trebicz-Geffen, and Serge Ankri. 2024. "Exploring the Interactome of the Queuine Salvage Protein DUF2419 in Entamoeba histolytica" Cells 13, no. 22: 1900. https://doi.org/10.3390/cells13221900
APA StyleYe, J., Trebicz-Geffen, M., & Ankri, S. (2024). Exploring the Interactome of the Queuine Salvage Protein DUF2419 in Entamoeba histolytica. Cells, 13(22), 1900. https://doi.org/10.3390/cells13221900