Next Article in Journal
High-Quality Assembly and Comparative Analysis of Actinidia latifolia and A. valvata Mitogenomes
Next Article in Special Issue
Mn-XRN1 Has an Inhibitory Effect on Ovarian Reproduction in Macrobrachium nipponense
Previous Article in Journal
Genome-Wide Association Study on Reproductive Traits Using Imputation-Based Whole-Genome Sequence Data in Yorkshire Pigs
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 14
Issue 4
10.3390/genes14040862
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cloning, Expression Analysis and SNP Screening of the kiss1 Gene in Male Schizothorax biddulphi

by
Zhulan Nie
1,2,3,
Nianhua Zhao
1,2,3,
He Zhao
1,2,3,
Zhengyi Fu
4,5,
Zhenhua Ma
4,5,* and
Jie Wei
1,2,3,*
1
College of Life Sciences and Technology, Tarim University, Alaer 843300, China
2
Key Laboratory of Tarim Animal Husbandry Science and Technology, Xinjiang Production & Construction, Alaer 843300, China
3
State Kay Laboratory Breeding Base for the Protection and Utilization of Biological Resources in Tarim Basin Co-Funded by Xinjiang Corps and the Ministry of Science and Technology, Tarim University, Alaer 843300, China
4
Tropical Aquaculture Research and Development Center, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Sanya 572018, China
5
College of Science and Engineering, Flinders University, Adelaide, SA 5001, Australia
*
Authors to whom correspondence should be addressed.
Genes 2023, 14(4), 862; https://doi.org/10.3390/genes14040862
Submission received: 1 March 2023 / Revised: 28 March 2023 / Accepted: 29 March 2023 / Published: 3 April 2023
(This article belongs to the Special Issue Fish and Shellfish Genetics and Breeding)
Browse Figures
Versions Notes

Abstract

:
Schizothorax biddulphi is an endemic fish distributed only in southern Xinjiang, China. Due to overfishing, water conservancy facilities, and other factors, as well as inherent biological limitations, resource recovery is quite difficult. For endangered fish with slow growth, late sexual maturity, and insufficient natural population supplementation, large-scale artificial reproduction and breeding are important for restoring resources. Therefore, it is urgent to optimize the reproductive regulation methods of the fish. The kiss1 gene is a key regulator of the reproductive regulation cascade, and identifying and analyzing the role of kiss1 are important for further elucidating the reproductive mechanism of S. biddulphi. To understand the characteristics of the kiss1 of S. biddulphi, the full-length cDNA sequence of kiss1 was obtained in this study, and its tissue expression specificity and association with phenotypic traits were analyzed in male fish. The full-length cDNA sequence of kiss1 in S. biddulphi was 658 bp, with an ORF of 327 bp, and encoded a 108-amino acid, unstable protein. Homology results indicated that kiss1 was highly conserved. qPCR showed kiss1 expression in different tissues in male S. biddulphi, with the highest expression in the gonads, followed by muscle, and significantly lower expression in the swim bladder, pituitary gland, heart, hypothalamus, gill, fin, liver, eye, and mid-kidney. qPCR revealed three SNP loci in the exonic region of kiss1. The c.3G>T locus was significantly correlated (p < 0.05) with gonad mass and the maturation coefficient in S. biddulphi. These results will help uncover the reproductive endocrinology network of S. biddulphi, improve artificial breeding technology for fish, and unveil new directions for breeding excellent strains of S. biddulphi and molecular marker-assisted breeding.

1. Introduction

The Tarim schizothoracin (Schizothorax biddulphi) in order Cypriniformes, family Cyprinidae, subfamily Schizothoracinae, and genus Schizothorax [1], is a special fish in Xinjiang. It is one of the most representative fish in the Tarim River basin and was once among the most important economic fish in Bosten Lake [2]. In the 1970s, S. biddulphi experienced a sharp decline in germplasm resources and numbers due to its biological features, such as slow growth, late sexual maturity, low fertility, and strict requirements for the spawning environment and living conditions, as well as constraints imposed by anthropogenic and natural conditions, resulting in severe deterioration of its habitat [3]. Its distribution is now extremely narrow, with individuals inhabiting only the Tarim River system and in very small numbers. In 1998, this species was included in the Red Book of Endangered Animals of China as a Class II protected wild animal in Xinjiang [4]; in 2004, it was listed as a Class II aquatic animal in Xinjiang Uygur Autonomous Region, and in 2021, it was under second-class state protection, becoming one of the rare fishes endemic to China [5]. Therefore, analyzing S. biddulphi reproduction-related genes and screening molecular markers associated with reproduction will have a positive effect on the conservation of S. biddulphi as well as resource recovery and species breeding.
Kisspeptin is a polypeptide-like protein encoded by the kiss gene that is involved in the regulation of the hypothalamic–pituitary–gonadal axis function in animals and plays an important role in the regulation of reproductive metabolism, puberty initiation, photoperiodic reproduction, and sexual differentiation of the brain [6,7]. The successful identification of kisspeptin and its receptor gene, GPR54, as an important neural signaling system [8] was a turning point in neuroendocrinology and redirected animal reproduction research. In sexually mature fish, kisspeptin treatment led to increased gonad weight and gonadosomatic index in some white bass (Morone chrysops) and striped bass (Morone saxatilis) [9]. The Kisspeptin system of teleosts generally consists of kiss genes (kiss1 and kiss2) and kiss receptors (kissr1, kissr2, and kissr3) [10,11]. Most bony fishes, such as goldfish (Carassius auratus), zebrafish (Danio rerio), and medaka (Oryzias latipes), contain both the kiss1 and kiss2 genes [10,12]. In almost 20 fish species, only kiss2 can be found [13,14]. To test whether kiss and/or kissr have been lost in some species requires a syntenic analysis of kiss and kissr neighboring genes [15]. For example, in turbot (Scophthalmus maximus), kiss1/kissr3, which were thought to be lost in flatfish species, were cloned and functionally characterized using this approach [16]. The actions of different kisspeptins and their receptors vary depending on the species, sex, and developmental stage of the fish. For example, in zebrafish, kiss 1 is involved in the activation of puberty, while kiss 2 is involved in the regulation of seasonal reproduction [17]. In goldfish, kiss 1 is involved in the induction of spawning behavior, while kiss 2 is involved in the regulation of gonadotropin-releasing hormone (GnRH) secretion [18,19]. Furthermore, the actions of fish kisspeptins can also vary depending on their target tissues. For instance, in medaka, kissr1 is present in both the brain and the gonads, suggesting a role in both the central regulation of reproduction and the direct regulation of gonadal function [20]. In contrast, in Salmo salar, kissr1 is mainly expressed in the brain, suggesting a more central role in the regulation of reproduction [21].
Although both kiss1 and kiss2 are associated with reproductive regulation in teleosts, kiss1 and its receptor have been found to be the main factors regulating gonadal development in many fish. For example, the mRNA expression levels of kiss1 or kissr1 fluctuated greatly at different gonadal developmental periods in European sea bass (Dicentrarchus labrax) and striped bass [22,23]; in chub mackerel (Scomber japonicus) and zebrafish, the expression levels of kiss1 mRNA also fluctuated greatly before and after spawning [24,25]. The kiss1 gene was originally discovered in a study of human melanoma pigment cells. Because of its tumor metastasis inhibitory effect, it was the first in this system to be studied for its role in tumor proliferation and spread. A large number of studies later reported that mutations in the GPR54 gene lead to incomplete reproductive function in humans and mice and knocking out the kiss1 gene has the same consequences [26]. Some scholars have also found that the kiss1 gene promotes the onset of puberty [14]. Around puberty, the kiss1 gene increases its expression level in the hypothalamus of animals by promoting the release of gonadotropins, all of which indicate that the kiss1 gene plays a role in the regulation of reproduction and demonstrate that regular reproductive activity in animals requires the participation of the reproductive system together with the nervous and endocrine systems. To date, kiss genes have been identified in zebrafish, medaka, European sea bass, goldfish, chub mackerel, Japanese puffer (Takifugu rubripes), Japanese sturgeon (Acipenser schrenckii), pompano (Trachinotus ovatus), turbot (Scophthalmus maximus), Chinese rare minnow (Gobiocypris rarus), and cavefish (Sinocyclocheilus tingi) [27,28,29,30,31,32]. The characteristic sequences of the gene and its expression in many tissues have been investigated, but reports on the association between kiss1 gene polymorphism and reproductive traits are limited.
Single nucleotide polymorphisms (SNPs) are ideal genetic markers with promising applications in genetic diversity analysis, association analysis, variety identification, construction of high-density genetic linkage maps, and assisted breeding [33,34,35,36]. Therefore, in this study, we performed cloning, sequence alignment, and tissue differential expression analysis of the S. biddulphi kiss1 gene and conducted the first case of molecular marker screening for kiss1 gene polymorphism and reproductive traits in S. biddulphi, thereby providing technical support and a theoretical basis for molecular marker-assisted breeding in S. biddulphi.

2. Materials and Methods

2.1. Test Animals and Sample Collection

S. biddulphi were collected from August 2020 to August 2021 in the Kizil River with a geo-cage net (net length 10 m, 33 sections and 20 holes, frame 2 cm × 3 cm, mesh 4 mm). A total of 128 fish were caught, including 75 males and 53 females, with body lengths ranging from 95.05 to 328.52 mm and body masses from 8.02 to 415.02 g. Before the experiment, these fish were placed in a 2 m × 1 m tank for two weeks, and the experiment was carried out using an HZ-060 aerator for oxygenation. Floating compound feed (Sichuan Sterga Feed Ltd., Chengdu, China) was provided three times a day (9:30, 13:30, and 19:30). Fish were fed the diet at 3.0% to 5.0% of their total weight. Due to the small number of females, only a total of 62 males that developed to stage IV or V were selected (developmental stage I-III males were immature, and gonadosomatic indexes could not be calculated). The body lengths of males used in this study were 164.78 ± 32.52 mm, and the total weight was 63.85 ± 44.15 g. Such males were identified based on milky white spermatozoa and a small amount of semen flowing from the abdomen when lightly pressed. Morphological data were collected, and the fish were anesthetized using MS-222 and dissected to take the heart, liver, mid-kidney, muscle, gonads, eye, hypothalamus, pituitary gland, gill, fin, and swim bladder tissues, while the male gonads were weighed to calculate their maturation coefficients. The samples were immediately placed in liquid nitrogen and subsequently stored in a −80 °C freezer. A portion of the gonadal mixture was immersed in centrifuge tubes with anhydrous ethanol and stored in a −20 °C freezer. All animal experiments conformed to the standards of the Committee of Laboratory Animal Experimentation at the China Academy of Agriculture Sciences, China.

2.2. Methods

2.2.1. Cloning and Sequence Analysis of the kiss1 Gene

Total RNA was extracted from the gonadal tissue of S. biddulphi using TRIzol reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s protocol, and contaminating genomic DNA was removed by treatment with DNaseI (TaKaRa, Shanghai, China). The quality of RNA was examined by spectrophotometry and agarose gel electrophoresis, and the first strand of cDNA was synthesized from the total RNA of mixed gonadal samples according to the manufacturer’s 5′/3′ RACE protocol and stored at −20 °C. Primers were designed using Primer Premier 6.0 based on a comparison of the coding regions of the kiss1 genes of C. auratus (NC_039278.1), D. rerio (NC_007122.7), and O. latipes (NC_019863.2) in the NCBI database. The primer names and sequences are shown in Table 1.
Specifically, the first round of PCR for 5′ RACE was performed using the primers rkiss1-R1 and rkiss1-R2. The amplification procedure was as follows: 94 °C predenaturation for 2 min, followed by 38 cycles of 94 °C denaturation for 30 s, 70 °C for 30 s, and 66 °C for 30 s. The products of the first round of PCR were diluted 10-fold, and the second round of PCR was performed with conditions of 94 °C predenaturation for 2 min, 94 °C for 30 s, and 66 °C for 30 s. 3′ RACE was performed using the primers rkiss1-F1 and rkiss1-F2 with the same reaction conditions and amplification procedure. PCR products were detected with 1.2% agarose gel electrophoresis and determined to have specific amplification. After specific amplification, cut-gel recovery and T vector splicing was performed, and the ligated products were cloned into the vector and sequenced separately. All sequencing was performed on an ABI377 DNA sequencer (Perkin-Elmer, Norwalk, CT, USA).

2.2.2. Sequence Analysis of the kiss1 Gene

The intermediate fragment and 5′ RACE and 3′ RACE ends of the obtained kiss1 gene were spliced using SeqMan to obtain the full-length cDNA of kiss1. The open reading frame (ORF) was queried for the kiss1 gene using DNAStar’s EditSeq program, and the amino acid sequence was translated; the physicochemical properties of the protein and the secondary structure of the protein were analyzed using ExPASy (http://www.expasy.org, accessed on 28 February 2022), NetSurfP 2.0 (https://services.healthtech.dtu.dk/service.php?NetSurfP2.0, accessed on 28 February 2022) and SOPMA (http://metadatabase.org/wiki/SOPMA, accessed on 28 February 2022), and the tertiary structure of the protein was predicted using Phyre2. SignalP5.0 Server (http://www.cbs.dtu.dk/services/SignalP/, accessed on 28 February 2022) was used for signal peptide analysis, NetPhos3.1 (http://www.cbs.dtu.dk/s.ervices/NetPhos, accessed on 28 February 2022)for protein phosphorylation site prediction, TMHMM for transmembrane structural domain prediction, the Cell-PLoc 2.0 package for kiss1 subcellular localization, NCBI Blast for homology matching analysis, DNAMAN (version v 10.0.2.128; Lynnon Biosoft, Vaudreuil, QC, Canada) for multiple amino acid sequence comparison, and MEGA 7.0 (https://www.megasoftware.net/, accessed on 28 February 2022) for phylogenetic tree construction. Sequences were aligned using Muscle, and neighbor-joining trees were constructed using the p-distance model with 500 bootstrap replicates. The accession number and protein sequence of other fish in the phylogenetic tree analysis are provided in Table S1.

2.2.3. Detection of kiss1 Expression in Different Tissues of S. biddulphi

Total RNA was extracted from the heart, liver, mid-kidney, muscle, gonad, eye, hypothalamus, pituitary gland, gill, fin, and swim bladder tissues of S. biddulphi (n = 3) using TRIzol reagent (Invitrogen, Waltham, MA, USA) according to the protocol of the US manufacturer. The amount of cDNA used in the qPCR system for different tissues was adjusted using β-actin as the internal reference gene. qPCR was performed according to the qPCR primers qkiss1-F and qkiss1-R, which were designed based on the kiss1 gene sequence (Table 1). qPCR was performed using a 15 μL system: 2 × SG Green qPCR Mix 7.5 μL, 0.25 μL of each upstream and downstream primer (10 μM), 1 μL of cDNA, and 6 μL of ddH2O. The PCR parameters included initial denaturation at 95 °C for 10 min, denaturation at 95 °C for 20 s, and annealing and extension at 60 °C for 30 s for 40 cycles. After PCR was completed, the melting curve was analyzed to determine the amplification of individual products. Three parallel PCRs were performed for each tissue sample, and the results obtained were analyzed using the comparative CT method (2−∆∆Ct) to obtain the relative expression level of each tissue. Origin 2021 software was used to create graphs.

2.2.4. SNP Locus Screening of the kiss1 Gene

Total RNA was extracted from each sample (n = 62) and reverse transcribed to cDNA as described above. Using this cDNA as a template, PCR amplification was performed using the kiss1-F and kiss1-R primers (Table 1). Primer design was performed on the NCBI website (http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome, accessed on 28 February 2022) based on the conserved sequence on either side of the site. The main parameters are as follows: the length of primer was generally 18~24 bp; Tm 55 °C~65 °C; (G+C) content 40%~70%; production size was less than 800 bp. The products were purified by gel cutting and ligation transformation, followed by direct sequencing. The specific steps were performed as described above. Sequencing results were analyzed with sequence alignment using DNAMAN (version v 10.0.2.128; Lynnon BioSoft, Vaudreuil, QC, Canada) to find SNP sites.

2.2.5. Measurement of Reproductive Traits and Evaluation of its Association with SNP Loci

The gonadosomatic index (GSI) was calculated as follows: maturation coefficient = (gonadal weight/total weight) × 100%. The test data were expressed as the mean ± standard deviation (mean ± S.D.). The genotype frequency and allele frequency at each SNP locus of the kiss1 gene were calculated using Microsoft Excel, and the Hardy–Weinberg equilibrium (HWE) test was performed using the χ2 test. ANOVA was performed in SPSS 26.0 to calculate the associations between different genotypes of the kiss1 gene and reproductive traits, and the results were expressed as the mean ± standard deviation. Duncan’s new complex polarization method (Duncan’s) was used to determine the significance of differences between the means of the groups, with significant differences indicated by p < 0.05.

3. Results

3.1. Sequence Analysis of the kiss1 Gene

The kiss1 gene was 658 bp long, with a full-length ORF of 327 bp, and encoded 108 amino acids. The 5′ UTR was 62 bp long, the 3′ UTR was 269 bp long, the start codon was ATG, and the stop codon was TGA. Underlined was Kisspeptin-10 (YNLNSFGLRY) (Figure 1).
There are 14 species that have greater than 80% amino acid sequence similarity with S. biddulphi (Table 2), which indicates that the protein encoded by the kiss1 gene cloned from S. biddulphi was highly conserved with that of other species.
The results of the evolutionary tree analysis of kiss1 proteins (Figure 2) showed that the kiss1 protein of S. biddulphi was most closely related to that of S. richardsonii.

3.2. Characterization of kiss1-Encoded Proteins

The theoretical isoelectric point of the protein encoded by the kiss1 gene is 9.34, and the molecular weight of the kiss1 protein is 12.45 kDa. The 108 encoded amino acids comprise 19 unique amino acids, the most common of which is leucine (12.0%) and the least common of which is histidine (0.9%); there are 13 positively charged amino acids (Lys and Arg) (12.0%) and 10 negatively charged amino acids (Asp and Glu) (9.3%). The total number of protein atoms is 1733, and the instability index is 60.41. The protein is unstable. The secondary structure of the kiss1 protein mainly contained two secondary components, the extended strand and random coil (Figure 3A), with the α-helix accounting for 23.15%, the extended strand accounting for 16.67%, and the random coil accounting for 60.19%. The similarity of the tertiary structure with this template was 45% (Figure 3B). The shear site of the signal peptide was located between amino acids 15 and 16 (Figure 3C). There were 10 serine phosphorylation sites located at sites 11, 20, 36, 51, 53, 57, 61, 74, 78, and 93; there were 8 threonine phosphorylation sites located at sites 5, 17, 31, 35, 43, 45, 48, and 80; and there were 7 tyrosine phosphorylation sites, located at sites 18, 25, 26, 79, 88, 89, and 98 (Figure 3D). The kiss1 protein is not a transmembrane protein (Figure 3E), and its subcellular localization is mainly outside the cell; presumably, its function is performed mainly outside the cell.

3.3. Tissue Expression Profile of the kiss1 Gene

The expression of the kiss1 gene in different tissues of male S. biddulphi was detected by fluorescence quantitative PCR, and the results showed that the kiss1 gene was expressed in 11 tissues. kiss1 gene expression was highest in the gonads of male S. biddulphi, followed by the muscle, and then was ordered from high to low as follows: swim bladder, pituitary gland, heart, hypothalamus, gill, fin, liver, eye, and mid-kidney (Figure 4).

3.4. SNP Diversity Analysis of the kiss1 Gene

3.4.1. Polymorphic SNP Loci of the kiss1 Gene

Three SNP loci were detected in the exonic region of the kiss1 gene, and their base changes and amino acid changes, mutation types, and genetic structure information are shown in Table 2. SNP c.3G>T and SNP c.198T>G both have GG and TT genotypes, of which TT is the dominant genotype, with two alleles, G and T, of which T is the dominant allele. SNP c.12T>C has two genotypes, CC and TT, where C is the dominant genotype. The mutation types at these three loci were all missense mutations, and all deviated from Hardy–Weinberg equilibrium (p < 0.05, Table 3).

3.4.2. Association Analysis of SNP Loci of the kiss1 Gene with Reproductive Traits in S. biddulphi Males

The gonad weight and gonadosomatic index of individuals with the TT genotype were significantly higher than those of individuals with the GG genotype at SNP c.3G>T (p < 0.05). The gonad weight and gonadosomatic index of individuals with SNP c.12T>C and SNP c.198T>G were not significantly different (p > 0.05, Table 4).

4. Discussion

The developmental process in animals is extremely complex and precise, and the central nervous system and the endocrine system work together to jointly regulate the developmental process, with the kisspeptin system playing a key role in reproductive development and energy metabolism in fish [28,37]. In this study, the 658-bp cDNA sequence of kiss1 was cloned from S. biddulphi for the first time, which encoded a 108-amino acid protein. The C-terminal core decapeptide of this sequence is YNLNSFGLRY (Y-Y pattern), the shortest mature sequence that stimulates phosphatidylinositol conversion at the amino acid level [38], which is highly consistent with the C-terminal decapeptide sequences of D. rerio [39], O. latipes [40] and other carps, showing that the core sequence of the kiss1 gene, kisspeptin-10, is highly conserved in carps. In contrast, in mammals and amphibians, the corresponding amino acid at position 3 of this core sequence is W [41,42]. In fish, it corresponds to L, immediately following the core decapeptide with GLR as the splitting site and amidation site of this sequence. This short peptide is equally highly conserved in mammals and fish [38,39]. kiss1 and kiss2 encode different functional proteins, and in the kiss2 protein, the C-terminal core decapeptide YNLNSFGLRY of the kiss1 protein corresponds to FNYNPFGLRF, where the same motif of -N-N-FGLR- is present [32,43]. The kiss1 and kiss2 genes are RY- and RF-amide-type compounds, respectively. Generally, only kiss1 is present in mammals, and some scholars speculate that it may be due to the loss of the kiss2 gene during evolution. Fish generally contain two kiss genes, kiss1 and kiss2. Anguilla anguilla is the only teleost species having two kiss genes (kiss1 and kiss2) and three kissr types (kissr1, kissr2, and kissr3) reported to date, indicating that the evolutionary process varies with species [13]. The secondary structure of the kiss1 gene of S. biddulphi mainly includes an extended strand and irregular curl, while the irregular curl structure often dominates changes in enzyme activity and functional site composition [44], which is presumed to have an important role in the formation of specific functional sites, and its inclusion of two plus-tail signals (AATAAA) suggests selective shearing during transcription [45]. There were 14 fish species with an amino acid sequence similarity more significant than 80%, and the homology results showed that the kiss1 amino acid sequence of S. biddulphi had the highest similarity of 98% with that of the congener S. richardsonii. In the phylogenetic tree, they were clustered onto one branch, indicating the closest genetic relationship.
Exploring the expression of a gene in different tissues helps analyze the mechanism of gene regulation, and the gene expression pattern indicates, to some extent, the functional diversity among tissues [23]. It has been confirmed that the kisspeptin system mediates the reproductive endocrine process in animals. In this study, the kiss1 gene had the highest expression in the gonads, followed by the muscle, swim bladder, pituitary gland, heart, hypothalamus, and gill, and low expression in the fin, liver, eye, and mid-kidney, similar to the kiss1 gene tissue expression results of Acipenser schrenckii [30]. In other teleosts, there were differences in the pattern of kiss1 gene expression, with D. rerio’s kiss1 being most expressed in the brain and pituitary gland and the intestine, pancreas, kidney, and adipose tissue [39]. kiss1 of S. japonicus was expressed in the brain, gonads, gills, heart, and spleen, but kiss1 expression was not present in the pituitary gland, and the pattern of expression varied by reproductive cycle [28]. In T. putitora, the expression of kiss1 was inconsistent between ovarian development and spermatogenesis [46], and the expression of kiss1 increased as the organism developed. These results indicate that the expression of kiss1 varies among species, gender, and reproductive cycles. The high expression in the gonads of S. biddulphi is consistent with findings for O. latipes [40], C. auratus [47], and S. japonicus [28], confirming the involvement of kiss1 in the reproductive function of fish. In some species, Oryzias latipes, zebrafish, Dicentrarchus labrax, and Scomber japonicus, it has been demonstrated that kiss1 is regularly expressed at different developmental stages in the male brain [23,40,48,49]. In the brain of Scomber japonicus males, kiss1 mRNA expression level gradually decreased from the immature stage to the spermiation stage, followed by a significant decline during the post-spawning stage [23]. The kiss1 gene in the brain of S. biddulphi may follow a similar expression pattern during the gonadal development stage. In the present study, the kiss1 gene expression levels in the pituitary and hypothalamus were not very high, probably because gonads were developed to stage IV or V. They may not be at the peak of expression in the temporal expression pattern.
In addition to the gonads, kiss1 is also highly expressed in muscle tissues. It has been confirmed that muscle tissue is one of the main regions for energy accumulation and metabolism, and the kiss1 gene has an important role in maintaining energy balance [24]. Kisspeptin can act as an anorexigenic factor, but its effect on energy balance is not mediated by food intake but by regulating energy digestion, which is related to the number of kisspeptinARC neurons and can have an effect on body weight changes in mice [21,50]. The results of a large number of metabolic stress models show that reproductive regulation is inhibited by the metabolic stress response, and leptin and NPY factors, which are closely related to energy metabolism, can inhibit the expression of the kiss gene, which in turn affects the reproduction of the organism [51]. However, the specific controlling mechanisms still need to be investigated. The pituitary gland, as an indispensable component of the HPG axis, mutually regulates its function with the hypothalamus and gonads. The hypothalamus releases gonadotropin-releasing hormone (GnRH) that binds to receptors that promote the release of luteinizing hormone (LH) and follicle-stimulating hormone (FSH) from the pituitary gland, forming a neuroendocrine network that ultimately affects the reproductive function of fish and this series of cascade reactions cannot be separated from either organ. The expression of kiss1 in the pituitary gland and hypothalamus is also consistent with their respective functions [52]. Similar results were obtained for O. latipes [40], C. auratus [47], L. rohita [53], D. labrax [21], etc. Interestingly, kiss1 gene expression was also detected in the fins of fish, which play an important role in maintaining balance and assisting forward movement during swimming, suggesting that kiss1 has some function other than regulating reproduction.
Reproductive traits are important indicators for assessing the reproductive potential of individuals. The important role of kiss1 in animal reproduction can make it a candidate gene for fertility, and by identifying its SNP loci and analyzing the association between genotype and phenotype, effective molecular markers for the genetic improvement of animal reproductive traits can be obtained [54]. The SNP g.1311578G>T locus found in Ovis aries plays a key role in lambing and can be screened for the TT dominant genotype to improve reproductive and production potential [55]. Maitra et al. (2014) found three SNP loci (G296C, G2510A, and C2540T) related to the litter size of Indian C. hircus in intron 1 of the kiss1 gene [56]. An et al. (2013) detected two SNP loci (G2124T>A and G2270C>T) significantly associated with the lambing number of C. hircus in intron 1 of the kiss1 gene in three different sheep populations [57]. Similar mutations at the G227C and T486A loci of the kiss1 gene were reported to be associated with lambing numbers in Northern Guizhou C. hircus [58].
In this study, for the first time, SNP loci in exons of the kiss1 gene were correlated with reproductive traits in male S. biddulphi, and the results showed that the gonad weight and maturation coefficients of individual S. biddulphi males with the TT genotype were significantly higher than those of individuals with the GG genotype at SNP c.3G>T. Mutation of single nucleotides at the SNP c.3G>T locus resulted in amino acid types that significantly affected gonad mass and maturation coefficients of S. biddulphi males. The exonic region belongs to the coding region of the gene, and this single base substitution leads to an amino acid change; this nonsynonymous mutation may affect the stability of the protein and function of the gene, which may be responsible for the differences in reproductive traits among individuals; therefore, it is hypothesized that the dominant allele T improves the reproductive ability of S. biddulphi to some extent. The results also indicated that the pure TT genotype at the SNP c.3G>T locus in S. biddulphi yielded better reproductive traits and could be used to select parents for breeding progeny with obvious reproductive advantages. Since reproductive traits are influenced not only by genes but also by the environment, it is not clear whether the kiss1 gene is the main-effect gene affecting S. biddulphi or whether there is perhaps a linkage with other main-effect genes controlling reproductive traits, and the mechanism needs to be further explored.
Although the size of the studied population was relatively small, the present results have important and practical implications for the recovery and continuation of resources of S. biddulphi and the breeding of superior breeds, which may lead to significant improvement in reproductive characteristics. However, differences in gonad weight and maturation coefficients among genotypes need to be confirmed based on a larger amount of additional data to confirm their significant effects. The next step could be the identification and screening of associated SNP loci for highly reproductive females, which could be applied in actual reproduction practices in combination with the present results.

5. Conclusions

In conclusion, the kiss1 gene of S. biddulphi is homologous to that in other fishes, and the widespread expression of kiss1 in different tissues implies that it may be involved in functions other than reproduction. However, in-depth research is still needed regarding its expression pattern and involvement in other functions during gonad development. In this study, we searched for mutated loci of kiss1 in S. biddulphi and found that the SNP c.3G>T locus was significantly associated with both gonad mass and the maturation coefficient in S. biddulphi, and individuals with the genotype TT had significantly larger reproductive traits than those with other genotypes. The identified SNPs could be used as markers for higher fertility and, thus, to improve the reproductive performance of this population.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes14040862/s1, Table S1: The accession number and protein sequence of other fish in the phylogenetic tree analysis.

Author Contributions

Conceptualization, Z.N. and Z.M; methodology, N.Z.; software, H.Z.; validation, N.Z., H.Z. and Z.F.; formal analysis, N.Z.; investigation, J.W.; resources, J.W.; data curation, H.Z.; writing—original draft preparation, Z.N.; writing—review and editing, Z.M.; visualization, Z.F.; supervision, J.W.; project administration, Z.M.; funding acquisition, J.W. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (31860729 and 31560721); Young and Middle-aged Science and Technology Innovation Leading Talent Program Project of Xinjiang Production and Construction Corps (2018CB033); President’s Fund of Tarim University-Germplasm Resources and Genetic Breeding of Schizothorax in Southern Xinjiang Innovative Research Team Project (TDZKCX202204); The Third Xinjiang Integrated Scientific Expedition Project (2022xjkk150403); and United Fund of the Ocean University of China and Tarim University (ZHYLH201902).

Institutional Review Board Statement

The animal study protocol was approved by the Scientific Ethics Committee of Tarim University (BIOL0164, 9 December 2019).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Yan, G.; Zhang, R.M.; Cai, L.G. Xinjiang Fish Journal; Xinjiang Science and Technology Press: Urumqi, China, 2012. [Google Scholar]
  2. Wang, P.Z.; Song, D.; Zhang, Y.Z.; Qian, J.; Gong, K.; Ye, S.W.; Liu, J.S.; Li, Z.J. Resource composition, length-weight relationship and condition factor of fishes in Bosten Lake. Acta Agric. Boreali-Occident. Sin. 2020, 42, 181–187. [Google Scholar]
  3. Zhang, R.M.; Guo, Y.; Ma, Y.W. Investigation of the resources and distribution of Schizothorax biddulphi Günther. Freshw. Fish. 2007, 37, 76–78. [Google Scholar]
  4. Le, P.Q.; Chen, Y.Y. Red Book of Endangered Animals of China (Fish); Science Press: Beijing, China, 1998. [Google Scholar]
  5. Meng, W.; Guo, Y.; Hai, S.; Yang, T.Y.; Ma, Y.W.; Xie, C.G. Genetic structure and genetic diversity analysis of Schizothorax biddulphi population. Acta Hydrobiol. Sin. 2013, 36, 851–857. [Google Scholar] [CrossRef]
  6. Clements, M.K.; McDonald, T.P.; Wang, R.; Xie, G.; O’Dowd, B.F.; George, S.R.; Austin, C.P.; Liu, Q. FMRFamide-Related Neuropeptides Are Agonists of the Orphan G-Protein-Coupled Receptor GPR54. Biochem. Biophys. Res. Commun. 2001, 284, 1189–1193. [Google Scholar] [CrossRef]
  7. Messager, S.; Chatzidaki, E.E.; Ma, D.; Hendrick, A.G.; Zahn, D.; Dixon, J.; Thresher, R.R.; Malinge, I.; Lomet, D.; Carlton, M.B.L.; et al. Kisspeptin directly stimulates gonadotropin-releasing hormone release via G protein-coupled receptor 54. Proc. Natl. Acad. Sci. USA 2005, 102, 1761–1766. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Dhillo, W.S.; Chaudhri, O.B.; Patterson, M.; Thompson, E.L.; Murphy, K.G.; Badman, M.K.; McGowan, B.M.; Amber, V.; Patel, S.; Ghatei, M.A.; et al. Kisspeptin-54 Stimulates the Hypothalamic-Pituitary Gonadal Axis in Human Males. J. Clin. Endocrinol. Metab. 2005, 90, 6609–6615. [Google Scholar] [CrossRef] [Green Version]
  9. Beck, B.H.; Fuller, S.A.; Peatman, E.; McEntire, M.E.; Darwish, A.; Freeman, D.W. Chronic exogenous kisspeptin administration accelerates gonadal development in basses of the genus Morone. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2012, 162, 265–273. [Google Scholar] [CrossRef] [PubMed]
  10. Rabouti, H.; Asghari, S.M.; Sariri, R.; Balalaie, S.; Valipour, A.; Omidian, N.; Heidari, B. Functional evaluation of a novel kisspeptin analogue on the reproduction of female goldfish. Sci. Rep. 2022, 12, 21944. [Google Scholar] [CrossRef]
  11. Wang, B.; Mechaly, A.S.; Somoza, G.M. Overview and new insights into the diversity, evolution, role, and regulation of kisspeptins and their receptors in teleost fish. Front. Endocrinol. 2022, 13, 393. [Google Scholar] [CrossRef]
  12. Somoza, G.M.; Mechaly, A.S.; Trudeau, V.L. Kisspeptin and GnRH interactions in the reproductive brain of teleosts. Gen. Comp. Endocrinol. 2020, 298, 113568. [Google Scholar] [CrossRef]
  13. Pasquier, J.; Kamech, N.; Lafont, A.; Vaudry, H.; Rousseau, K.; Dufour, S. Molecular evolution of GPCRs: Kisspeptin/kisspeptin receptors. J. Mol. Endocrinol. 2014, 52, T101–T117. [Google Scholar] [CrossRef]
  14. Baptista, R.P.; Kissinger, J.C. Is reliance on an inaccurate genome sequence sabotaging your experiments? PLoS Pathog. 2019, 15, e1007901. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Zhao, C.; Wang, B.; Liu, Y.; Feng, C.; Xu, S.; Wang, W.; Liu, Q.; Li, J. New Evidence for the Existence of Two Kiss/Kissr Systems in a Flatfish Species, the Turbot (Scophthalmus maximus), and Stimulatory Effects on Gonadotropin Gene Expression. Front. Endocrinol. 2022, 13, 883608. [Google Scholar] [CrossRef] [PubMed]
  16. Kitahashi, T.; Ogawa, S.; Parhar, I.S. Cloning and Expression of kiss2 in the Zebrafish and Medaka. Endocrinology 2009, 150, 821–831. [Google Scholar] [CrossRef] [PubMed]
  17. Valipour, A.; Heidari, B.; Asghari, S.M.; Balalaie, S.; Rabouti, H.; Omidian, N. The effect of different exogenous kisspeptins on sex hormones and reproductive indices of the goldfish (Carassius auratus) broodstock. J. Fish Biol. 2021, 98, 1137–1143. [Google Scholar] [CrossRef] [PubMed]
  18. Valipour, A.; Heidari, B.; Vaziri, H.; Asghari, S.M. Expression of reproductive-related genes and changes in oocyte maturation of goldfish broodstock (Carassius auratus) following injection of different exogenous kisspeptins. Reprod. Domest. Anim. 2021, 56, 1349–1357. [Google Scholar] [CrossRef] [PubMed]
  19. Hodne, K.; Weltzien, F.A.; Oka, Y.; Okubo, K. Expression and Putative Function of Kisspeptins and Their Receptors During Early Development in Medaka. Endocrinology 2013, 154, 3437–3446. [Google Scholar] [CrossRef] [Green Version]
  20. Sivalingam, M.; Parhar, I.S. Hypothalamic kisspeptin and kisspeptin receptors: Species variation in reproduction and reproductive behaviours. Front. Neuroendocrinol. 2022, 64, 100951. [Google Scholar] [CrossRef]
  21. Migaud, H.; Ismail, R.; Cowan, M.; Davie, A. Kisspeptin and seasonal control of reproduction in male European sea bass (Dicentrarchus labrax). Gen. Comp. Endocr. 2012, 179, 384–399. [Google Scholar] [CrossRef]
  22. Zmora, N.; Stubblefield, J.; Zulperi, Z.; Biran, J.; Levavi-Sivan, B.; Muñoz-Cueto, J.A.; Zohar, Y. Differential and Gonad Stage-Dependent Roles of Kisspeptin1 and Kisspeptin2 in Reproduction in the Modern Teleosts, Morone Species. Biol. Reprod. 2012, 86, 177, 1–12. [Google Scholar] [CrossRef]
  23. Selvaraj, S.; Kitano, H.; Fujinaga, Y.; Ohga, H.; Yoneda, M.; Yamaguchi, A.; Shimizu, A.; Matsuyama, M. Molecular characterization, tissue distribution, and mRNA expression profiles of two Kiss genes in the adult male and female chub mackerel (Scomber japonicus) during different gonadal stages. Gen. Comp. Endocr. 2010, 169, 28–38. [Google Scholar] [CrossRef]
  24. Biran, J.; Ben-Dor, S.; Levavi-Sivan, B. Molecular Identification and Functional Characterization of the Kisspeptin/Kisspeptin Receptor System in Lower Vertebrates. Biol. Reprod. 2008, 79, 776–786. [Google Scholar] [CrossRef]
  25. Shahjahan, M.; Motohashi, E.; Doi, H.; Ando, H. Elevation of Kiss2 and its receptor gene expression in the brain and pituitary of grass puffer during the spawning season. Gen. Comp. Endocr. 2010, 169, 48–57. [Google Scholar] [CrossRef]
  26. Felip, A.; Zanuy, S.; Pineda, R.; Pinilla, L.; Carrillo, M.; Tena-Sempere, M.; Gómez, A. Evidence for two distinct KiSS genes in non-placental vertebrates that encode kisspeptins with different gonadotropin-releasing activities in fish and mammals. Mol. Cell. Endocrinol. 2009, 312, 61–71. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Liang, Y.; Zhang, J.; Guo, H.; Zhu, K.; Guo, L.; Zhang, N.; Liu, B.; Yang, J.; Zhang, D. Genomic structure characterization of Kiss1 gene from Trachinotus ovatus and its expression responses to the feed types. J. Fish. China 2019, 43, 707–718. [Google Scholar]
  28. Ohga, H.; Selvaraj, S.; Adachi, H.; Imanaga, Y.; Nyuji, M.; Yamaguchi, A.; Matsuyama, M. Functional analysis of kisspeptin peptides in adult immature chub mackerel (Scomber japonicus) using an intracerebroventricular administration method. Neurosci. Lett. 2014, 561, 203–207. [Google Scholar] [CrossRef] [PubMed]
  29. Yang, Y.; Gao, J.; Yuan, C.; Zhang, Y.; Guan, Y.; Wang, Z. Molecular identification of Kiss/GPR54 and function analysis with mRNA expression profiles exposure to 17α-ethinylestradiol in rare minnow Gobiocypris rarus. Mol. Biol. Rep. 2016, 43, 737–749. [Google Scholar] [CrossRef] [PubMed]
  30. Gao, X.; Lyu, W.; Wang, H.; Zhang, Y. Cloning, sequence analysis, and expression characterization of the kisspeptin gene from Acipenser schrenckii. Chin. J. Fish. 2020, 27, 504–515. [Google Scholar]
  31. Yang, B.; Jiang, Q.; Chan, T.; Ko, W.K.W.; Wong, A.O.L. Goldfish kisspeptin: Molecular cloning, tissue distribution of transcript expression, and stimulatory effects on prolactin, growth hormone and luteinizing hormone secretion and gene expression via direct actions at the pituitary level. Gen. Comp. Endocr. 2010, 165, 60–71. [Google Scholar] [CrossRef] [PubMed]
  32. Liao, Z.J.; Sun, C.Y.; Wang, X.A.; Yang, G.K.; Pan, X.B.; Yang, J.X.; Li, W.S. Molecular cloning and tissue distribution of Kisspeptin from Sinocyclocheilus tingi. Sichuan J. Zool. 2016, 35, 496–502. [Google Scholar]
  33. Fan, J.; Ma, D.; Zhu, H.; Jiang, P.; Su, H. Gene structure, SNP screening and growth correlation analysis of the preproinsulin gene in grass carp (Ctenopharyngodon idellus). J. Genet. 2021, 100, 48. [Google Scholar] [CrossRef]
  34. Filippi, C.V.; Merino, G.A.; Montecchia, J.F.; Aguirre, N.C.; Rivarola, M.; Naamati, G.; Fass, M.I.; Álvarez, D.; Di Rienzo, J.; Heinz, R.A.; et al. Genetic Diversity, Population Structure and Linkage Disequilibrium Assessment among International Sunflower Breeding Collections. Genes 2020, 11, 283. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Hayah, I.; Ababou, M.; Botti, S.; Badaoui, B. Comparison of three statistical approaches for feature selection for fine-scale genetic population assignment in four pig breeds. Trop. Anim. Health Prod. 2021, 53, 395. [Google Scholar] [CrossRef] [PubMed]
  36. Yu, Z.; Fredua-Agyeman, R.; Hwang, S.; Strelkov, S.E. Molecular genetic diversity and population structure analyses of rutabaga accessions from Nordic countries as revealed by single nucleotide polymorphism markers. BMC Genom. 2021, 22, 442. [Google Scholar] [CrossRef] [PubMed]
  37. van Aerle, R.; Kille, P.; Lange, A.; Tyler, C.R. Evidence for the existence of a functional Kiss1/Kiss1 receptor pathway in fish. Peptides 2008, 29, 57–64. [Google Scholar] [CrossRef]
  38. De Bond, J.P.; Smith, J.T. Kisspeptin and energy balance in reproduction. Reproduction 2014, 147, R53–R63. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Servili, A.; Le Page, Y.; Leprince, J.; Caraty, A.; Escobar, S.; Parhar, I.S.; Seong, J.Y.; Vaudry, H.; Kah, O. Organization of Two Independent Kisspeptin Systems Derived from Evolutionary-Ancient Kiss Genes in the Brain of Zebrafish. Endocrinology 2011, 152, 1527–1540. [Google Scholar] [CrossRef] [Green Version]
  40. Kanda, S.; Akazome, Y.; Matsunaga, T.; Yamamoto, N.; Yamada, S.; Tsukamura, H.; Maeda, K.; Oka, Y. Identification of KiSS-1 Product Kisspeptin and Steroid-Sensitive Sexually Dimorphic Kisspeptin Neurons in Medaka (Oryzias latipes). Endocrinology 2008, 149, 2467–2476. [Google Scholar] [CrossRef] [Green Version]
  41. Han, S.; Gottsch, M.L.; Lee, K.J.; Popa, S.M.; Smith, J.T.; Jakawich, S.K.; Clifton, D.K.; Steiner, R.A.; Herbison, A.E. Activation of gonadotropin-releasing hormone neurons by kisspeptin as a neuroendocrine switch for the onset of puberty. J. Neurosci. 2005, 25, 11349–11356. [Google Scholar] [CrossRef] [Green Version]
  42. Um, H.N.; Han, J.M.; Hwang, J.; Hong, S.I.; Vaudry, H.; Seong, J.Y. Molecular coevolution of kisspeptins and their receptors from fish to mammals. Ann. N. Y. Acad. Sci. 2010, 1200, 67–74. [Google Scholar] [CrossRef]
  43. Akazome, Y.; Kanda, S.; Okubo, K.; Oka, Y. Functional and evolutionary insights into vertebrate kisspeptin systems from studies of fish brain. J. Fish Biol. 2010, 76, 161–182. [Google Scholar] [CrossRef] [PubMed]
  44. Suzuki, R.; Tobe, K.; Aoyama, M.; Sakamoto, K.; Ohsugi, M.; Kamei, N.; Nemoto, S.; Inoue, A.; Ito, Y.; Uchida, S. Expression of DGAT2 in white adipose tissue is regulated by central leptin action. J. Biol. Chem. 2005, 280, 3331–3337. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Qu, R.; Wu, C.; Feng, X. Function of mRNA alternative splicing in plant development. Plant Physiol. J. 2014, 50, 717–724. [Google Scholar]
  46. Shahi, N.; Singh, A.K.; Sahoo, M.; Mallik, S.K.; Thakuria, D. Molecular cloning, characterization and expression profile of kisspeptin1 and kisspeptin1 receptor at brain-pituitary-gonad (BPG) axis of golden mahseer, Tor putitora (Hamilton, 1822) during gonadal development. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2017, 205, 13–29. [Google Scholar] [CrossRef] [PubMed]
  47. Li, S.; Zhang, Y.; Liu, Y.; Huang, X.; Huang, W.; Lu, D.; Zhu, P.; Shi, Y.; Cheng, C.H.; Liu, X. Structural and functional multiplicity of the kisspeptin/GPR54 system in goldfish (Carassius auratus). J. Endocrinol. 2009, 201, 407. [Google Scholar] [CrossRef] [Green Version]
  48. Navarro, V.M. Metabolic regulation of kisspeptin—The link between energy balance and reproduction. Nat. Rev. Endocrinol. 2020, 16, 407–420. [Google Scholar] [CrossRef]
  49. Stengel, A.; Wang, L.; Goebel-Stengel, M.; Taché, Y. Centrally injected kisspeptin reduces food intake by increasing meal intervals in mice. Neuroreport 2011, 22, 253. [Google Scholar] [CrossRef] [Green Version]
  50. Manfredi-Lozano, M.; Roa, J.; Tena-Sempere, M. Connecting metabolism and gonadal function: Novel central neuropeptide pathways involved in the metabolic control of puberty and fertility. Front. Neuroendocrinol. 2018, 48, 37–49. [Google Scholar] [CrossRef] [PubMed]
  51. Gottsch, M.L.; Cunningham, M.J.; Smith, J.T.; Popa, S.M.; Acohido, B.V.; Crowley, W.F.; Seminara, S.; Clifton, D.K.; Steiner, R.A. A Role for Kisspeptins in the Regulation of Gonadotropin Secretion in the Mouse. Endocrinology 2004, 145, 4073–4077. [Google Scholar] [CrossRef] [Green Version]
  52. Pineda, R.; Aguilar, E.; Pinilla, L.; Tena-Sempere, M. Chapter 5—Physiological Roles of the Kisspeptin/GPR54 System in the Neuroendocrine Control of Reproduction. In Progress in Brain Research; Martini, L., Ed.; Elsevier: Amsterdam, The Netherlands, 2010; pp. 55–77. [Google Scholar]
  53. Saha, A.; Pradhan, A.; Sengupta, S.; Nayak, M.; Samanta, M.; Sahoo, L.; Giri, S.S. Molecular characterization of two kiss genes and their expression in rohu (Labeo rohita) during annual reproductive cycle. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2016, 191, 135–145. [Google Scholar] [CrossRef]
  54. Padrón, M.; Milhes, M.; Delcamp, A.; Guichoux, E. Identification of SNP markers for population genetics studies of the Mediterranean gorgonian, Leptogorgia sarmentosa. Conserv. Genet. Resour. 2021, 13, 379–381. [Google Scholar] [CrossRef]
  55. An, X.J.; Zhao, S.G.; Pan, Z.Y.; Wen, Y.L.; Tian, Z.L.; Cai, Y.; Chu, M.X. Tissue expression and polymorphism of sheep KISS1 gene and their association with litter size. Chin. J. Anim. Sci. 2019, 55, 45–50. [Google Scholar]
  56. Maitra, A.; Sharma, R.; Ahlawat, S.; Tantia, M.S.; Roy, M.; Prakash, V. Association analysis of polymorphisms in caprine KiSS1 gene with reproductive traits. Anim. Reprod. Sci. 2014, 151, 71–77. [Google Scholar] [CrossRef] [PubMed]
  57. An, X.P.; Han, P.; Hou, J.X.; Zhao, H.B.; Yan, Y.; Ma, T.; Fang, F.; Meng, F.X.; Song, Y.X.; Wang, J.G. Molecular cloning and characterization of KISS1 promoter and effect of KISS1 gene mutations on litter size in the goat. Genet. Mol. Res. 2013, 12, 4308–4316. [Google Scholar] [CrossRef] [PubMed]
  58. Chen, X.; Li, P.; Sun, Z.; Xu, H.; Chen, W. Study on polymorphism and tissue differential expression of KISS1 gene in Qianbei Ma Goats (Capra hircus). J. Agric. Biotechnol. 2018, 26, 1213–1218. [Google Scholar]
Genes 14 00862 g001 550
Figure 1. The kiss1 nucleotide sequence and its amino acid sequence. Sequences in blue are ORF, * Stop codon, Sequences in the box are Kisspeptin1-10.
Figure 1. The kiss1 nucleotide sequence and its amino acid sequence. Sequences in blue are ORF, * Stop codon, Sequences in the box are Kisspeptin1-10.
Genes 14 00862 g001
Genes 14 00862 g002 550
Figure 2. Phylogenetic tree analysis of the kiss1 protein in different species. The number shown at each branch indicates the bootstrap value (%). GenBank accession numbers see Table 2.
Figure 2. Phylogenetic tree analysis of the kiss1 protein in different species. The number shown at each branch indicates the bootstrap value (%). GenBank accession numbers see Table 2.
Genes 14 00862 g002
Genes 14 00862 g003 550
Figure 3. The characterization of kiss1 protein (A), Secondary structure; (B), Tertiary structure; (C), Prediction of the signal peptide; (D), Phosphorylation sites prediction; (E), Transmembrane domain prediction).
Figure 3. The characterization of kiss1 protein (A), Secondary structure; (B), Tertiary structure; (C), Prediction of the signal peptide; (D), Phosphorylation sites prediction; (E), Transmembrane domain prediction).
Genes 14 00862 g003
Genes 14 00862 g004 550
Figure 4. Distribution of the kiss1 gene in different tissues of male S. biddulphi. Different letters indicate that the difference is significant, and the same letters indicate that the difference is nonsignificant (p > 0.05).
Figure 4. Distribution of the kiss1 gene in different tissues of male S. biddulphi. Different letters indicate that the difference is significant, and the same letters indicate that the difference is nonsignificant (p > 0.05).
Genes 14 00862 g004
Table
Table 1. Primer sequences for amplification of the kiss1 gene.
Table 1. Primer sequences for amplification of the kiss1 gene.
Primer IDPrimer Sequence (5′-3′)Use
mkiss1-FGAATGGTGACACATACCCTTCAGCoding region
mkiss1-RGACCTTTCTGGAGACCACCCoding region
rkiss1-R1GGACGGGTGTCAGTTCCCCTGAGATC5′ RACE
rkiss1-R2CGGAGTGATGTTTCCTCAGGAGTTTC5′ RACE
rkiss1-F1GACACATACCCTTCAGGGCATATTCAGTAC3′ RACE
rkiss1-F2GATGAAACTCCTGAGGAAACATCACTCCG3′ RACE
qkiss1-FATTTTCATGTATTCTTTGTTqPCR
qkiss1-RGTCTGTATTGTAATCACCTTqPCR
β-actin-FAATCCCAAAGCCAACAGAqPCR (Internal control)
β-actin-RCGACCAGAAGCGTACAGAGqPCR (Internal control)
kiss1-FACAACCTCCATACCTGCAAGTGSNP Screening
kiss1-RATGAGCAGGTTATGAAATATTCCASNP Screening
Table
Table 2. Amino acid similarity levels of the kiss1 protein of S. biddulphi with those from other species.
Table 2. Amino acid similarity levels of the kiss1 protein of S. biddulphi with those from other species.
SpeciesPer. IdentAccession Number
Labeo catla88.79%AIZ66894.1
Heteropneustes fossilis84.21%QPD01600.1
Gobiocypris rarus82.86%AHH83757.1
Anabarilius grahami88.68%ROL46005.1
Onychostoma macrolepis92.59%KAF4107520.1
Danio rerio82.41%ACT10282.1
Triplophysa tibetana64.29%KAA0707738.1
Tribolodon brandtii83.78%ASU91841.1
Schizothorax richardsonii98.04%AIL56343.1
Tor putitora94.74%AIZ03572.1
Clarias magur93.22%AWK21963.1
Osteochilus vittatus85.51%QKG01959.1
Sinocyclocheilus tingi86.11%APT42866.1
Cyprinus carpio85.19%KTG38456.1
Carassius auratus82.86%ACK77790.1
Danionella translucida47.17%TRZ01864.1
Silurus meridionalis43.86%XP_046730475.1
Megalops atlanticus40.59%KAG7477746.1
Astyanax mexicanus41.75%XP_049327815.1
Hemibagrus wyckioides43.43%KAG7319116.1
Bagarius yarrelli38.03%TST85788.1
Albula glossodonta40.91%KAG9352792.1
Anguilla anguilla40.70%XP_035245162.1
Rachycentron canadum31.37% ANJ46819.1
Anoplopoma fimbria33.98%AKN78944.1
Odontesthes bonariensis43.66%AHA46378.1
Amphiprion sebae30.10% AJP70562.1
Amphiprion clarkii30.10%QID05230.1
Chrysiptera cyanea30.10% BAO21623.1
Larimichthys crocea39.36%TMS19587.1
Epinephelus bruneus34.29%ADF59544.1
Sebastes schlegelii35.78%AIZ68243.1
Dicentrarchus labrax31.43%ACM07422.1
Siniperca chuatsi34.62%QYY49470.1
Lates calcarifer31.37%XP_050930503.1
Sander vitreus33.98% AFV25604.1
Seriola lalandi28.16%AEF32393.1
Alosa alosa36.00%KAG5274662.1
Ictidomys tridecemlineatus38.16%XP_005330451.2
Marmota monax38.16%XP_046319241.1
Table
Table 3. SNP locus information of the kiss1 gene.
Table 3. SNP locus information of the kiss1 gene.
SNPsAmino Acid ChangeMutation TypeGenotype FrequencyGene Frequencyp Value
SNP c.3G>TM→Ymissense mutationGG (0.20)
TT (0.80)		G (0.20)
T (0.80)		<0.01
SNP c.12T>CG→Qmissense mutationCC (0.80)
TT (0.20)		C (0.80)
T (0.20)		<0.01
SNP c.198T>GP→Gmissense mutationGG (0.12)
TT (0.87)		G (0.125)
T (0.875)		<0.01
Table
Table 4. Association analysis between kiss1 polymorphism and reproductive traits.
Table 4. Association analysis between kiss1 polymorphism and reproductive traits.
SNPsGenotypeGonad WeightGonadosomatic Index
SNP c.3G>TTT1.39 ± 0.16 a1.75 ± 0.01 a
GG0.73 ± 0.27 b1.70 ± 0.02 b
SNP c.12T>CCC1.27 ± 0.14 a1.74 ± 0.01 a
TT0.73 ± 0.26 a1.70 ± 0.02 a
SNP c.198T>GTT1.22 ± 0.14 a1.73 ± 0.01 a
GG0.72 ± 0.32 a1.69 ± 0.03 a
In the same SNPs with same small letter superscripts mean no significant differences (p > 0.05); different small letter superscripts mean significant differences (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Nie, Z.; Zhao, N.; Zhao, H.; Fu, Z.; Ma, Z.; Wei, J. Cloning, Expression Analysis and SNP Screening of the kiss1 Gene in Male Schizothorax biddulphi. Genes 2023, 14, 862. https://doi.org/10.3390/genes14040862

AMA Style

Nie Z, Zhao N, Zhao H, Fu Z, Ma Z, Wei J. Cloning, Expression Analysis and SNP Screening of the kiss1 Gene in Male Schizothorax biddulphi. Genes. 2023; 14(4):862. https://doi.org/10.3390/genes14040862

Chicago/Turabian Style

Nie, Zhulan, Nianhua Zhao, He Zhao, Zhengyi Fu, Zhenhua Ma, and Jie Wei. 2023. "Cloning, Expression Analysis and SNP Screening of the kiss1 Gene in Male Schizothorax biddulphi" Genes 14, no. 4: 862. https://doi.org/10.3390/genes14040862

APA Style

Nie, Z., Zhao, N., Zhao, H., Fu, Z., Ma, Z., & Wei, J. (2023). Cloning, Expression Analysis and SNP Screening of the kiss1 Gene in Male Schizothorax biddulphi. Genes, 14(4), 862. https://doi.org/10.3390/genes14040862

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop