Next Article in Journal
Genome-Wide Identification of the WD40 Gene Family in Tomato (Solanum lycopersicum L.)
Next Article in Special Issue
Integrated Transcriptomics and Metabolomics Analysis of the Fructan Metabolism Response to Low-Temperature Stress in Garlic
Previous Article in Journal
Genome-Wide Association Analysis for Resistance to Coniothyrium glycines Causing Red Leaf Blotch Disease in Soybean
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ectopic Expression of BcCUC2 Involved in Sculpting the Leaf Margin Serration in Arabidopsis thaliana

1
School of Horticulture, Anhui Agricultural University, Hefei 230036, China
2
College of Horticulture, Nanjing Agricultural University, Nanjing 210095, China
3
Jiangsu Key Laboratory for Horticultural Crop Genetic Improvement, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China
*
Author to whom correspondence should be addressed.
These authors have contributed equally to this work and share first authorship.
Genes 2023, 14(6), 1272; https://doi.org/10.3390/genes14061272
Submission received: 19 April 2023 / Revised: 7 June 2023 / Accepted: 14 June 2023 / Published: 15 June 2023
(This article belongs to the Special Issue Genetics and Breeding of Horticulture Crops)

Abstract

:
Leaf margin serration is a morphological characteristic in plants. The CUC2 (CUP-SHAPED COTYLEDON 2) gene plays an important role in the outgrowth of leaf teeth and enhances leaf serration via suppression of growth in the sinus. In this study, we isolated the BcCUC2 gene from Pak-choi (Brassica rapa ssp. chinensis), which contains a 1104 bp coding sequence, encoding 367 amino acid residues. Multiple sequence alignment exhibited that the BcCUC2 gene has a typical conserved NAC domain, and phylogenetic relationship analysis showed that the BcCUC2 protein has high identity with Cruciferae plants (Brassica oleracea, Arabidopsis thaliana, and Cardamine hirsuta). The tissue-specific expression analysis displayed that the BcCUC2 gene has relatively high transcript abundance in floral organs. Meanwhile, the expression profile of BcCUC2 was relatively higher in the ‘082’ lines with serrate leaf margins than the ‘001’ lines with smooth leaf margins in young leaves, roots, and hypocotyls. In addition, the transcript level of BcCUC2 was up-regulated by IAA and GA3 treatment, especially at 1–3 h. The subcellular localization assay demonstrated that BcCUC2 was a nuclear-target protein. Furthermore, leaf serration occurred, and the number of the inflorescence stem was increased in the transgenic Arabidopsis thaliana plants’ overexpressed BcCUC2 gene. These data illustrated that BcCUC2 is involved in the development of leaf margin serration, lateral branches, and floral organs, contributing to further uncovering and perfecting the regulation mechanism of leaf serration in Pak-choi.

Graphical Abstract

1. Introduction

Leaves are important vegetative organs in plants, and their shape and size directly affect the photosynthesis, transpiration, stress response, and ornamental value of plants. Leaf morphogenesis starts from the flanks of a small group of totipotent stem cells, the shoot apical meristem (SAM) [1]. The development of leaves can be divided into three main stages: (1) the initiation of leaf primordium; (2) the establishment of primary leaf shape, the leaf primordium continuing to grow and differentiate, and the production of secondary structures such as serrate leaves, lobed leaves, and leaflets; (3) the formation of secondary leaf morphology, producing leaf margins, stomata, trichome, and eventually forming mature leaves [2,3].
Plant leaves can be defined as entire leaves (smooth margins), serrate leaves, and lobed leaves according to the margins of the leaf and leaflet blades [4]. Leaf morphology is complex and varied in diverse species, which mainly depends on the regulation of genetic, developmental, and environmental factors [5]. So far, a number of leaf margin regulators have been identified with crucial roles in elaborating leaf shape. The KNAT1, KNAT2, and SHOOT MERISTEMLESS (STM) genes belong to KNOTTED-like homeodomain class I (KNOX1) transcription factors, which are involved in the formation and maintenance of the SAM. The expression level of KNOX1 genes is down-regulated during early leaf initiation, and the overexpression of KNAT1 and KNAT2 leads to occasional ectopic shoots on the adaxial surface of leaves, lobed leaves, and ectopic stipules [6,7,8,9,10]. In Arabidopsis thaliana (A. thaliana) (L.) Heynh., the loss of function of STM is associated with the evolution of the unlobed leaf form; thereby, STM is essential for lobe formation [11].
CUP-SHAPED COTYLEDON (CUC), members of the NAC transcription factors (such as NAM in Petunia hybrida and ATAF1/2 and CUC2 in A. thaliana), which contain a conserved NAC domain at the N-terminus and a highly variable domain in the C-terminal region [12], act as major players in shoot apical meristem (SAM) construction, organ separation, leaf development, and the regulation of the axillary meristem initiation in leaf axils [4,13,14,15,16,17]. In Arabidopsis, the CUC subfamily contains three members, CUC1, CUC2, and CUC3, which act redundantly to regulate cotyledons’ separation, organ boundary specification, and embryonic shoot meristem formation, in part [13,16,18]. The CUC1 and CUC2 genes are necessary for shoot meristem initiation via promoting the transcript level of STM [19]. The cuc1 and cuc2 single mutants display few morphological phenotypes due to their functional redundancy, while the cuc1cuc2 mutant exhibits complete absence of shoot meristem and forms dramatically fused cotyledons [13,18,20]. Mutation of the CUC homologs, the CUPULIFORMIS, NO APICAL MERISTEM (NAM), and GOBLET genes in snapdragon, petunia, and tomato, respectively, results in similar development defects [21,22,23,24], illustrating that these genes share an evolutionarily conserved function in organ separation and SAM development. CUC2 plays an important role in the initiation of leaf serration during the early phase and has a synergistic interaction with CUC3 in the maintenance of leaf serration during the later stage [15]. In addition, MIR164A encodes a microRNA, which is involved in the regulation of leaf margin serration through cooperating with CUC2 in Arabidopsis. The mir164a mutants display significant deep serrate leaf margins compared with the wild type in Arabidopsis [4]. The CUC2 gene is one of the target genes of miR164, and the balance between CUC2 and miR164a has a prominent role in the extent of leaf serrations. In Solanum lycopersicum, loss of GOBLET (GOB), the homologous gene of Arabidopsis CUC2, results in reduced complexity of compound leaves and fruit shape [24], suggesting that the CUC2 gene has diverse functions in different species and plays a crucial role in leaf development.
Pak-choi (Brassica rapa ssp. chinensis) belongs to Brassicaceae crops, is an important leafy vegetable, and is widely cultivated in the middle and lower regions of the Yangtze River. Leaf morphology, as an important agronomic trait, has a direct effect on its yield and ornamental value. In this study, we isolated a CUC2 gene encoding 367 amino acids from Pak-choi, which has three highly conserved CUC2-specific motifs. The expression patterns and biological function of BcCUC2 were systematically investigated.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

Pak-choi cultivar ‘001’ with entire leaf margin and ‘082’ with serrate leaf margin were used in this study. Seeds were dispersed on wet filter paper for germination and grown in pots containing humus soil/vermiculite (2:1) mixture in plant artificial climate chamber controlled at 23/17 °C, 16/8 h for light/dark cycle. The illumination intensity was set to 12,000 xl, and the relative humidity was 65–75%. For different tissues, the samples were harvested at seedling, rosette, flowering, and podding stages. Three biological replicates were used for each sample.
A. thaliana wild type (Columbia-0) was used in this study and grown in illumination incubator under the same condition. Four-week-old tobacco (Nicotiana benthamiana) seedlings were used for subcellular localization assay.

2.2. IAA and GA3 Treatments

Seedlings of cultivar ‘001’ with six fully expanded leaves were foliar sprayed with 100 μM GA3 and IAA. The leaves were collected at 1 h, 3 h, 6 h, 12 h, 24 h, and 48 h after treatment (0 h was used as a control) and frozen rapidly in liquid nitrogen, followed by storage at −70 °C in refrigerators for RNA extraction. Three biological repeats were implemented for each sample.

2.3. Cloning and Sequence Analysis

Total RNA was extracted from leaves using RNAprep pure Plant Kit (TIANGEN, Beijing, China), and the first strands of cDNA were synthesized via reverse transcription using PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara, Dalian, China). The coding sequence (CDS) of BcCUC2 was amplified by gene-specific primers (see Table A1) based on the sequence of Bra022685 using homology cloning referred to in our previous report [25]. The resulting fragment was cloned into pEASYBlunt Simple Vector (Transgene, Beijing, China) and sequenced by Genscript Company (Nanjing, China). The physicochemical characteristics of BcCUC2 were predicted using Expasy proteomics server (https://web.expasy.org/protparam/, accessed on 10 July 2020). The secondary structure of BcCUC2 was predicted using PSIPRED 4.0 (http://bioinf.cs.ucl.ac.uk/psipred/, accessed on 10 July 2020).

2.4. Phylogenetic Tree Analysis

The protein sequences of A. thaliana were obtained from TAIR database (http://arabidopsis.org/index.jsp, accessed on 15 July 2020). The protein sequences of Brassica oleracea, Brassica hirsuta, Solanum lycopersicum, Oryza sativa, Zea mays, and Vitis vinifera were downloaded from NCBI database (https://www.ncbi.nlm.nih.gov/, accessed on 15 July 2020). Multiple sequence alignment of CUC genes in different species was performed using ClustalW software. The phylogenetic tree was constructed by MEGA 7.0 using neighbor-joining (NJ) method with the bootstrap of 1000 replications. All protein sequences used in this study are listed in Table A2. The conserved motifs distribution was analyzed by the MEME program, and the number of motifs was set as 10 (Figure 1B).

2.5. Subcellular Localization Assay

The full-length CDS of BcCUC2 without stop codon was subcloned into linear pRI101-GFP vector with NdeI and BamHI restriction enzyme to generate the construct 35S:BcCUC2-GFP. For transient expression assay, empty vector (35S:GFP) and recombinant construct were introduced into Agrobacterium tumefaciens GV3101 and injected into tobacco foliar epidermis, respectively. After dark culturing for 24 h, the seedlings were moved to normal growth conditions for 24–36 h, and then fluorescent images were photographed using a confocal laser scanning microscope (Zeiss, LSM780, Jena, Germany).

2.6. Ectopic Expression in Arabidopsis

The coding sequence of BcCUC2 was inserted into the pCAMBIA1301 vector to produce the construct 35S:BcCUC2-GUS; then, the recombinant construct was transformed into Arabidopsis using the floral dipping method via Agrobacterium-mediated transformation [26]. In brief, the 35S:BcCUC2-GUS plasmids were transferred into A. tumefaciens GV3101 and agroinfiltrated into the Arabidopsis flowers for 45–60 s, cultivated in dark conditions for 2 d, and then grown in plant artificial climate chamber. To obtain the positive overexpression lines, seeds of Arabidopsis transgenic plants were surface sterilized and sown on half-strength Murashige and Skoog (1/2 MS) tissue culture plates containing 30 mg/L of hygromycin. The resistant seedlings were further testified using gene-specific primers amplification and GUS staining. Finally, 20 plants for each T3 positive transgenic line were cultivated and used for phenotype analysis.

2.7. Quantitative Real-Time PCR

Total RNAs were extracted using RNAprep pure Plant Kit (TIANGEN, Beijing, China) according to the operation manual, and cDNA was synthetized with PrimeScript™RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Dalian, China). qRT-PCR was performed with ABI StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using TransStart Tip Green qPCR SuperMix (TransGen, Beijing, China). The PCR procedure was carried out with the following parameters: 94 °C for 30 s and 40 cycles of 94 °C for 5 s, 60 °C for 15 s, 72 °C for 10 s. The Actin genes of Pak-choi and Arabidopsis were used as internal control, and the relative expression levels were calculated utilizing the 2−ΔΔCt method [27]. All primers used in this study are listed in Table A1.

3. Results

3.1. Cloning and Characteristic Analysis of BcCUC2

The full-length fragment of the BcCUC2 gene was amplified from Pak-choi cultivar ‘001’ using primer pair BcCUC2-F and BcCUC2-R. The BcCUC2 protein is an unstable and hydrophilic protein (GRAVY = −0.567), encoding 367 amino acid residues; the theoretical isoelectric point (pI) is 8.47, and the molecular weight is 40.97 KDa via Expasy online prediction. The BcCUC2 protein has a typical conserved NAC domain at the N-terminal (18–144 amino acid sites) through conserved domain search analysis in NCBI, and it belongs to the NAC family of plant-specific transcription factors. Meanwhile, multiple sequence alignment analysis revealed that the CUC protein sequence of different species shares a highly conserved NAC domain at the N-terminal, while the C-terminal is a transcriptional activation region with abundant variation, reflecting the diversity of species, which is also a general structural feature of NAC transcription factors (Figure 1A). Furthermore, multiple sequence alignment implied that the BcCUC2 protein shares 38.61% and 48.5% identity with OsNAM from rice and SlNAM from tomato, while sharing 81.38% and 74.73% identity with AtCUC2 from Arabidopsis and ChCUC2 from Cardamine hirsuta, suggesting the conservation of Cruciferae species in evolution. Meanwhile, the MEME analysis indicated that motifs 1/2/3/6 were extremely conserved sequences in all species, while motifs 7/9/10 were CUC2-specific sequences of Cruciferae plants (Figure 1B). Additionally, the secondary structure analysis showed that the BcCUC2 protein was mainly composed of α helices, random coils, and extended strands (Figure A1).

3.2. Phylogenetic Tree Analysis of BcCUC2

To explore the phylogenetic relationship of CUC genes, an unrooted phylogenetic tree was constructed using MEGA 7.0 software with the neighbor-joining (NJ) method. As shown in the phylogenetic tree (Figure 2), the CUC genes were firstly divided into two clades, the NAM/CUC1/CUC2 clade and the CUC3 clade. Meanwhile, the CUC genes from dicots (A. thaliana, C. hirsuta, S. lycopersicum, V. vinifera, B. oleracea, and Pak-choi) were clustered together and separated from monocots (O. sativa and Z. mays) into two clades, and the dicot–monocot split occurred 150 million years ago (Mya) [28]. Furthermore, BcCUC2 has a higher similarity with the B. oleracea CUC2 gene (Brassica), followed by the A. thaliana and C. hirsuta CUC2 gene (Cruciferae), and Brassica rapa diverged from A. thaliana and B. oleracea at 20 Mya and 8 Mya, respectively [29,30]. The result indicated that the molecular evolutionary relationship of the CUC2 protein between Pak-choi and seven other species is basically consistent with the genetic relationship.

3.3. Expression Pattern Analysis of BcCUC2 in Pak-choi

The NAM/CUC3 subfamily plays an important role in the formation of shoot meristem and boundary, leaf margin serration, compound leaf, and axillary meristem (lateral branch) [4,13,14,15]. To mirror the spatiotemporal expression patterns of BcCUC2 in Pak-choi, quantitative RT-PCR analysis was carried out. As shown in Figure 3, BcCUC2 was expressed relatively higher in petioles at the seedling stage, in stems and roots at the rosette stage, and in floral organs at the flowering and podding stages, while being weakly expressed in leaves and hypocotyls in cultivar ‘001’ with entire leaf margins.
In addition, to investigate the function of BcCUC2 in leaf morphology, we comprehensively examined the transcript levels of the BcCUC2 gene in cultivar ‘082’ with a serrate leaf margin. The result indicated that BcCUC2 has higher expression in leaves, roots, and hypocotyls at the seedling stage, stems at the rosette stage, and pods and floral organs at the flowering and podding stages. The transcript levels of BcCUC2 were significantly higher in the young leaves of cultivar ‘082’ than in cultivar ‘001’, while being decreased in mature leaves, suggesting a possibility that BcCUC2 has a role in the early steps of leaf serration. Therefore, we inferred that BcCUC2 may participate in leaf morphogenesis and flower development.

3.4. Expression Analysis of BcCUC2 Gene under Hormone Treatment

Several studies have shown that auxin and gibberellin have an important role in the regulation of leaf shape development [31,32,33]. To dissect the response of BcCUC2 to auxin and gibberellin, quantitative expression analysis was performed for the BcCUC2 gene under IAA and GA3 treatment. As shown in Figure 4, the BcCUC2 gene was highly expressed under exogenous IAA and GA3 treatment at the initial stage and peaked at the 3 h time point, demonstrating that the BcCUC2 gene may be regulated by IAA and GA3 through the means of promotion.

3.5. Subcellular Localization Analysis of BcCUC2

To confirm whether the BcCUC2 gene, as a putative transcription factor, is localized in the nucleus, the 35S:BcCUC2-GFP fusion protein was constructed and used for transient transformation in Nicotiana benthamiana using Agrobacterium tumefaciens-mediated transfection methodology. The laser confocal scanning microscope images of tobacco epidermal cells showed that the green fluorescence of the 35S:BcCUC2-GFP fusion protein was mainly distributed in the cell nucleus, while the empty vector (35S:GFP protein, negative control) was expressed in the whole cell, illustrating that BcCUC2 is a nuclear-localized protein (Figure 5).

3.6. Ectopic Expression of BcCUC2 Caused Leaf Margin Serration and Increased Lateral Branches in Arabidopsis

In order to explore the potential function of BcCUC2, we first transformed the BcCUC2 gene into Arabidopsis. The positive transgenic plants were authenticated by PCR amplification using specific primers and GUS staining, and the qRT-PCR was used to check the gene expression level for further verification (Figure A2). Finally, thirteen transgenic lines (termed as OE1-OE13) were obtained, and four lines (OE5, OE6, OE9, OE11) with relatively higher expression levels of BcCUC2 were selected for further research (Figure 6B). We observed that leaf margins were modified when the BcCUC2 gene was overexpressed in Arabidopsis. The phenotype of leaf margin serration was significantly presented in transgenic Arabidopsis plants expressing the BcCUC2 gene, which were clearly distinct from the leaves of wild-type Arabidopsis (Figure 6C). In addition, the ectopic expression lines with the BcCUC2 gene displayed a significant increase in the number of inflorescence stems, flowers, and siliques in comparison with the wild type (Figure 6D). These results demonstrated that BcCUC2 plays critical roles in the formation of leaf margin serration and the development of flower and lateral branches, which is consistent with the high expression abundance in stem and floral organs.

4. Discussion

Previous studies have shown that the serrate morphology of deep-lobed leaf blades is conducive to heat dissipation and defense against high-temperature burns, thereby improving the survival probability of plants [34]. The hydraulic efficiency of the deep-lobed leaves is high, which enhances their adaptability in arid environments [35]. Meanwhile, deep-lobed morphology makes the leaves have a larger specific leaf area in space and thus has stronger competition for light resources and higher photosynthesis efficiency than entire leaves [36]. In addition to its adaptive ability in diverse conditions, the degree of dissection of the leaf margins may add to the ornamental value of leaves in different species. The functional analysis of genes associated with leaf serration development contributes to improving the leaf margin traits using biotechnological methods. Leaf shape is a major agronomic trait, and leaf margins can be lobed, serrate, or entire in plants. Pak-choi, as an economically leafy vegetable, has important edible value and is widely cultivated in Asia. However, the candidate genes and molecular mechanism of serrate leaf margins remain to be fully elucidated.
The NAM/CUC subfamily, including CUC1, CUC2, and CUC3, belongs to the NAC (NAM, ATAF1/2, and CUC) transcription factors family, playing a central and redundant role in plant organ development and organ boundary formation, e.g., in floral organs (gynoecium and ovules), leaf serration, and primary and axillary shoots (reviewed in [37]). So far, CUC genes have been widely studied in several species. For example, in Arabidopsis, CUC1 and CUC2 are involved in the formation of carpel margin meristem by controlling shoot meristem activity [38] and regulating carpel margin development through interacting with SPATULA (SPT) [39], and CUC3 has significant roles in regulating organ boundary formation and postembryonic shoot meristem [16]. In addition, CUC2 participates in ovule primordia formation via direct interaction with the DELLA protein GAI [33]. The balance between miR164a and CUC2 is responsible for the extent of leaf serrations [4]. In strawberry, the miR164-CUC2 regulatory module plays conserved and novel roles in specifying leaf and floral organ morphology [40]. In tomato, the GOBLET (GOB) gene, homologous to the CUC2 gene, plays important roles in regulating fruit shape and the complexity of compound leaves [24]. In Liriodendron chinense, the LcCUC2-like (LcCUC2L) gene, homologous to AtCUC2 in sequence, has an important role in controlling cotyledon development and rosette leaf number [32]. According to the above reports, the CUC2 gene has prominent roles in organ boundary formation and organ number.
The functional importance and relationship of the CUC2 gene in Pak-choi, however, is poorly understood. Here, we performed systematic analysis of the characterization and function of BcCUC2 using bioinformatics tools, real-time PCR, and ectopic expression in Arabidopsis. The phylogenetic tree displayed that the BcCUC2 gene was clustered into the NAM/CUC1/CUC2 clade and close to the B. oleracea BoCUC2 and A. thaliana AtCUC2, which all belong to Cruciferae, consistent with their evolutionary history. The tissue-specific expression analysis showed that BcCUC2 has relatively higher transcript levels in stem and floral organs and differential expression in leaves with smooth margins or serrate margins, indicating that BcCUC2 may be involved in the proper control of leaf morphology and the development of floral organs. In addition, the expression abundance of the BcCUC2 gene was observably greater in young leaves with serrate margins (cultivar ‘082’) than smooth margins (cultivar ‘001’), while being markedly decreased in mature leaves, possibly implying that BcCUC2 participated in the formation of serrate margins in early leaf development. In the Pro35:BcCUC2 lines, the transcript levels of BcCUC2 were significantly up-regulated and the phenotype of leaf serration and increased inflorescence stems, flowers, and siliques were found, supporting our hypothesis that BcCUC2 is involved in modulating the development of floral organs and leaf morphology. It is interesting that the phenotype of leaf serration was significant at the seedling stage, while being diminished at mature and flower stages in transgenic lines, which is consistent with the spatiotemporal expression profile of BcCUC2. On the other hand, given that the overexpression of BcCUC2 in Arabidopsis resulted in non-significant enhancement of serration, it is possible that BcCUC2 may be less functional in Arabidopsis than in Pak-choi, or line ‘082’ may have another potential gene to enhance serration.
In plants, phytohormones have a crucial role in the growth and development and cell morphogenesis of diverse tissues. Leaf shape traits are regulated by an intricate regulatory network concerning transcription factors and hormone signaling [4]. For instance, PIN1, as an auxin efflux carrier, plays an essential role in auxin distribution in the placenta, and the expression of PIN1 was up-regulated by CUC genes, which have crucial roles in leaf shape [31]. In L. chinense, LcCUC2L regulates leaf development by regulating the auxin content [32]. Furthermore, the ovule primordia formation was modulated by CUC2’s direct interaction with the gibberellin signaling protein GAI [33]. To investigate the response of BcCUC2 to auxin and gibberellin, the expression patterns of BcCUC2 under IAA and GA3 treatment were analyzed. The result showed that the transcript levels of BcCUC2 were significantly increased at 1–3 h after treatment, indicating that BcCUC2 responds to auxin and gibberellin. Based on the above results, we speculated that BcCUC2 is involved in the formation of serrate leaf margins through the mediation of auxin or gibberellin.
Although the expression patterns and potential function of BcCUC2 have been preliminarily determined based on real-time PCR and overexpression assay, the specific reason for the difference in leaf morphology and BcCUC2 expression profiles between the lines ‘001’ and ‘082’ remains unclear. Several studies have shown that miR164 level or auxin levels have an essential role in the development of leaf morphology [4,31,32,40]. Thus, the promoter sequence of BcCUC2, miR164 level, or auxin levels between the lines ‘001’ and ‘082’ will be analyzed to further elucidate the molecular mechanism of leaf morphology and BcCUC2 expression difference between the lines.

5. Conclusions

In conclusion, we have isolated a CUP-SHAPED COTYLEDON (CUC) gene in Pak-choi named BcCUC2. The phylogenetic reconstruction displayed that the BcCUC2 gene is clustered into the CUC1/CUC2 clade and is close to the B. oleracea BoCUC2 and A. thaliana AtCUC2, which all belong to Cruciferae. The expression patterns of the BcCUC2 gene were significantly different in leaves and petioles between cultivar ‘001’ with entire leaf margins and ‘082’ with serrate leaf margins, while similar in floral organs. In addition, the transcript abundance of BcCUC2 was significantly induced by IAA and GA3 treatment. The heterologous expression of BcCUC2 resulted in leaves with serrate margins and more inflorescence stems.

Author Contributions

Conceptualization, X.H. and H.H.; methodology, W.L. and H.H.; software, T.W., N.W. and Y.M.; validation, W.W., J.T. and C.Z.; data curation, H.H.; writing—original draft preparation, W.L., T.W. and H.H.; writing—review and editing, X.H., C.Z. and J.T.; visualization and supervision, H.H.; funding acquisition, H.H. and J.T. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Research Start-up Funds in Anhui Agricultural University (rc322006) and the National Natural Science Foundation of China (32072619).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data supporting the findings of this study are available from the corresponding author upon reasonable request.

Acknowledgments

We thank Xilin Hou of Nanjing Agricultural University for providing the materials (cultivar ‘001’ and ‘082’) used for the experiments.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Figure A1. The secondary structure of BcCUC2.
Figure A1. The secondary structure of BcCUC2.
Genes 14 01272 g0a1
Figure A2. The verification of transgenic plants. The positive transgenic plants were identified using PCR amplification with gene-specific primers (A) and GUS staining (B).
Figure A2. The verification of transgenic plants. The positive transgenic plants were identified using PCR amplification with gene-specific primers (A) and GUS staining (B).
Genes 14 01272 g0a2
Table A1. Primers used in this study.
Table A1. Primers used in this study.
PrimerSequence (5′-3′)
Cloning
BcCUC2-FATGGACATTCCGTACTACCAC
BcCUC2-RGTAATTCCATACGCAATCAAG
qRT-PCR
qBcCUC2-FCGGAGGCTCAGCAGAAGCAA
qBcCUC2-RGGTGTAGCCGAGGGTTGTGG
qBcActin-FGTTGCTATCCAGGCTGTTCT
qBcActin-RAGCGTGAGGAAGAGCATAAC
qAtActin-FTTGACAATTGATGCAAACAAT
qAtActin-RCCATTGCTTAATTCCACGGAC
Overexpression
KpnI-BcCUC2-FGGGGTACCATGGACATTCCGTACTACCAC
BamHI-BcCUC2-RCGGGATCCGTAATTCCATACGCAATCAAG
Table A2. The protein sequences of CUC gene used in this study.
Table A2. The protein sequences of CUC gene used in this study.
Gene NameGenBank AccessionPlant SpeciesProtein Sequences
AtCUC1NM_112380Arabidopsis thalianaMDVDVFNGWGRPRFEDESLMPPGFRFHPTDEELITYYLLKKVLDSNFSCAAISQVDLNKSEPWELPEKAKMGEKEWYFFTLRDRKYPTGLRTNRATEAGYWKATGKDREIKSSKTKSLLGMKKTLVFYKGRAPKGEKSCWVMHEYRLDGKFSYHYISSSAKDEWVLCKVCLKSGVVSRETNLISSSSSSAVTGEFSSAGSAIAPIINTFATEHVSCFSNNSAAHTDASFHTFLPAPPPSLPPRQPRHVGDGVAFGQFLDLGSSGQIDFDAAAAAFFPNLPSLPPTVLPPPPSFAMYGGGSPAVSVWPFTL
AtCUC2NM_124774Arabidopsis thalianaMDIPYYHYDHGGDSQYLPPGFRFHPTDEELITHYLLRKVLDGCFSSRAIAEVDLNKCEPWQLPGRAKMGEKEWYFFSLRDRKYPTGLRTNRATEAGYWKATGKDREIFSSKTCALVGMKKTLVFYKGRAPKGEKSNWVMHEYRLEGKFSYHFISRSSKDEWVISRVFQKTTLASTGAVSEGGGGGGATVSVSSGTGPSKKTKVPSTISRNYQEQPSSPSSVSLPPLLDPTTTLGYTDSSCSYDSRSTNTTVTASAITEHVSCFSTVPTTTTALGLDVNSFSRLPPPLGFDFDPFPRFVSRNVSTQSNFRSFQENFNQFPYFGSSSASTMTSAVNLPSFQGGGGVSGMNYWLPATAEENESKVGVLHAGLDCIWNY
AtCUC3NM_106292Arabidopsis thalianaMMLAVEDVLSELAGEERNERGLPPGFRFHPTDEELITFYLASKIFHGGLSGIHISEVDLNRCEPWELPEMAKMGEREWYFYSLRDRKYPTGLRTNRATTAGYWKATGKDKEVFSGGGGQLVGMKKTLVFYKGRAPRGLKTKWVMHEYRLENDHSHRHTCKEEWVICRVFNKTGDRKNVGLIHNQISYLHNHSLSTTHHHHHEALPLLIEPSNKTLTNFPSLLYDDPHQNYNNNNFLHGSSGHNIDELKALINPVVSQLNGIIFPSGNNNNDEDDFDFNLGVKTEQSSNGNEIDVRDYLENPLFQEASYGLLGFSSSPGPLHMLLDSPCPLGFQL
ChCUC1 ACL14369.1Cardamine hirsutaMDIVVFNGSERPRFEDDTLMPPGFRFHPTDEELITYYLLKKVLDSNFSCAAISQVNLNKSEPWELPEKAKMGEKEWYFFTLRDRKYPTGLRTNRATEAGYWKATGKDREIKSSKTKSLLGMKKTLVFYKGRAPKGEKSSWVMHEYRLDGKFSYHYISSSAKDEWVLCKVCLKSGVVNRETKSISSSTSAAGEFSSPGSTIAPIIDAFASEHVSCFSNDAAHANESFRTTYLPAPPPSLPPRQPRHIGDDVAFGQFMDFGFSGQIHYDAAAFFPNLPSLPPTALPPPPSFAMYGGGSTLSYWPFAL
ChCUC2ACL14370.1Cardamine hirsutaMDIPYYHYDHGGDSQYLPPGFRFHPTDEELITHYLLRKVLDGCFSSRAIAEVDLNKCEPWQLPGRAKMGEKEWYFFSLRDRKYPTGLRTNRATEAGYWKATGKDREIYSSKTCALIGMKKTLVFYKGRAPKGEKSNWVMHEYRLEGKFSYHFISRSSKDEWVISRVFQKTGLLSTGAAGAGAIVSGSNGTGTSKKTKIPSTISRNYQEQPSSPSSVSLPPLLGYTDSSCSYDGHSTNTTVTATGITEHVSCFSTATTTNTTTTDLGLDVNVDSFNHFPPPVFDPLPRFVSRNVSNLSNFRSFQDNQFPYFGSSSSASTMTSSVHLPSSQSGGSGVSGMNYWLQATAEENETKAGVLQAGLDCIWNY
ChCUC3ACL14365.1Cardamine hirsutaMMLAVEDVLSELAGEERNERGLPPGFRFHPTDEELISFYLASKVFDGGLCGIHITEVDLNRCEPWELPEMAKMGEKEWYFYSLRDRKYPTGLRTNRATTAGYWKATGKDKEVFGSGGGQLVGMKKTLVFYKGRAPRGLKTKWVMHEYRLETDLSHRHSCKEEWVICRVFNKTGDRKNVGVHSQISCLHNHSLSTYHHHHHETLPPLLEPSKTISNFPSLLYDDHTHQNHNNNLFHGSSGHHHIDELKALINPVVSQLNGIIFSPGNNNNVDDEDDFNLGVKTEPFLNGGSNELDVRDYLENPLFHEVGYGLLGVSSAPGPLHMLLDSPCPLGFQL
OsNAMEAZ00836.1Oryza sativaMERCSVLGLGGGGGGGGRLDGELPPGFRFHPTDEELITYYLLRKVVDGSFNGRAIAEIDLNKCEPWELPEKAKMGEKEWYFYSLRDRKYPTGLRTNRATGAGYWKATGKDREIRSARTGALVGMKKTLVFYRGRAPKGQKTQWVMHEYRLDGTYAYHFLSSSTRDEWVIARIFTKPGVFPVVRKGRLGISGGGGDTSCFSDSTSASVGGGGGTSASSALRAPLAEASLFAAAAAPAVDGADSSNYGGGGGGGSATATANLVTGLELVPCFSTTAHMDASFGTGQYNPAPLAVEPPPPPPAFFPSLRSLQENLQLPLFLSGGMQAGVSSQPLSGSGAFHWQSGMDVKVEGAVGRAPPQMAVGPGQLDGAFAWGF
OsCUC3NP_001062212.1Oryza sativaMPTTEILQHYSVVSQIKSHGKGIASEFPSALASWSADQISTDGAANLAGKLKQARSQIKNWTKNRTSCRFLDNDCKFVIDLFDFLEELRELSAPERLLRQMVQDKFTQYKLMQASYWKQRGKVKKIRLGIDNTHFFKAHATQNHRRTFIRSIKLTDMEVSEHSDKATTMFSYYNSILGASTETSWSFDLHTIYHGCAMANADELVQPFSEQEIFQAIKHMDKNSAPGPDGFGPGFFQAAWAMIKPDILHLLQSFYDETADMERINRAFIVLIPKPGKTNTPDGYRPISLQNCSVKIIAKVMANRMQRQLPPLIDLDQSGFLKREKHLGELHLCKILQARGFPFLWRSWTNRLLQTSKSAIMINGVPGNWINCKRGVRQGDPMSPYLFILVADVLQKLIRHSGEIKHPIYPDQPCATLQYADDTIIICRATEQDLAALKTCLNHFAAATGLHINFSKSTLVTMHVPDEVTTALANILQCKTDSSWGRWIWQEHSGSALFCDNQLGPHWDSLSTLLPILQRLTRVQVGDGTRTSFWHDCWYGSSTFKDRFAPLFSHALNREATVAVFLSKPIEDQFAPRLSSTAETQLARLREMLQNFYLSNSTDLCPSRDAPGILRTKFIYSSTHMGLPLCKNWRFIWDNRAPPRVQFFAWLLAKDRLPTKANLHKKNIVPTAGCIVCNCADETATHLFLQCQFAQEFWRALRTSVVSNVQDLADLVAPCHLPVKHFQVFFLLCFWGLWNHRHDVVFRGLPNSRTRNLQSLKPAESQAAGQPPEVWYACVAWAQLCRDIADNRTKPRSAAFEKSRNQPAIEHACMQGKNGFCVRGTSDSEMHHHSATMGDALWEMLGEEMAAAAAAAGEHGLPPGFRFHPTDEELVTFYLAAKVFNGACCGGVDIAEVDLNRCEPWELPEAARMGEKEWYFFSLRDRKYPTGLRTNRATGAGYWKATGKDREVVAAAAAGGALIGMKKTLVFYKGRAPRGEKTKWVLHEYRLDGDFAAARRSTKEEWVICRIFHKVGDQYSKLMMMKSPASYYLPVSHHHPSSIFHDLPPVPFPNPSLVPFHHDLPTSFHPPLLQHSHANSKNSSSNNGGFVFPNEPNTTNSSDNHISCNGAMAAAAAAAFPSFSCASTVTGKGGPPAQLGVNAGQQEPPPPTWMDAYLQHSGFIYEMGPPAVPRGA
ZmNAM1CAH56057.1Zea maysMERFGLDGGGGGGELPPGFRFHPTDEELITYYLLRKAVDGSFCGRAIAEIDLNKCEPWELPGKAKMGEKEWYFYSLRDRKYPTGLRTNRATVAGYWKATGKDREIRSGRTGALVGMKKTLVFYRGRAPKGQKTHWVMHEYRLEGAYAYHFLPSSTRQDEWVIARVFQKPGEVPPAARKHRLGALSSTTGTAAGDSCFSDSTSASIGGASSSSTPGPLFASAAAAVANAGAADGDTSSYCGGAANHGNLVTGRELVPCFSTATINGPLVAAALGIGQPYNAAPLPFEQQPPPPAFLPSLRSLQDNLQLPPFLSAGGLGGGGALHWLPAGGMEVKVEGRSAPPQMAVGPGQLDGAFGWSF
ZmNAM2CAH56058.1Zea maysMERLGVGVGVGELPPGFRFHPTDEELITYYLLCKAVDGGFCGGRAIAEIDLNKCEPWELPGKAKMGEKEWYFYCLRDRKYPTGLRTNRATAAGYWKATGKDREVRSGRSGALVGMKKTLVFYRGRAPRGQKTRWVMHEYRLDGTYAYHFLPGSTRDEWVIARVFQKPGEVPCGRKHRLGGPSAAAGDSCFSDSTTSASIGGGGGGGASASSRPLLTVTDTSSPSLFVANANAAASNNNGNPVTGRELVPCFSTTASPLEAAALGVVGHPYNAAPLRLGLDFEAPSPGFVVPNLRSLQVQDDGGLPLFLSAAAGGGMSSATLGIMGSLGGSLHCPPHAGMDVVKVEGRAAPPQMAVGPGLLDGAFAWGF
ZmCUC3CAH56059.1Zea maysMAAAGGEHGLPPGFRFHPTDEELVTFYLAAKVFNGACCGIDIAEVDLNRCEPWELPDAARMGEREWYFFSLRDRKYPTGLRTNRATGAGYWKATGKDREVLNAATGALLGMKKTLVFYKGRAPRGEKTKWVLHEYRLDGDFAAARRPCKEEWVICRILHKAGDQYSKLMMVKSPYYLPMAMDPSSFCFQEDPTGHPLPNPSGCTPFHHGHPHHSMQPPPPLPPSNHAGKAVFTGAAAACCMQQEPADGSNSAVLPMPPFPPFTPIVAGKPAAPAPPPQVVNAGPQEPPPPTWLEAYLQHTGGILYEMGPTAAPRGA
SlNAMACL14371.1Solanum lycopersicumMEIYHQMQFDCGDPHLPPGFRFHPTDEELITYYLLKKVLDCNFTARAIAEVDLNKCEPWELPGKAKMGEKEWYFFSLRDRKYPTGLRTNRATEAGYWKATGKDREIFSSKTCALVGMKKTLVFYRGRAPKGEKSNWVMHEYRLDGKFAYHYISRSSKDEWVISRVFQKSTGSNGAATSTGGGKKRLSSSINMYQEVSSPSSVSHLPPLLDSSPYSTTATSAAAIVIGDRDRDHSFKKEHVPCFSTTATATITAQSLTFDPTSVFDISSNTLHALQPTPSFASILDSSPSNFTNYTRNSTFPSLRSLHENLQLPLFSGGTSAMHGGFSNPMVNWTVPETQKVEQSELDCMWSY
VvNAM1XP_002282655.1Vitis viniferaMDAYHHFDNSDAHLPPGFRFHPTDEELITYYLIKKVLDSNFTGRAIAEVDLNKCEPWELPEKAKMGEKEWYFFSLRDRKYPTGLRTNRATEAGYWKATGKDREIYSSKTCSLVGMKKTLVFYRGRAPKGEKSNWVMHEYRLEGKFAYHYLSRSSKDEWVISRVFQKSGSSGGGGATGGKKARLSSTVNLYPEVSSPSSASLPPLLDVSPYAGTSAAAAVNDRESCSYDGGESSNNSNARDQHVPWFSTIAAAAAAAAANSFNAHHQPPPFDLAPPSIIGSIDPSRFPRNGAVPAFPNLRSLQENLHLPFFFSQVAPPIPSSGDPSTEMGITNSAGNWPAPENQKMDNGRLPMGATELDCMWSY
VvNAM2XP_002280812.1Vitis viniferaMEEERKEETLPPGFRFHPTDEELITCYLINKISDATFTGRAIADVDLNKCEPWELPGKAKMGEKEWYFFSLRDRKYPTGVRTNRATNTGYWKTTGKDKEIFNSVTSELVGMKKTLVFYRGRAPRGEKTNWVMHEYRIHSKSAFRTSKDEWVVCRVFQKSAAGKKYPSNQSRGMNPYSLDIGPSVMPPPMLQADSSQFPMGRNYVSNAELAELTRVLRGGSTGGLNLPIQSQLNYPLGGGCFTISGLNLNLGGTSTQPVLRPNSLPQPMQMNQQDHMMTSPMLTSGSIPTDQTGYGAEVNNGNGHNSRFMNMVDHCVDLDNYWPPY
VvNAM3XP_002276293.2Vitis viniferaMQQAANQMHEKMEESLPPGFRFHPTDEELITYYLTPKVSNTNFASRAIADVDLNKCEPWDLPAKASMGEKEWYFFSLRDRKYPTGIRTNRATEAGYWKTTGKDKEIYRAGILVGMKKTLVFYKGRAPKGEKSNWVMHEYRLETKLSFKPKKEEWVVCRVFKKSSAVKKPHQPAPSSLPSLESPCDTNTIVSEFGDIEFPNMNSIANSSSGFSNINSAQSYNTSTDDNLNMNMNMNMNMNWAAAREAASLPSLPWSSSLLSPNLQMNSLLIKALQLGSYRPREATSTENYSFLPQGISNFGTDFISNFQASSSKVLDSLHQQQQQQQQEQPFNLDSINWFGHMSRSNSLNYLGKHSTSRLINSHRTAPQHKQAAGLSSCHMFLTPGPAPFLVNVLKTHGHHGSQQQSILCHTITHTKQLTQLLTSSAALLAACHSGLLPGASTAAPLCSVASTGQWLPSSICSAQPTCRRRQDSAKENPWDGLMGMVGDNGYEEVNRKGHVWPCKGGGDRHEGRASMVMGIRRTMSLAWRLMHGMIPHGA
VvCUC3XP_002273222.1Vitis viniferaMLAMEEVLCELSREDINEQGLPPGFRFHPTDEELITFYLASKVFNGSFCGVEIAEVDLNRCEPWELPDVAKMGEREWYFFSLRDRKYPTGLRTNRATGAGYWKATGKDREVHSASSGALLGMKKTLVFYKGRAPRGEKTKWVMHEYRLDGDFSYRHTCKEEWVICRIFHKTGEKKNPMFQGQAYLLGSSAAAAVATSSLPALLESQTTLLESQSHPTMQGGISSSFLVHHHHDQESNELKALINPVLSQSPLAFPINSGFQSCSFSTTPTTNIPNTNNINSTTGNNNPSTSILFKSLLSHQECSLKEQTTIPKQCKTEANFSHFQLPDANMHWVDRMNSNLHQNPLFFEMDYCSGGVLGFTAATATGGGGGGGGASAAATSAAVASAAETVHEMSTSIAFNRAGFQMMVDFPIRVPGGESWPLDP
BoCUC2HQ703968Brassica oleraceaDHGGDSQYLPPGFRFHPTDEELITHYLLRKVIEGCFSSRAIAEVDLNKSEPWQLPGKAKMGEKEWYFFSLRDRKYPTGLRTNRATEAGYWKATGKDREIYSSKTCALVGMKKTLVFYKGRAPKGEKSSWVMHEYRLEGKFSYHFISRSSKDEWVISRVFKKTGLATTGASAGASISVSNCTGTSKKTKIPSNISTNYREQPSSPSSVSLPPLLDPTTTLGYTDSSWSYDSRSTNTPVITTAIT
BoCUC3HQ703970Brassica oleraceaNDRGLPPGFRFHPTDEELITFYLASKVFHGGLCGIHIAEVDLNRCEPWELPEMAKMGEREWYFYSLRDRKYPTGLRTNRATTAGYWKATGKDKEVFAGGGSGGGALVGMKKTLVFYKGRAPRGLKTKWVMHEYRLETDLSHRHTCKEEWVICRVFNKTGDRKNVGIHNQISYLHNTSLSTTHQQRNHNHYHHLEILPPLLEPSKTLTNFPSLLYDDTHQNYNNNLLHGSSGHNVDEFKTLINPAVSQLNGVIFSPEISNYNNEDDNNFGIKTEQYSNGGNNDLDVRDYLDNPFCQEAGYGLLGLSSSPGPLM

References

  1. Fleming, A.J. The control of leaf development. New Phytol. 2005, 166, 9–20. [Google Scholar] [CrossRef] [PubMed]
  2. Holtan, H.E.; Hake, S. Quantitative Trait Analysis of Leaf Dissection in Tomato Using Lycopersicon pennellii Segmental Introgression Lines. Genetics 2003, 165, 1541–1550. [Google Scholar] [CrossRef] [PubMed]
  3. Barkoulas, M.; Galinha, C.; Grigg, S.P.; Tsiantis, M. From genes to shape: Regulatory interactions in leaf development. Curr. Opin. Plant Biol. 2007, 10, 660–666. [Google Scholar] [CrossRef] [PubMed]
  4. Nikovics, K.; Blein, T.; Peaucelle, A.; Ishida, T.; Morin, H.; Aida, M.; Laufs, P. The Balance between the MIR164A and CUC2 Genes Controls Leaf Margin Serration in Arabidopsis. Plant Cell 2006, 18, 2929–2945. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Tsukaya, H. Leaf shape: Genetic controls and environmental factors. Int. J. Dev. Biol. 2005, 49, 547–555. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Lincoln, C.; Long, J.; Yamaguchi, J.; Serikawa, K.; Hake, S. A knotted1-like homeobox gene in Arabidopsis is expressed in the vegetative meristem and dramatically alters leaf morphology when overexpressed in transgenic plants. Plant Cell 1994, 6, 1859–1876. [Google Scholar]
  7. Long, J.A.; Moan, E.I.; Medford, J.I.; Barton, M.K. A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 1996, 379, 66–69. [Google Scholar] [CrossRef]
  8. Reinhardt, D.; Mandel, T.; Kuhlemeier, C. Auxin regulates the initiation and radial position of plant lateral organs. Plant Cell 2000, 12, 507–518. [Google Scholar] [CrossRef] [Green Version]
  9. Chuck, G.; Lincoln, C.; Hake, S. KNAT1 induces lobed leaves with ectopic meristems when overexpressed in Arabidopsis. Plant Cell 1996, 8, 1277–1289. [Google Scholar]
  10. Pautot, V.; Dockx, J.; Hamant, O.; Kronenberger, J.; Grandjean, O.; Jublot, D.; Traas, J. KNAT2: Evidence for a Link between Knotted-Like Genes and Carpel Development. Plant Cell 2001, 13, 1719–1734. [Google Scholar] [CrossRef] [Green Version]
  11. Piazza, P.; Bailey, C.D.; Cartolano, M.; Krieger, J.; Cao, J.; Ossowski, S.; Schneeberger, K.; He, F.; de Meaux, J.; Hall, N.; et al. Arabidopsis thaliana leaf form evolved via loss of knox expression in leaves in association with a selective sweep. Curr. Biol. 2010, 20, 2223–2228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Ooka, H.; Satoh, K.; Doi, K.; Nagata, T.; Otomo, Y.; Murakami, K.; Matsubara, K.; Osato, N.; Kawai, J.; Carninci, P.; et al. Comprehensive Analysis of NAC Family Genes in Oryza sativa and Arabidopsis thaliana. DNA Res. 2003, 10, 239–247. [Google Scholar] [CrossRef] [PubMed]
  13. Vroemen, C.W.; Mordhorst, A.P.; Albrecht, C.; Kwaaitaal, M.A.; de Vries, S.C. The CUP-SHAPED COTYLEDON3 gene is required for boundary and shoot meristem formation in Arabidopsis. Plant Cell 2003, 15, 1563–1577. [Google Scholar] [CrossRef] [PubMed]
  14. Zimmermann, R.; Werr, W. Pattern formation in the monocot embryo as revealed by NAM and CUC3 orthologues from Zea mays L. Plant Mol. Biol. 2005, 58, 669–685. [Google Scholar] [CrossRef] [PubMed]
  15. Hasson, A.; Plessis, A.; Blein, T.; Adroher, B.; Grigg, S.; Tsiantis, M.; Boudaoud, A.; Damerval, C.; Laufs, P. Evolution and diverse roles of the cup-shaped cotyledon genes in Arabidopsis leaf development. Plant Cell 2011, 23, 54–68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Hibara, K.; Karim, M.R.; Takada, S.; Taoka, K.; Furutani, M.; Aida, M.; Tasaka, M. Arabidopsis CUP-SHAPED COTYLEDON3 regulates postembryonic shoot meristem and organ boundary formation. Plant Cell 2006, 18, 2946–2957. [Google Scholar] [CrossRef] [Green Version]
  17. Raman, S.; Greb, T.; Peaucelle, A.; Blein, T.; Laufs, P.; Theres, K. Interplay of miR164, CUP-SHAPED COTYLEDON genes and LATERAL SUPPRESSOR controls axillary meristem formation in Arabidopsis thaliana. Plant J. 2008, 55, 65–76. [Google Scholar] [CrossRef]
  18. Aida, M.; Ishida, T.; Fukaki, H.; Fujisawa, H.; Tasaka, M. Genes involved in organ separation in Arabidopsis: An analysis of the cup-shaped cotyledon mutant. Plant Cell 1997, 9, 841–857. [Google Scholar] [CrossRef] [Green Version]
  19. Hibara, K.; Takada, S.; Tasaka, M. CUC1 gene activates the expression of SAM-related genes to induce adventitious shoot formation. Plant J. 2003, 36, 687–696. [Google Scholar] [CrossRef]
  20. Takada, S.; Hibara, K.; Ishida, T.; Tasaka, M. The CUP-SHAPED COTYLEDON1 gene of Arabidopsis regulates shoot apical meristem formation. Development 2001, 128, 1127–1135. [Google Scholar] [CrossRef]
  21. Souer, E.; van Houwelingen, A.; Kloos, D.; Mol, J.; Koes, R. The no apical meristem gene of Petunia is required for pattern formation in embryos and flowers and is expressed at meristem and primordia boundaries. Cell 1996, 85, 159–170. [Google Scholar] [CrossRef] [Green Version]
  22. Weir, I.; Lu, J.; Cook, H.; Causier, B.; Schwarz-Sommer, Z.; Davies, B. CUPULIFORMIS establishes lateral organ boundaries in Antirrhinum. Development 2004, 131, 915–922. [Google Scholar] [CrossRef] [Green Version]
  23. Blein, T.; Pulido, A.; Vialette-Guiraud, A.; Nikovics, K.; Morin, H.; Hay, A.; Johansen, I.E.; Tsiantis, M.; Laufs, P. A conserved molecular framework for compound leaf development. Science 2008, 322, 1835–1839. [Google Scholar] [CrossRef] [Green Version]
  24. Berger, Y.; Harpaz-Saad, S.; Brand, A.; Melnik, H.; Sirding, N.; Alvarez, J.P.; Zinder, M.; Samach, A.; Eshed, Y.; Ori, N. The NAC-domain transcription factor GOBLET specifies leaflet boundaries in compound tomato leaves. Development 2009, 136, 823–832. [Google Scholar] [CrossRef] [Green Version]
  25. Song, X.; Li, Y.; Liu, T.; Duan, W.; Huang, Z.; Wang, L.; Tan, H.; Hou, X. Genes associated with agronomic traits in non-heading Chinese cabbage identified by expression profiling. BMC Plant Biol. 2014, 14, 71. [Google Scholar] [CrossRef] [Green Version]
  26. Mara, C.; Grigorova, B.; Liu, Z. Floral-dip transformation of Arabidopsis thaliana to examine pTSO2::β-glucuronidase reporter gene expression. J. Vis. Exp. 2010, 40, 1952. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  28. Wikstrom, N.; Savolainen, V.; Chase, M.W. Evolution of the angiosperms: Calibrating the family tree. Proc. Biol. Sci. 2001, 268, 2211–2220. [Google Scholar] [CrossRef] [PubMed]
  29. Yang, Y.W.; Lai, K.N.; Tai, P.Y.; Li, W.H. Rates of nucleotide substitution in angiosperm mitochondrial DNA sequences and dates of divergence between Brassica and other angiosperm lineages. J. Mol. Evol. 1999, 48, 597–604. [Google Scholar] [CrossRef] [PubMed]
  30. Wroblewski, T.; Coulibaly, S.; Sadowski, J.; Quiros, C.F. Variation and phylogenetic utility of the Arabidopsis thaliana Rps2 homolog in various species of the tribe Brassiceae. Mol. Phylogenet. Evol. 2000, 16, 440–448. [Google Scholar] [CrossRef]
  31. Galbiati, F.; Sinha Roy, D.; Simonini, S.; Cucinotta, M.; Ceccato, L.; Cuesta, C.; Simaskova, M.; Benkova, E.; Kamiuchi, Y.; Aida, M.; et al. An integrative model of the control of ovule primordia formation. Plant J. 2013, 76, 446–455. [Google Scholar] [CrossRef]
  32. Wen, S.; Li, J.; Hao, Z.; Wei, L.; Ma, J.; Zong, Y.; Li, H. Overexpression of the LcCUC2-like gene in Arabidopsis thaliana alters the cotyledon morphology and increases rosette leaf number. Peer J. 2022, 2, e12615. [Google Scholar] [CrossRef]
  33. Barro-Trastoy, D.; Gomez, M.D.; Blanco-Touriñán, N.; Tornero, P.; Perez-Amador, M.A. Gibberellins regulate ovule number through a DELLA-CUC2 complex in Arabidopsis. Plant J. 2022, 110, 43–57. [Google Scholar] [CrossRef]
  34. Vogel, S. Leaves in the lowest and highest winds: Temperature, force and shape. New Phytol. 2009, 183, 13–26. [Google Scholar] [CrossRef]
  35. Sisó, S.; Camarero, J.; Gil-Pelegrín, E. Relationship between hydraulic resistance and leaf morphology in broadleaf Quercus species: A new interpretation of leaf lobation. Trees 2001, 15, 341–345. [Google Scholar] [CrossRef]
  36. Semchenko, M.; Zobel, K. The role of leaf lobation in elongation responses to shade in the rosette-forming forb Serratula tinctoria (Asteraceae). Ann. Bot. 2007, 100, 83–90. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Maugarny, A.; Gonalves, B.; Arnaud, N.; Laufs, P. Cuc transcription factors: To the meristem and beyond. In Plant Transcription Factors; Academic Press: Cambridge, MA, USA, 2016; pp. 229–247. [Google Scholar]
  38. Kamiuchi, Y.; Yamamoto, K.; Furutani, M.; Tasaka, M.; Aida, M. The CUC1 and CUC2 genes promote carpel margin meristemformation during Arabidopsis gynoecium development. Front. Plant Sci. 2014, 5, 165. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Nahar, M.A.; Ishida, T.; Smyth, D.R.; Tasaka, M.; Aida, M. Interactions of CUP-SHAPED COTYLEDON and SAPTULA genes control carpel margin development in Arabidopsis thaliana. Plant Cell Physiol. 2012, 53, 1134–1143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Zheng, G.; Wei, W.; Li, Y.; Kan, L.; Wang, F.; Zhang, X.; Li, F.; Liu, Z.; Kang, C. Conserved and novel roles of miR164-CUC2 regulatory module in specifying leaf and floral organ morphology in strawberry. New Phytol. 2019, 224, 480–492. [Google Scholar] [CrossRef]
Figure 1. Alignment and conserved motif of plant CUC protein sequences. (A) Multiple sequence alignment of BcCUC2 with other CUC proteins. (B) Conserved motif analysis of CUC proteins.
Figure 1. Alignment and conserved motif of plant CUC protein sequences. (A) Multiple sequence alignment of BcCUC2 with other CUC proteins. (B) Conserved motif analysis of CUC proteins.
Genes 14 01272 g001
Figure 2. Phylogenetic analysis of CUC genes. Phylogenetic relationships between BcCUC2 and other CUC proteins in different species. The unrooted phylogeny was constructed by the neighbor-joining (NJ) method using MEGA 7.0 software.
Figure 2. Phylogenetic analysis of CUC genes. Phylogenetic relationships between BcCUC2 and other CUC proteins in different species. The unrooted phylogeny was constructed by the neighbor-joining (NJ) method using MEGA 7.0 software.
Genes 14 01272 g002
Figure 3. The transcript levels of BcCUC2 in Pak-choi. (A,B) The leaf morphology of cultivars ‘001’ and ‘082’ at seedling stage. Scale bars: 5 cm. (C) The expression profile of BcCUC2 at seedling, rosette, flowering, and podding stages in cultivars ‘001’ and ‘082’. The data represent the means of three replicates. A t-test was used for statistical analysis: * p < 0.05; ** p < 0.01.
Figure 3. The transcript levels of BcCUC2 in Pak-choi. (A,B) The leaf morphology of cultivars ‘001’ and ‘082’ at seedling stage. Scale bars: 5 cm. (C) The expression profile of BcCUC2 at seedling, rosette, flowering, and podding stages in cultivars ‘001’ and ‘082’. The data represent the means of three replicates. A t-test was used for statistical analysis: * p < 0.05; ** p < 0.01.
Genes 14 01272 g003
Figure 4. Relative expression patterns of BcCUC2 gene under different hormone treatments. Six-leaf-stage Pak-choi plants (cultivar ‘001’) were subjected to IAA and GA3 treatments over a continuous time course (0, 1, 3, 6, 12, 24, 48 h). The transcript abundance of BcCUC2 at 0 h was used as a control. Statistical significance (ANOVA) is designated by * p < 0.05, ** p < 0.01.
Figure 4. Relative expression patterns of BcCUC2 gene under different hormone treatments. Six-leaf-stage Pak-choi plants (cultivar ‘001’) were subjected to IAA and GA3 treatments over a continuous time course (0, 1, 3, 6, 12, 24, 48 h). The transcript abundance of BcCUC2 at 0 h was used as a control. Statistical significance (ANOVA) is designated by * p < 0.05, ** p < 0.01.
Genes 14 01272 g004
Figure 5. Subcellular localization of BcCUC2 protein. (A) The fusion constructs of 35S:GFP and 35S:BcCUC2-GFP. (B) Localization of 35S:GFP and 35S:BcCUC2-GFP in tobacco epidermic cells. The red, green, and yellow in the panel represent the fluorescence of mcherry (nuclear marker), GFP, and merge, respectively. Scale bars = 50 μm.
Figure 5. Subcellular localization of BcCUC2 protein. (A) The fusion constructs of 35S:GFP and 35S:BcCUC2-GFP. (B) Localization of 35S:GFP and 35S:BcCUC2-GFP in tobacco epidermic cells. The red, green, and yellow in the panel represent the fluorescence of mcherry (nuclear marker), GFP, and merge, respectively. Scale bars = 50 μm.
Genes 14 01272 g005
Figure 6. Ectopic expression of BcCUC2 resulted in serrated leaves and many branches. (A) The construct of 35S:BcCUC2-GUS. (B) The relative expression level of BcCUC2 in transgenic plants. (C) The leaf morphological difference in WT and transgenic plants. Scale bars = 1 cm. (D) Transgenic plants have more stem branches at flowering stage compared with wild type. Scale bar = 5 cm.
Figure 6. Ectopic expression of BcCUC2 resulted in serrated leaves and many branches. (A) The construct of 35S:BcCUC2-GUS. (B) The relative expression level of BcCUC2 in transgenic plants. (C) The leaf morphological difference in WT and transgenic plants. Scale bars = 1 cm. (D) Transgenic plants have more stem branches at flowering stage compared with wild type. Scale bar = 5 cm.
Genes 14 01272 g006
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, W.; Wang, T.; Ma, Y.; Wang, N.; Wang, W.; Tang, J.; Zhang, C.; Hou, X.; Hou, H. Ectopic Expression of BcCUC2 Involved in Sculpting the Leaf Margin Serration in Arabidopsis thaliana. Genes 2023, 14, 1272. https://doi.org/10.3390/genes14061272

AMA Style

Li W, Wang T, Ma Y, Wang N, Wang W, Tang J, Zhang C, Hou X, Hou H. Ectopic Expression of BcCUC2 Involved in Sculpting the Leaf Margin Serration in Arabidopsis thaliana. Genes. 2023; 14(6):1272. https://doi.org/10.3390/genes14061272

Chicago/Turabian Style

Li, Wanqi, Tongtong Wang, Yu Ma, Nan Wang, Wenjing Wang, Jun Tang, Changwei Zhang, Xilin Hou, and Hualan Hou. 2023. "Ectopic Expression of BcCUC2 Involved in Sculpting the Leaf Margin Serration in Arabidopsis thaliana" Genes 14, no. 6: 1272. https://doi.org/10.3390/genes14061272

APA Style

Li, W., Wang, T., Ma, Y., Wang, N., Wang, W., Tang, J., Zhang, C., Hou, X., & Hou, H. (2023). Ectopic Expression of BcCUC2 Involved in Sculpting the Leaf Margin Serration in Arabidopsis thaliana. Genes, 14(6), 1272. https://doi.org/10.3390/genes14061272

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop