Next Article in Journal
CD44 Promotes Migration and Invasion of Docetaxel-Resistant Prostate Cancer Cells Likely via Induction of Hippo-Yap Signaling
Previous Article in Journal
Microbiome—Microbial Metabolome—Cancer Cell Interactions in Breast Cancer—Familiar, but Unexplored
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cells
Volume 8
Issue 4
10.3390/cells8040294
cells-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Phylogeny and Historical Biogeography of the Butterfly Tribe Aeromachini Tutt (Lepidoptera: Hesperiidae) from China

by
Yuanyuan Li
1,†,
Jianqing Zhu
2,†,
Chen Ge
1,
Ying Wang
1,
Zimiao Zhao
1,
Shuojia Ma
1,
Ary A. Hoffmann
3,
Nancy M. Endersby
3,
Qunxiu Liu
2,
Weidong Yu
1 and
Weibin Jiang
1,*
1
College of Life Sciences, Shanghai Normal University, Shanghai 200234, China
2
Shanghai Zoological Park, Shanghai 200335, China
3
School of BioSciences, The University of Melbourne, Bio21 Institute, Parkville, VIC 3052, Australia
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Cells 2019, 8(4), 294; https://doi.org/10.3390/cells8040294
Submission received: 4 March 2019 / Revised: 22 March 2019 / Accepted: 23 March 2019 / Published: 29 March 2019
(This article belongs to the Section Mitochondria)
Browse Figures
Versions Notes

Abstract

:
The butterfly tribe Aeromachini Tutt, 1906 is a large group of skippers. In this study, a total of 10 genera and 45 species of putative members of this tribe, which represent most of the generic diversity and nearly all the species diversity of the group in China, were sequenced for two mitochondrial genes and three nuclear genes (2093 bp). The combined dataset was analyzed with maximum likelihood inference using IQtree. We found strong support for monophyly of Aeromachini from China and support for the most recent accepted species in the tribe. Two paraphyletic genera within Aeromachini are presented and discussed. The divergence time estimates with BEAST and ancestral-area reconstructions with RASP provide a detailed description about the historical biogeography of the Aeromachini from China. The tribe very likely originated from the Hengduan Mountains in the late Ecocene and expanded to the Himalaya Mountains and Central China Regions. A dispersal-vicariance analysis suggests that dispersal events have played essential roles in the distribution of extant species, and geological and climatic changes have been important factors driving current distribution patterns.

1. Introduction

Butterflies have been exceptionally well studied as the subject of many taxonomic, ecological and evolutionary investigations [1]. However, the family Hesperiidae, commonly known as “skippers”, which includes around 4000 species, and has been largely ignored compared with systematic research on other butterfly families [2,3,4]. The first relatively comprehensive phylogeny of the family was inferred from three loci and morphological data for 196 genera by Warren et al. [5,6] only a decade ago and the result was mainly used to revise subfamily and tribal boundaries. Sahoo et al. [7] and Toussaint et al. [8] recently increased taxon and locus sampling and obtained a stronger support for most subfamilial and tribal level relationships. These results clarify a robust phylogenetic framework for Hesperiidae at higher taxonomic levels, especially based on anchored hybrid enrichment sequencing [8]. Despite this, these markers did not provide strong support to most complete generic and species-level phylogenetic relationships within the family because of the limited taxon sampling of a family that includes about 4000 species. The current study focuses on the tribe Aeromachini and constructs the phylogenetic relationships of the genera and species within the tribe to fill in one of the gaps at lower categories of Hesperiidae.
Aeromachini is a large and diverse tribe of Hesperiidae (subfamily Hesperiinae). Most species of Aeromachini are restricted geographically to the Oriental Region. Apart from the genus Halpe, most species of other genera of Aeromachini are distributed in the Sino-Himalayan Subregion [9]. The remaining species are found in the Palearctic Region and Afrotropical Region. The centers of species diversity are the eastern part of the Himalayan Region (Sikkim, the Kingdom of Bhutan, Assam of India and Tibetan southeastern area of China), north Myanmar and the Hengduan Mountains Region in southwest China. The common external features of the Aeromachini species are characterized by porrect palpi and forewing vein Cu2 (cubitus) arises opposite the origin of vein R1 (radius). Males of most species have a distortion at the end of the discal cell on hindwing. The length of discal cell is shorter than half length of hindwing. Most species of the tribe have a footstalk in the male genitalia. A pair of separated side panels is inserted in the juxta [10].
The earlier studies of Aeromachini are mainly focused on morphological classification, distribution and new species reports. [11,12,13]. Huang [10] constructed a phylogenetic relationship with 24 genera and 31 species of Hesperiidae based on 155 morphological characters in both external features and male genitalia, and defined the genera and species in the tribe Aeromachini in China. Despite this, due to the similar appearance and lack of effective and homologous morphological traits in most species of the family Hesperiidae [5,6,14,15,16], there are challenges in the traditional classification system and phylogenetic relationships based on morphological classification can be unclear. An example is the phylogenetic positions of Aeromachus and Arnetta, are uncertain in the study of Huang [10], because both these genera are not included in any group with robust support.
To clarify the phylogenetic relationships of Aeromachini in China, we constructed phylogenetic trees with mitochondrial and nuclear genes, and compared these with the systematic relationships based on morphological characters. We used the mitochondrial genes Cytochrome Oxidase I (COI), Cytochrome Oxidase II (COII) and nuclear ribosomal DNA (rDNA) including the D3 region of 28S rRNA, and V4 and V7 regions of 18S rDNA. We sequenced a total of 122 specimens from 45 species, representing all major species groups. We constructed the phylogenetic trees under the methods Maximum likelihood (ML) using IQtree [17]. We also analyzed the origin of the tribe in China through prior studies on the distribution of Aeromachini species, and through estimating the times to the most recent common ancestor of the major lineages using relaxed-clock molecular dating. Huang et al. [18] recently reported a phylogenetic framework of Aeromachini species from East Asia, South Asia, Southeast Asia and the Far East, and inferred that the common ancestor of Aeromachini originated in Southeast Asia. In contrast to their wide sampling, we focused on the species from the most diversified region, South China. Our results help to understand the diversification and evolutionary history of Aeromachini in China and other groups with similar distribution patterns.

2. Materials and Methods

2.1. Taxon Sampling

We collected 122 specimens representing 45 species from 10 genera in the tribe Aeromachini in China (Table S1) across ten years. All specimens were caught in the field and preserved following dehydration in small envelopes. The preliminary species-level identification was based on traditional morphological characteristics of wings, genitalia, locality and additional information [10]. Three species in the same subfamily as Aeromachini and seven species from other subfamilies served as outgroups in the phylogenetic analyses. They are not a concern with the taxa chosen for the outgroup (Table S1).

2.2. DNA Extraction, PCR Amplification and Sequencing

The DNA was isolated from legs of adult butterflies using a QIAamp DNA Mini kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. The mitochondrial genes cytochrome oxidase subunit I (COI), cytochrome oxidase subunit II (COII) and three expansion segments (known as variable domains) of nuclear DNA (D3 region of 28S rDNA, V4 and V7 regions of 18S rDNA) were amplified using the primers described in Table 1 [19,20,21]. The PCR conditions were carried out following Jiang et al. [22]. Sequences were obtained by using an ABI 3730xl sequencer following the manufacturer’s recommendations. All novel sequences generated for this study were deposited in GenBank and accession numbers for these and other sequences were downloaded from GenBank (Table S1).

2.3. Phylogenetic Analyses

The sequence data of the mitochondrial dataset and nuclear dataset were aligned, translated to amino acid sequences to check for nuclear mitochondrial pseudogenes (numts), and pruned to remove redundant sequences with Bioedit v.7.0 [23]. MEGA v6.0 was used to calculate the genetic divergences based on the K2P model [24]. The best-fit partitioning scheme and corresponding nucleotide substitution models for the concatenated matrix were selected by PartitionFinder v2.1.1 [25] using the Bayesian Information Criterion (BIC). The GTR+R model is the best-fit substitution model for all four partitions. The concatenated supermatrix was analyzed with maximum likelihood (ML) inference using IQtree 1.4.2 [17]. To assess nodal support, we performed 1000 ultrafast bootstrap replicates and a SH-aLRT test with 1000 replicates. The UFBoot is largely unbiased compared to standard or alternative bootstrap strategies and SH-aLRT is conserved as standard bootstrap [26,27]. Only nodes with support values of UFBoot ≥ 80 and SH-aLRT ≥ 75 were considered robust.

2.4. Divergence Time Estimates

The times to the most recent common ancestor (tmrca) of the major lineages were estimated using a relaxed-clock molecular dating estimation implemented in BEAST 1.5.2 [28]. Analyses using the HKY model of nucleotide substitution with gamma distributed rate variation among sites were performed and the Yule speciation method was assumed. We used the previously estimated age ranges (81–114 Mya) to calibrate the split between Hesperiidae and Hedylidae, the age ranges (35–55 Mya) between Hesperiinae and Heteropterinae [29,30], and a recently described fossil to constrain the minimum stem age of Hesperiinae (25 Mya) [31]. Chains were run for 50 million generations, with the first 20% discarded as burn-in. The results were summarized through TRACER 1.5 [32].

2.5. Ancestral Areas

To further discover the historical biogeography of Chinese Aeromachini, the distribution of all Aeromachini species in China (75) was summarized from the published studies and mapped [6,13,33,34,35,36,37,38,39,40,41,42]. Statistical dispersal-vicariance analysis (S-DIVA) and Bayesian binary MCMC (BBM) implemented in RASP 2.0 (Reconstruct Ancestral State in Phylogenies were used to infer the biogeographic history of the group [43,44]. Evolutionary events were inferred as dispersal, vicariance, extinction or standard speciation. Parameters for each analysis are presented in Table S2. The distributions of populations were divided into four biogeographic units based on the stochastic model of geographic range evolution [45,46] designated following Che et al. [47], Procheş and Ramdhani [48] and Zhang [49] as follows: (A) Himalaya-Hengduan Mountains Region; (B) Southern China Region; (C) Central China Region; and (D) Northern China Region (Figure 1).

3. Results

3.1. Analysis and Tree Topology

The information on number of nucleotide sites, variable sites, parsimony informative sites, fragment composition and accession numbers is listed in Table 2. Figure 2 shows the ML tree based on the dataset of the combined sequences and supports the monophyly of the tribe Aeromachini. In the phylogeny, there are three clades supported by high bootstrap values. Clade I contains most genera from the tribe: Onryza, Pedesta, Halpe, Pithauria, Ampittia, and Sebastonyma. Species belonging to the same genus form a monophyletic group except for the inclusion of Onryza maga and Onryza pesudomaga making Pedesta paraphyletic. Clade II contains three genera, Aeromachus, Sovia and Halpemorpha. Aeromachus is a monophyletic genus while Sovia is a paraphyletic group with the genus Halpemorpha forming a sister group to Sovia subflava. Clade III contains only Parasovia. Some closely related species with morphological separation are confirmed by our molecular data, e.g., the sympatric species O. maga and O. pesudomaga [42], Pe. maculata and Pe. hyrie [34], Pe. latris and Pe. yingqii [50], So. lii and So. lucasii [51], and So. fangi and So. grahami [36].

3.2. Divergence Time Estimates

The estimated divergence times for Aeromachini are presented in Figure 3. The initial divergences among Aeromachini were about 43 Mya (48–41, 95% HPD). Within Clade I, Ampittia diverged from other genera ≈39 Mya (42–36, 95% HPD). The split between Onryza-Pedesta and Halpe-Pithauria-Sebastonyma was dated at ≈35 Mya (39–32, 95% HPD). The diversification of Pithauria and Halpe-Sebastonyma occurred about 32 Mya (35–28, 95% HPD). Halpe diverged from Sebastonyma about 29 Mya. The diversification of Clade II occurred about 40 Mya (42–36, 95% HPD).

3.3. Ancestral Areas

The most probable ancestral area and node frequency values from S-DIVA and BBM for major nodes are shown in Figure 4, and dispersal-vicariance-extinction plots juxtaposed with the phylogeny. Plots were similar in two models and dispersal was estimated to be dominant. For the S-DIVA, although some ambiguity and possible alternative resolutions exist, the highest likelihood estimates were consistent with the results of BBM. We considered it most likely for the hypotheses here.
The common ancestor of Aeromachini originated from the Hengduan Mountains, somewhere between the Himalaya-Hengduan Mountains Region and the Central China Region (Figure 4). A subsequent combination of vicariant and dispersal events separated two lineages of ancestral Aeromachini, giving rise to Clade I in the general area of the Himalaya-Hengduan Mountains Region and Clade II in the Central China Region. Within Clade I, an important dispersal event spread the clade from the Himalaya-Hengduan Mountains Region to Central China and, subsequently, there was a vicariant event within the genus Pedesta. The other dispersal event nearly simultaneously spread the Halpe + Pithauria + Sebastonyma lineage from the Himalaya-Hengduan Mountains Region to South and Central China. Within Clade II, the Sovia + Halpemorpha lineage diverged from the Aeromachus + Parasovia lineage in the Hengduan Mountains (between Himalaya-Hengduan Mountains Region and Central China Region) by a combination of vicariance and dispersal events. However, this result is contentious because node frequency is low (0.56). The common ancestor of Sovia and Halpemorpha occurred in the Central China Region and mainly spread back to the Himalaya-Hengduan Mountains Region. The common ancestor of Aeromachus and Parasovia also occurred in the Central China Region and became widespread.

4. Discussion

4.1. Taxonomic Implications

Well-defined taxonomic limits of Aeromachini have been a problem for many years. The members of Aeromachini were often classified in different tribes or generic groups by different entomologists [10]. Huang [10] could not verify the phylogenetic positions of Aeromachus, but did show the Areomachini from China consisted of at least nine genera based on morphological characters. We found strong support for the monophyly of Aeromachini from China and confirmed that Aeromachus belongs to this tribe based on molecular phylogenetic constructions in accord with Huang et al. [18]. Additionally, we collected samples from the most diversified region, South China, and made a further study based on their result.
We found two genera within Aeromachini are paraphyletic, Pedesta and Sovia. Pedesta includes all the traditionally-assigned Pedesta species and some Thoressa species that share similar morphological characters, and the genus is a sister genus of Onryza [18]. However, our results show that Pedesta is paraphyletic (Figure 2). The species from the genus Onryza and two species of Pedesta, Pe. kuata and Pe. luanchuanensis, firstly form a sister group relationship, and then cluster with the remaining Pedesta species to share a common ancestor. The species of Onryza share several characters with Pedesta: (a) forewings with white or yellow translucent spots; (b) gnathos developed and distally armed with small spines; and (c) uncus bifid or concave distally. Although we did not examine the type species of Onryza (On. meiktila distributed in Burma, Thailand and Laos) in this study, we believe Pedesta and Onryza should be synonymized based on the phylogenetic analyses and morphological characteristics. Based on the sample examined, we moved two Chinese Onryza species, maga and pesudomaga, to the genus Pedesta: Pedesta maga comb.nov. and Pedesta pesudomaga comb.nov.
The other paraphyletic genus is Sovia and the inclusion is Halpemorpha eminens. Sovia is rendered paraphyletic by the inclusion of Halpemorpha eminens. Halpemorpha was erected by Huang et al. [18] and includes only two species, H. eminens and H. albipectus. These two species were previously classified in Sovia by morphological criteria [12,52]. In this study, eminens and So. subflava are sister species with high support (Figure 2), and these cluster with the remaining species of Sovia form a monophyletic group. Although we included just one species of Halpemorpha in this study, we believe the genus should be re-examined.
The restructured genus Ampittia, which now includes Ochus based on the work of Huang et al. [18], is monophyletic with strong support in this study. Our results support Huang et al.’s [18] placement of Ochus subvittatus within Ampittia.

4.2. Historical Biogeography

Butterfly fossils are very rare and only 48 fossil butterfly species are named so far [31], making up a very low proportion of the total fossil record. The ages of butterflies and butterfly divergence time inferred in most previous studies are very different based on their calibrations on these few fossils [29,53,54,55,56]. The results of this study indicate that, although the first divergence time of the tribe Aeromachini (43 Mya) is earlier than the previously estimated times at 34 Mya, the ages of major evolutionary events in the taxa are consistent with previous studies [18]. The tribe Aeromachini probably originated in the late Ecocene and underwent adaptive radiation during the Oligocene and Miocene. These periods belong to the Tertiary, which is the heyday of the evolution of insect herbivores after a major extinction at the terminal Cretaceous (Cretaceous–Paleogene mass extinction, ~65 Mya) [55,57].
Huang et al. [18] reported that the common ancestor of Aeromachini originated in South China and Indochina. We further confirmed Aeromachini in China originated from the Hengduan Mountains. Most of the genera of Aeromachini originated 30–40 Mya between the Himalaya-Hengduan Mountains Region and the Central China Region, and began to diversify ca. 25 Mya (Figure 3). These estimates correspond well with the third of four major Qinghai–Tibetan Plateau uplifts believed to have occurred ca. 22–20, 15–13, 10–8, and 3.6–0 Mya [58,59,60,61], although the exact timings of these uplifts are still debated. Huang et al. [18] believed vicariance might play a significant role in the diversification of Pedesta. During the mid-Miocene, apart from the extensive uplift of the Himalaya-Hengduan Mountains Region, the dramatic crustal deformation induced by the Indo-Asian collision also contributed to the complicated landscapes in western China [62]. Massive mountains and deeply carved valleys acted as barriers to expansion and resulted in speciation.
Paleoecological records indicate that warm, humid and seasonal climates would have been common in southwestern China at least from the middle Miocene [63,64]. The mountains of southwestern China (Himalaya-Hengduan Mountains Region) can buffer regional climate variability and create stable climatic conditions [65]. Climatically stable refugia harbor not only greater concentrations of endemic species, but also high species diversity, and thus might be foci of speciation [66,67]. Combining the previous result of a dispersal-vicariance analysis, we propose that dispersal to adjacent areas has played essential roles within the Aeromachini, but speciation triggered by geological and climatic changes on the Qinghai–Tibetan Plateau also have been important factors in generating current biodiversity within this region.

Supplementary Materials

The following are available online at https://www.mdpi.com/2073-4409/8/4/294/s1, Figure S1: Diversity of Aeromachini (upperside and underside): (1) Aeromachus catocyanea; (2) Aeromachus dalailama; (3) Aeromachus inachus; (4) Aeromachus jhora; (5) Aeromachus kali; (6) Aeromachus nanus; (7) Aeromachus piceus; (8) Aeromachus propinquus; (9) Aeromachus stigmata; (10) Ampittia dioscorides; (11) Ampittia trimacula; (12) Ampittia virgata; (13) Halpe gamma; (14) Halpe knyvetti; (15) Halpe nephele; (16) Halpe pauper; (17) Ampittia subvittatus; (18) Onryza maga; (19) Onryza pesudomaga; (20) Parasovia perbella; (21) Pithauria linus; (22) Pithauria murdava; (23) Pithauria stramineipennis; (24) Sebastonyma dolopia; (25) Halpemorpha eminens; (26) Sovia fangi; (27) Sovia grahami; (28) Sovia lii; (29) Sovia lucasii; (30) Sovia separate; (31) Sovia subflava; (32) Pedesta baileyi; (33) Pedesta bivitta; (34) Pedesta blanchardii; (35) Pedesta fusca; (36) Pedesta hyrie; (37) Pededta kuata; (38) Pedesta latris; (39) Pedesta luanchuanensis; (40) Pedesta maculata; (41) Pedesta masuriensis; (42) Pedesta submacula; (43) Pedesta xiaoqingae; (44) Pedesta yingqii; (45) Pedesta zinnia. Scale bar = 10 mm, Table S1: Information on specimens used in this study, Table S2: Model parameters used in ancestral area estimation analysis.

Author Contributions

For research articles with several authors, a short paragraph specifying their individual contributions must be provided. The following statements should be used “conceptualization, J.Z. and W.J.; methodology, Y.L., Z.Z., S.M., Q.L. and W.Y.; software, Y.L., C.G. and Y.W.; formal analysis, Y.L., C.G. and Y.W.; data curation, Y.L., C.G. and Y.W.; writing—original draft preparation, W.J.; writing—review and editing, A.A.H. and N.M.E.; funding acquisition, W.J.

Funding

This research was funded by grants from Shanghai Engineering Research Center of Plant Germplasm Resources, grant number 17DZ2252700 and the APC was funded by National Natural Science Foundation of China, grant number 31401997.

Acknowledgments

We thank Zhibin Chen (Shanghai Zoological Park, Shanghai, China), Jialin Chen (Foshan, Guangdong, China), Siyao Huang (Zhuhai, Guangdong, China), Shusheng Zhang (Wuyanling National Nature Reserve, Zhejiang, China), Hao Huang (Qingdao, Shangdong, China), Liang Tang, Jiayao Hu, Ziwei Yin, Zhong Peng, and Lizhen Li (Shanghai Normal University, Shanghai, China) for providing valuable comments and specimens throughout the project.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Boggs, C.L.; Watt, W.B.; Ehrlich, P.R. Butterflies: Evolution and Ecology Taking Flight; University of Chicago Press: Chicago, IL, USA, 2003; p. 14. [Google Scholar]
  2. Brab, M.F.; Roger, V.; Pierce, N.E. Molecular phylogeny and systematics of the Pieridae (Lepidoptera: Papilionoidea): Higher classification and biogeography. Zool. J. Linn. Sci. 2006, 147, 239–275. [Google Scholar] [CrossRef]
  3. Caterino, M.S.; Reed, R.D.; Kuo, M.M.; Sperling, F.A.H. A partitioned likelihood analysis of swallowtail butterfly phylogeny (Lepidoptera: Papilionidae). Syst. Biol. 2001, 50, 106–127. [Google Scholar] [CrossRef]
  4. Freitas, A.V.L.; Brown, K.S. Phylogeny of the Nymphalidae (Lepidoptera). Syst. Biol. 2004, 53, 363–383. [Google Scholar] [CrossRef]
  5. Warren, A.D.; Ogawa, J.R.; Brower, A.V.Z. Phylogenetic relationships of subfamilies and circumscription of tribes in the family Hesperiidae (Lepidoptera: Hesperioidea). Cladistics 2008, 24, 1235. [Google Scholar] [CrossRef]
  6. Warren, A.D.; Ogawa, J.R.; Brower, A.V.Z. Revised classification of the family Hesperiidae (Lepidoptera: Hesperioidea) based on combined molecular and morphological data. Syst. Entomol. 2009, 34, 467–523. [Google Scholar] [CrossRef]
  7. Sahoo, R.K.; Warren, A.D.; Wahlberg, N.; Brower, A.V.Z.; Lukhtanov, V.A.; Kodandaramaiah, U. Ten genes and two topologies: An exploration of higher relationships in skipper butterflies (Hesperiidae). PeerJ 2016, 4, e2653. [Google Scholar] [CrossRef]
  8. Toussaint, E.F.A.; Breinholt, J.W.; Earl, C.; Warren, A.D.; Brower, A.V.Z.; Yago, M.; Dexter, K.M.; Espeland, M.; Pierce, N.E.; Lohman, D.J.; et al. Anchored phylogenomics illuminates the skipper butterfly tree of life. BMC Evol. Biol. 2018, 18, 101. [Google Scholar] [CrossRef] [PubMed]
  9. Eliot, J.N. An analysis of the Eurasian and Australian Neptini. Bull. Br. Mus. Nat. Hist. 1969, 15, l50–155. [Google Scholar]
  10. Huang, H. Systematic and Taxonomic Study on the Tribe Aeromachini Tutt (Lepidoptera: Hesperiidae) from China. Master’s Thesis, Shanghai Normal University, Shanghai, China, 2009. [Google Scholar]
  11. Evans, W.H. A revision of the Genus Aeromachus de N. (Lepidoptera: Hesperiidae). Proc. R. Soc. B 1943, 12, 97–101. [Google Scholar] [CrossRef]
  12. Devyatkin, A.L. New Hesperiidae from North Vietnam, with the description of a new genus (Lepidoptera: Rhopalocera). Atalanta 1996, 27, 595–604. [Google Scholar]
  13. Huang, H.; Zhan, C.H. Notes on the genera Thoressa and Pedesta, with description of a new species from South China. Neue Entomol. Nachr. 2004, 57, 179–186. [Google Scholar]
  14. Jiang, W.B.; Zhu, J.Q.; Song, C.; Li, X.Y.; Yang, Y.; Yu, W.D. Molecular phylogeny of the butterfly genus Polytremis (Hesperiidae, Hesperiinae, Baorini) in China. PLoS ONE 2013, 8, e84098. [Google Scholar] [CrossRef] [PubMed]
  15. Jiang, W.B.; He, H.Y.; Li, Y.D.; Ren, M.Y.; Ma, Y.Z.; Zheng, L.L.; Zhu, J.Q.; Yu, W.D. Taxonomic status and molecular phylogeography of two sibling species of Polytremis (Lepidoptera: Hesperiidae). Sci. Rep. 2016, 6, 20820. [Google Scholar] [CrossRef]
  16. Jiang, W.B.; He, H.Y.; Li, Y.Y.; Wang, Y.; Ge, C.; Zhu, J.Q.; Yu, W.D. Molecular phylogeny of the tutterfly tribe Baorini Doherty, 1886 (Hesperiidae, Hesperiinae) in China. Zootaxa 2019, 4565, 108–116. [Google Scholar] [CrossRef]
  17. Nguyen, L.T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
  18. Huang, Z.F.; Chiba, H.; Jin, J.; Kizhakke, A.G.; Wang, M.; Kunte, K.; Fan, X.L. A multilocus phylogenetic framework of the tribe Aeromachini (Lepidoptera: Hesperiidae: Hesperiinae), with implications for taxonomy and biogeography. Syst. Entomol. 2019, 44, 163–178. [Google Scholar] [CrossRef]
  19. Rand, D.B.; Heath, A.; Suderman, T.; Pierce, N.E. Phylogeny and life history evolution of the genus Chrysoritis within the Aphnaeini (Lepidoptera: Lycaenidae), inferred from mitochondrial cytochrome oxidase I sequences. Mol. Phylogenet. Evol. 2000, 17, 85–96. [Google Scholar] [CrossRef]
  20. Jiang, W.B.; Zhu, J.Q.; Chen, M.H.; Yang, Q.C.; Du, X.; Chen, S.Y.; Zhang, L.N.; Yu, Y.M.; Yu, W.D. Wolbachia infection status and genetic structure in natural populations of Polytremis nascens (Lepidoptera: Hesperiidae). Infect. Genet. Evol. 2014, 27, 202–211. [Google Scholar] [CrossRef] [PubMed]
  21. Raupach, M.J.; Astrin, J.J.; Hannig, K.; Peters, M.K.; Stoeckle, M.Y.; Wägele, J.W. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae) using nuclear rDNA expansion segments and DNA barcodes. Front. Zool. 2010, 7, 26. [Google Scholar] [CrossRef]
  22. Jiang, W.B.; Zhu, J.Q.; Wu, Y.J.; Li, L.Z.; Li, Y.Y.; Ge, C.; Wang, Y.; Endersby, N.M.; Hoffmann, A.A.; Yu, W.D. Influence of Wolbachia infection on mitochondrial DNA variation in the genus Polytremis (Lepidoptera: Hesperiidae). Mol. Phylogenet. Evol. 2018, 129, 158–170. [Google Scholar] [CrossRef] [PubMed]
  23. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor an analysis program for Windows 95/98/NT. Nucleic Acids Symp. 1999, 41, 95–98. [Google Scholar]
  24. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]
  25. Lanfear, R.; Calcott, B.; Ho, S.Y.W.; Guindon, S. PartitionFinder: Combined selection of partitioning schemes and substitution models for phylogenetic analyses. Mol. Biol. Evol. 2012, 29, 1695–1701. [Google Scholar] [CrossRef]
  26. Hoang, D.T.; Chernomor, O.; von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the ultrafast bootstrap approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef] [PubMed]
  27. Minh, B.Q.; Nguyen, M.A.T.; Von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef] [PubMed]
  28. Excoffier, L.; Laval, G.; Schneider, S. Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evol. Bioinform. 2005, 1, 47–50. [Google Scholar] [CrossRef]
  29. Heikkilä, M.; Kaila, L.; Mutanen, M.; Peña, C.; Wahlberg, N. Cretaceous origin and repeated tertiary diversification of the redefined butterflies. Proc. R. Soc. Lond. B Biol. Sci. 2012, 279, 1093–1099. [Google Scholar] [CrossRef] [PubMed]
  30. Chazot, N.; Wahlberg, N.; Freitas, A.V.L.; Miller, C.; Labandeira, C.; Sohn, J.; Sahoo, R.K.; Seraphim, N.; De Jong, R.; Keikkila, M. The trials and tribulations of priors and posteriors in Bayesian timing of divergence analyses: The age of butterfles revisited. BioRxiv 2018. [Google Scholar] [CrossRef]
  31. De Jong, R. Reconstructing a 55-million-year-old butterfly (Lepidoptera: Hesperiidae). Eur. J. Entomol. 2016, 113, 423–428. [Google Scholar] [CrossRef]
  32. Fu, Y.X.; Li, W.H. Statistical tests of neutrality of mutations. Genetics 1993, 133, 693–709. [Google Scholar] [PubMed]
  33. Chou, I. Monographia Rhopalocerorum Sinensium; Henan Scientific and Technological Press: Zhengzhou, China, 1994; p. 854. [Google Scholar]
  34. Fan, X.L.; Wang, M. A New Species of the Genus Thoressa Swinhoe (Lepidoptera: Hesperiidae) from China. Entomol. News 2009, 120, 438–441. [Google Scholar] [CrossRef]
  35. Huang, H. Some new butterflies from China-2. Atalanta 2002, 33, 109–122. [Google Scholar]
  36. Huang, H. A list of butterflies collected from Nujiang and Dulongjiang, China with descriptions of new species, new subspecies and revisional notes. Neue Entomol. Nachr. 2003, 55, 3–114. [Google Scholar]
  37. Huang, H.; Wu, C.S. New and little known Chinese butterflies in the collection of the Institute of Zoology, Academia Sinica, Beijing-l. Neue Entomol. Nachr. 2003, 55, 115–144. [Google Scholar]
  38. Wang, Z.G.; Niu, Y. Description of new species of Chinese butterflies (in Chinese). Entomotaxonomia 2002, 24, 276–282. [Google Scholar]
  39. Xue, G.X.; Li, M.; Nan, W.H.; Jia, X.L.; Huang, S.Y.; Sun, H.; Li, X.J. A new species of the genus Sovia (Lepidoptera: Hesperiidae) from Qinling-Daba Mountains of China. Zootaxa 2015, 3985, 583–590. [Google Scholar] [CrossRef] [PubMed]
  40. Xue, G.X.; Li, Y.F.; Liu, Z.H.; Li, M.; Ren, Y.D. Distribution of Onryza maga (Leech, 1890) (Lepidoptera: Hesperiidae) with description of female genitalia and taxonomic notes. Entomol. Fenn. 2016, 27, 71–76. [Google Scholar]
  41. Yuan, F.; Yuan, X.Q.; Wang, Z.Q. Checklist of the genus Halpe (Lepidoptera: Hesperiidae) from China with description of a new species. Acta Zootaxonomica Sin. 2007, 32, 308–311. [Google Scholar]
  42. Zhu, J.Q.; Mao, W.W.; Chen, Z.B. A new species of Onryza Watson, 1893 (Lepidoptera: Hesperiidae) from China. Zootaxa 2017, 4216, 94–100. [Google Scholar] [CrossRef] [PubMed]
  43. Ali, S.S.; Yu, Y.; Pfosser, M.; Wetschnig, W. Inferences of biogeographical histories within subfamily Hyacinthoideae using S-DIVA and Bayesian binary MCMC analysis implemented in RASP (Reconstruct Ancestral State in Phylogenies). Ann. Bot. 2012, 109, 95–107. [Google Scholar] [CrossRef]
  44. Yu, Y.; Harris, A.J.; He, X.J. S-DIVA (statistical dispersal-vicariance analysis): A tool for inferring biogeographic histories. Mol. Phylogenet. Evol. 2010, 56, 848–850. [Google Scholar] [CrossRef] [PubMed]
  45. Ree, R.H.; Smith, S.A. Maximum likelihood inference of geographic range evolution by dispersal, local extinction, and cladogenesis. Syst. Biol. 2008, 57, 4–14. [Google Scholar] [CrossRef] [PubMed]
  46. Ree, R.H.; Moore, B.R.; Webb, C.O.; Donoghue, M.J.; Crandall, K. A likelihood framework for inferring the evolution of geographic range on phylogenetic trees. Evolution 2005, 59, 2299–2311. [Google Scholar] [CrossRef]
  47. Che, J.; Zhoua, W.; Hua, J.S.; Yana, F.; Papenfuss, T.J.; Wake, D.B.; Zhang, Y.P. Spiny frogs (Paini) illuminate the history of the Himalayan region and Southeast Asia. Proc. Natl. Acad. Sci. USA 2010, 107, 13765–13770. [Google Scholar] [CrossRef]
  48. Procheş, Ş.; Ramdhani, S. The world’s zoogeographical regions confimed by cross-taxon analyses. Bioscience 2012, 62, 260–270. [Google Scholar] [CrossRef]
  49. Zhang, R. Zoogeographical regions of China. Bull. Biol. 1987, 24, 196–202. [Google Scholar]
  50. Huang, H. Notes on the genus Thoressa Swinhoe, [1913] from China, with the description of a new species. Atlanta 2011, 42, 193–200. [Google Scholar]
  51. Zhai, Q.; Xue, G.X.; Li, M. DNA barcoding-based sexual association of Sovia lucasii and S. lii (Lepidoptera: Hesperiidae), with description of a new subspecies. PLoS ONE 2017, 12, e0183847. [Google Scholar] [CrossRef]
  52. Evans, W.H. A Catalogue of the Hesperiidae from Europe, Asia and Australia in the British Museum (Natural History); Trustees of the British Museum: London, UK, 1949; p. 12458. [Google Scholar]
  53. Cong, Q.; Shen, J.; Li, W.; Borek, D.; Otwinowski, Z.; Grishin, N.V. The first complete genomes of Metalmarks and the classification of butterfly families. Genomics 2017, 109, 485–493. [Google Scholar] [CrossRef] [PubMed]
  54. Espeland, M.; Breinholt, J.; Willmott, K.R.; Warren, A.D.; Vila, R.; Toussaint, E.F.A.; Maunsell, S.C.; Aduse-Poku, K.; Talavera, G.; Eastwood, R.; et al. A comprehensive and dated phylogenomic analysis of butterflies. Curr. Biol. 2018, 28, 770–778. [Google Scholar] [CrossRef] [PubMed]
  55. Sahoo, R.K.; Warren, A.D.; Collins, S.C.; Kodandaramaiah, U. Hostplant change and paleoclimatic events explain diversification shifts in skipper butterflies (Family: Hesperiidae). BMC Evol. Biol. 2017, 17, 174. [Google Scholar] [CrossRef]
  56. Wahlberg, N.; Leneveu, J.; Kodandaramaiah, U.; Pena, C.; Nylin, S.; Freitas, A.V.L.; Brower, A.V.Z. Nymphalid butterflies diversify following near demise at the Cretaceous/Tertiary boundary. Proc. Biol. Sci. 2009, 276, 4295–4302. [Google Scholar] [CrossRef] [PubMed]
  57. Rasnitsyn, A.P.; Quicke, D.L.J. History of Insects; Kluwer Academic Publishers: Dordrecht, The Netherlands, 2002. [Google Scholar]
  58. Harrison, T.M.; Copeland, P.; Kidd, W.; Yin, A. Raising Tibet. Science 1992, 255, 1663–1670. [Google Scholar] [CrossRef] [PubMed]
  59. Coleman, M.; Hodges, K. Evidence for Tibetan plateau uplift before 14 Myr ago from a new minimum age for east-west extension. Nature 1995, 374, 49–52. [Google Scholar] [CrossRef]
  60. Shi, Y.F.; Li, J.J.; Li, B.Y.; Yao, T.D.; Wang, S.M.; Li, S.J.; Cui, Z.J.; Wang, F.B.; Pan, B.T.; Fang, X.M.; et al. Uplift of the Qinghai-Xizang (Tibetan) plateau and East Asia environmental change during late Cenozoic. Acta Geograph. Sin. 1999, 54, 10–21. [Google Scholar]
  61. Spicer, R.A.; Harris, N.B.W.; Widdowson, M.; Herman, A.B.; Guo, S.; Valdes, P.J.; Wolfe, J.A.; Kelley, S.P. Constant elevation of southern Tibet over the past 15 million years. Nature 2003, 421, 622–624. [Google Scholar] [CrossRef]
  62. Clift, P.D. Controls on the erosion of Cenozoic Asia and the flx of clastic sediment to the ocean. Earth Planet. Sci. Lett. 2006, 241, 571–580. [Google Scholar] [CrossRef]
  63. Li, S.; Hughes, A.C.; Su, T.; Anberree, J.L.; Oskolski, A.A.; Sun, M.; Ferguson, D.K.; Zhou, Z.K. Fire dynamics under monsoonal climate in Yunnan, SW China: Past, present and future. Palaeogeogr. Palaeoclimatol. Palaeoecol. 2017, 465, 168–176. [Google Scholar] [CrossRef]
  64. Tang, C.Q.; Matsui, T.; Ohashi, H.; Dong, Y.F.; Momohara, A.; Herrando-Moraira, S.; Qian, S.H.; Yang, Y.C.; Ohsawa, M.; Luu, H.T. Identifying long-term stable refugia for relict plant species in East Asia. Nat. Commun. 2018, 9, 4488. [Google Scholar] [CrossRef] [PubMed]
  65. Tzedakis, P.C.; Lawson, I.T.; Frogley, M.R.; Hewitt, G.M.; Preece, R.C. Buffered tree population changes in a quaternary refugium: Evolutionary implications. Science 2002, 297, 2044–2047. [Google Scholar] [CrossRef] [PubMed]
  66. Hampe, A.; Petit, R.J. Conserving biodiversity under climate change: The rear edge matters. Ecol. Lett. 2005, 8, 461–467. [Google Scholar] [CrossRef] [PubMed]
  67. Harrison, S.; Noss, R. Viewpoint: Part of a special issue on endemics hotspots, endemism hotspots are linked to stable climatic refugia. Ann. Bot. 2017, 119, 207–214. [Google Scholar] [CrossRef] [PubMed]
Cells 08 00294 g001 550
Figure 1. Four biogeographic units: HH, Himalaya-Hengduan Mountains Region; South, Southern China Region; Central, Central China Region; and North, Northern China Region.
Figure 1. Four biogeographic units: HH, Himalaya-Hengduan Mountains Region; South, Southern China Region; Central, Central China Region; and North, Northern China Region.
Cells 08 00294 g001
Cells 08 00294 g002 550
Figure 2. Maximum-likelihood phylogeny of Aeromachini sampled for this study. The phylogeny is inferred by IQTREE based on concatenated mitochondrial and nuclear genes (totaling 2084 bp). Numbers beside nodes are IQTREE ultrafast bootstrap and SH-aLRT values. The species from the ten genera are marked in different colors.
Figure 2. Maximum-likelihood phylogeny of Aeromachini sampled for this study. The phylogeny is inferred by IQTREE based on concatenated mitochondrial and nuclear genes (totaling 2084 bp). Numbers beside nodes are IQTREE ultrafast bootstrap and SH-aLRT values. The species from the ten genera are marked in different colors.
Cells 08 00294 g002
Cells 08 00294 g003 550
Figure 3. Chronogram of Aeromachini divergence based on mean tmrca estimates. The scale bar is in units of millions of years. Lettered nodes are those for which tmrca was estimated. A filled star denotes a node for which a prior calibration was used. A, Hesperiini; B, Baorini; C, Taractrocerini; D, Heteropterinae; E, Coeliadinae; F, Eudaminae, G, Pyrginae; H, Hedylidae.
Figure 3. Chronogram of Aeromachini divergence based on mean tmrca estimates. The scale bar is in units of millions of years. Lettered nodes are those for which tmrca was estimated. A filled star denotes a node for which a prior calibration was used. A, Hesperiini; B, Baorini; C, Taractrocerini; D, Heteropterinae; E, Coeliadinae; F, Eudaminae, G, Pyrginae; H, Hedylidae.
Cells 08 00294 g003
Cells 08 00294 g004 550
Figure 4. Biogeographic inference recovered with: (A) statistical dispersal-vicariance analysis (S-DIVA); and (B) Bayesian binary MCMC (BBM) in RASP 2.0. Pie charts represent the marginal probabilities for each alternative ancestral area: HH, Himalaya-Hengduan Mountains Region; South, Southern China Region; Central, Central China Region; and North, Northern China Region.
Figure 4. Biogeographic inference recovered with: (A) statistical dispersal-vicariance analysis (S-DIVA); and (B) Bayesian binary MCMC (BBM) in RASP 2.0. Pie charts represent the marginal probabilities for each alternative ancestral area: HH, Himalaya-Hengduan Mountains Region; South, Southern China Region; Central, Central China Region; and North, Northern China Region.
Cells 08 00294 g004
Table
Table 1. Primer sequences and amplicon lengths of PCR products of target genes.
Table 1. Primer sequences and amplicon lengths of PCR products of target genes.
Gene/RegionPrimersSequence (5′–3′)Amplicon LengthAnnealing TemperatureReference
COIHCO2198
LCO1490		TAAACTTCAGGGTGACCAAAAAATCA
GGTCAACAAATCATAAAGATATTGG		487 bp42 °C[19]
COIIPIERRE
EVA		AGAGCCTCTCCTTTAATAGAACA
GAGACCATTACTTGCTTTCAGTCATCT		637 bp45 °C[20]
D3 region of 28S rDNACD3F
CD3R		GGACCCGTCTTGAAACAC
GCATAGTTCACCATCTTTC		240 bp52 °C[21]
V4 region of 18S rDNACV4F
CV4R		TGGTGCCAGCAGCCGCGGTAA
CCTCTAACGTCGCAATACGAATGCCC		381 bp56 °C[21]
V7 region of 18S rDNACV7F
CV7R		CTTAAAGGAATTGACGGAGGGCACCACC
GATTCCTTCAGTGTAGCGCGCGTG		400 bp58 °C[21]
Table
Table 2. The information on gene fragment composition.
Table 2. The information on gene fragment composition.
Gene FragmentNucleotide SitesVariable SitesParsimony Informative SitesATCGAccession Numbers
COI47825921928.9%39.5%17.6%13.9%MK344780-MK344909
COII62529326035.6%40.8%13.5%10.1%MK344911-MK345027
D3 region of 28S rDNA2351005225.2%19.3%25.1%30.4%MK345289-MK345418
V4 region of 18S rDNA392693724.3%28.1%20.2%27.4%MK345029-MK345156
V7 region of 18S rDNA3631548821.6%24.4%24.1%29.8%MK345158-MK345287

Share and Cite

MDPI and ACS Style

Li, Y.; Zhu, J.; Ge, C.; Wang, Y.; Zhao, Z.; Ma, S.; Hoffmann, A.A.; Endersby, N.M.; Liu, Q.; Yu, W.; et al. Molecular Phylogeny and Historical Biogeography of the Butterfly Tribe Aeromachini Tutt (Lepidoptera: Hesperiidae) from China. Cells 2019, 8, 294. https://doi.org/10.3390/cells8040294

AMA Style

Li Y, Zhu J, Ge C, Wang Y, Zhao Z, Ma S, Hoffmann AA, Endersby NM, Liu Q, Yu W, et al. Molecular Phylogeny and Historical Biogeography of the Butterfly Tribe Aeromachini Tutt (Lepidoptera: Hesperiidae) from China. Cells. 2019; 8(4):294. https://doi.org/10.3390/cells8040294

Chicago/Turabian Style

Li, Yuanyuan, Jianqing Zhu, Chen Ge, Ying Wang, Zimiao Zhao, Shuojia Ma, Ary A. Hoffmann, Nancy M. Endersby, Qunxiu Liu, Weidong Yu, and et al. 2019. "Molecular Phylogeny and Historical Biogeography of the Butterfly Tribe Aeromachini Tutt (Lepidoptera: Hesperiidae) from China" Cells 8, no. 4: 294. https://doi.org/10.3390/cells8040294

APA Style

Li, Y., Zhu, J., Ge, C., Wang, Y., Zhao, Z., Ma, S., Hoffmann, A. A., Endersby, N. M., Liu, Q., Yu, W., & Jiang, W. (2019). Molecular Phylogeny and Historical Biogeography of the Butterfly Tribe Aeromachini Tutt (Lepidoptera: Hesperiidae) from China. Cells, 8(4), 294. https://doi.org/10.3390/cells8040294

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop