Next Article in Journal
FIG4-Related Parkinsonism and the Particularities of the I41T Mutation: A Review of the Literature
Previous Article in Journal
Recent Progress of Antisense Oligonucleotide Therapy for Superoxide-Dismutase-1-Mutated Amyotrophic Lateral Sclerosis: Focus on Tofersen
Previous Article in Special Issue
Agouti-Signaling Protein and Melanocortin-1-Receptor Mutations Associated with Coat Color Phenotypes in Fallow Deer (Dama dama)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 15
Issue 10
10.3390/genes15101343
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Polymorphic Loci of Adaptively Significant Genes Selection for Determining Nucleotide Polymorphism of Pinus sylvestris L. Populations in the Urals

by
Nikita Chertov
1,
Yana Sboeva
1,
Yulia Nechaeva
1,
Svetlana Boronnikova
1,*,
Andrei Zhulanov
1,
Victoria Pechenkina
1,2 and
Ruslan Kalendar
3,4,*
1
Faculty of Biology, Perm State University, Bukireva, 15, 614990 Perm, Russia
2
Perm Agricultural Research Institute—Branch of Perm Federal Research Center Ural Brunch Russian Academy of Sciences, 614532 Perm, Russia
3
National Laboratory Astana, Nazarbayev University, Astana 010000, Kazakhstan
4
Institute of Biotechnology HiLIFE, University of Helsinki, 00014 Helsinki, Finland
*
Authors to whom correspondence should be addressed.
Genes 2024, 15(10), 1343; https://doi.org/10.3390/genes15101343
Submission received: 28 September 2024 / Revised: 16 October 2024 / Accepted: 18 October 2024 / Published: 21 October 2024
(This article belongs to the Special Issue Wildlife Genetic Diversity and Genomics)
Browse Figures
Versions Notes

Abstract

:
Background: Scots Pine is one of the main forest-forming species in boreal forests; it has great economic and ecological significance. This study aimed to develop and test primers for detecting nucleotide polymorphisms in genes that are promising for detecting adaptive genetic variability in populations of Pinus sylvestris in the Urals and adjacent territories. Objectives: The objects of the study were 13 populations of Scots Pine located in the Perm Territory, Chelyabinsk Region, and the Republic of Bashkortostan. Results: Sixteen pairs of primers to loci of potentially adaptively significant genes were developed, from which three pairs of primers were selected to detect the nucleotide diversity of the studied populations. The indicator of total haplotype diversity determined in the three studied loci varied from 0.620 (Pinus-12 locus) to 0.737 (Pinus-11 locus) and, on average, amounted to 0.662. The nucleotide diversity indicators in P. sylvestris in the study region were, on average, low (π = 0.004, θW = 0.013). Their highest values were found at the Pinus-12 locus (π = 0.005; θW = 0.032), and the lowest were found at the Pinus-15 locus (π = 0.003; θW = 0.002). This indicates that Pinus-15 is the most conserved of the three studied loci. In the three studied P. sylvestris loci associated with adaptation to environmental factors, 97 polymorphic positions were identified. The 13 populations of P. sylvestris are characterized by an average level of genetic diversity (Hd = 0.662; π = 0.004; θ = 0.013). Conclusions: The polymorphic loci of adaptively significant genes of P. sylvestris can help identify the adaptive potential of pine forests in conditions of increasing ambient temperatures.

1. Introduction

High rates of climate change and an increase in the number and duration of droughts leading to large-scale forest fires cause significant damage to forests [1,2,3]. Understanding the genetic basis of population divergence and adaptation is important in population genetics and evolutionary biology. The interaction of evolutionary factors and population structure forms genetic variability and adaptation to changing conditions in woody plant species [4,5,6,7].
Scots Pine (P. sylvestris L.), the second most widespread coniferous tree species globally, is highly economically and ecologically important [8]. Forests dominated by the species cover 37% of the total forest area in the world and about 70% of the forest area in the Northern Hemisphere [8,9]. The current range of this species is the result of postglacial recolonization events and the subsequent reduction in pine forests [10,11,12,13]. P. sylvestris is a species tolerant of many ecological habitats [14,15]. Scots Pine has high genetic variability, which determines quantitative and qualitative traits, some of which have adaptive value [16,17].
SNPs (single=nucleotide polymorphisms) are most successfully used to characterize genetic diversity at the levels of species and populations. Seventy-eight new SNP marker associations and drought-related traits were found in Sequoia sempervirens, and six were found in Sequoiadenron giganteum [18]. In addition, exome-derived SNP associations have been identified in several conifer species, such as Pseudotsuga menziesii [19] and Pinus taeda [20]. They arise due to changes in the nucleotide sequence of DNA when one nucleotide is replaced by another in members of the same species [21,22,23]. Single-nucleotide polymorphisms have been studied in common pine throughout its entire range. At the same time, P. sylvestris populations in Russia west of the Ural Mountains differ from other Asian populations [24]. Therefore, to analyze the genetic diversity of P. sylvestris in this region, it is necessary to continue selecting polymorphic loci and identifying SNPs in them. In addition, the identification of promising SNPs is relevant for revealing their association with adaptation to drought in a variety of conditions [25,26,27,28].
Thus, the working hypothesis of this study was that the selected polymorphic loci and the SNPs identified in them would allow us to establish and analyze the nucleotide diversity of P. sylvestris in the study region and identify possible adaptations of common pine to drought associated with nucleotide polymorphisms in genes potentially associated with drought tolerance.
This study aimed to develop and test primers for identifying nucleotide polymorphisms in genes that are promising for identifying adaptive genetic variability in P. sylvestris using populations of this species in the Urals and adjacent territories as an example.

2. Materials and Methods

The objects of the study were 13 populations of P. sylvestris L.; 11 were located in the following forests of the Northern and Middle Urals (Perm Krai): Cherdynsky (PS_Ch), Gainsky (PS_Gn), Bereznikovsky (PS_Rm), Kudymkarsky (PS_Ln), Dobryansky (PS_Pl), Sivinsky (PS_Kr), Tchaikovsky (PS_Bl), Permsky (PS_Uk), Kishertsky (PS_Pr), and Oktyabrsky (PS_Sk) forestries. Two populations were located in the Republic of Bashkortostan in the Duvansky (PS_Mh) and Salavatsky (PS_Sl) forests, and one was in the Kaslinsky forest (PS_Ar) of the Chelyabinsk region (Figure 1, Table S1). The populations from the Salavatsky forest of the Republic of Bashkortostan (PS_Sl) and the Gainsky forest of the Perm region (PS_Gn) were at the maximum distance (628 km). The populations from the Kishertsky (PS_Pr) and Oktyabrsky (PS_Sk) forests of the Perm region were at the minimum distance (28 km).
For molecular genetic analysis, needles were collected separately from 28–31 trees in each population, located no closer than 100–150 m from each other. DNA was isolated using CTAB with further purification using a high-salt gel electroelution trap [29,30] or using an acidic CTAB solution [31].
To analyze nucleotide polymorphism, sixteen pairs of primers to loci of potentially adaptively significant genes were developed (Table 1). The largest databases of single-nucleotide polymorphisms (SNPs) specific to Scots Pine were used to design primers for adaptively significant loci of Scots Pine containing SNPs [32].
P. sylvestris does not have GO (gene ontology) identifiers in the SNP database [32]; in addition, the sequences in the database are only 71 nucleotides long; therefore, for all database entries, a search was performed for corresponding contigs in the pine transcriptome taken from the TreeGenes database https://treegenesdb.org/FTP/Transcriptome/TSA/Pisy/Pisy_TSA.fasta, accessed on 18 August 2024). For the identified contigs, automatic functional annotation was performed using InterProScan [33]. From the results (annotations for primer development), 34 contigs with GO identifiers corresponding to adaptively significant genes were selected.
The primers were developed and analyzed using the FastPCR software v.6.9 [34] with the following parameters: the amplified fragment containing SNP length was 400–600 nucleotides, the optimal primer length was 20 nucleotides, and the optimal annealing temperature was 60 °C. In silico PCR analysis for primer pairs for the P. sylvestris genome was performed using virtualPCR [35].
Pairs of primers that did not form dimers or nonspecific amplification products were selected. A search was performed in the P. sylvestris transcriptome used in the previous step to verify the uniqueness of the sequences amplified by these primers. Sequences for which more than one homologous fragment was found were excluded.
After their selection, the most specific primers for the Pinus-11, Pinus-12, and Pinus-15 loci were amplified from the P. sylvestris total DNA extraction (Table 2).
The purification of PCR products was performed with a mixture of ExoI and FAST-AP enzymes (Thermo Fisher Scientific Inc., Waltham, MA, USA) in a ratio of 0.5:1 at a rate of 1.5 μL of the enzyme mixture per 5 μL of PCR products. According to the program, the reaction was carried out in a GeneAmp PCR System 9700 amplifier (Applied Biosystems, Thermo Fisher Scientific Inc., Waltham, MA, USA): 37 °C—30 min, 80 °C—15 min, cooling to 4 °C.
The BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) was used for sequencing. The forward and reverse sequences from the pair with which the PCR was supplied were used as primers. Amplification was performed in a GeneAmp PCR System 9700 thermal cycler (Applied Biosystems, USA) according to the program: 5 min—94 °C, the next 30 cycles (94 °C—30 s, Ta–45 s, 72 °C—2 min), 72 °C—10 min. The sequencing reaction products were purified from unreacted labeled nucleotides using the BigDye® X Terminator TM Purification Kit (Applied Biosystems, USA).
The study used a method of automated enzymatic sequencing, which included two stages: (1) performing termination reactions (labeling nucleotides with fluorophores) and (2) separating the products of these reactions using capillary electrophoresis. Only the second stage was automated, i.e., separating the labeled DNA fragments, obtaining the fluorophore emission spectrum, and processing the collected data. Capillary electrophoresis of the synthesized sequences was performed in the PCR laboratory of the Department of Botany and Plant Genetics of Perm State National Research University (Russia) on a 24-capillary genetic analyzer, Genetic Analyzer 3500xL (Applied Biosystems, USA), in two directions. On average, three DNA loci nucleotide sequences were sequenced in eight trees from each population. The total length of the nucleotide sequences for 312 trees was 115,128 nucleotides.
Sequenced sequences were edited in the GeneScanv2 program (Applied Biosystems, USA), and the location of polymorphic positions was determined by multiple sequence alignment with the UGENE computer program [36]. Data on the sequenced loci sequences (in the FASTA sequence file format) were compared with those available in the NCBI genetic database using the BLAST 2.2.26+ automatic online alignment system. In the DNASP program [37], the haplotypes were reconstructed, and the following indices of nucleotide polymorphism were calculated on the basis of a comparison of their nucleotide sequences: the number of variable sites (S); the number of haplotypes in the population (hn); the total haplotype diversity (Hd) according to M. Nei [38]; the nucleotide diversity (π), which estimates the average number of pairwise differences between two DNA sequences and is a measure of the genetic variability of a species or population; and the nucleotide diversity parameter calculated on the basis of the number of mutations (θW) or the Watterson estimate [39]. The Watterson estimate is based on the coalescence theory and is calculated from the mutation rate per generation and the number of polymorphic sites [40]. To assess the compliance of the nature of nucleotide substitutions with the neutrality hypothesis, the Tajima D-test was performed for each locus in the studied populations. Its significance was assessed by 10,000 simulations, which allowed us to test the hypothesis of neutrality of the existing polymorphism [41]. Regression analysis was used to analyze the relationship between the level of genetic diversity and various climatic indicators. We obtained 19 basic climatic parameters for each sample from the WorldClim service’s bioclimatic variables database utilizing the raster v3.4–13 package.

3. Results and Discussion

We tested 16 primer pairs to loci promising for detecting the genetic diversity of P. sylvestris at the population level. As a result of test amplification, nine pairs of primers for the loci Pinus-1, Pinus-2, Pinus-5, Pinus-6, Pinus-7, Pinus-10, Pinus-11, Pinus-12, and Pinus-15 showed positive amplification and DNA fragments of the required size (Figure S1). The remaining loci were not amplified or did not reveal amplicons of the required size and, for this reason, were excluded from further study. The main reason for the absence or non-specific amplification may be the incomplete affinity of the primers with the DNA of the studied species. In addition, the synthesis of non-specific fragments can be provoked by excessive or insufficient primer concentration, non-optimal annealing temperature, the concentration of magnesium ions, or the amount of DNA matrix [42]. In this regard, PCR conditions were optimized to obtain high-quality target amplicons. For this purpose, the proportions and concentrations of these components in the PCR mixture and the annealing temperature in several repeated PCRs for each tested locus were varied. As a result, the quality of the PCR products of the studied loci became significantly higher.
For common pine, primers Pinus-11, Pinus-12, and Pinus-15 showed successful amplification in PCR of a single fragment and had similar activity according to gene ontology (GO): GO:0009408, response to heat (Table 3). According to GO, heat shock proteins, Annexins, α(B)-crystallins, transcription factors associated with heat stress, and others have this activity.
The search for homologs to the selected loci in the NCBI and UniPlot databases using the BLAST tool revealed that the Pinus-11 locus is homologous to the small heat shock protein gene (A0AA38G6F5) in the UniPlot database. No homologs were found for this locus in the NCBI database. The Pinus-12 locus is homologous to the small heat shock protein gene, the α-crystallin domain of the α-crystallin-type small heat shock proteins in the NCBI database (ABK22047). The Pinus-15 locus is homologous to the P. taeda L. transcription factor (the MYB (myeloblastosis) transcription factor) in the NCBI database (AC241314).
The sequenced nucleotide sequences were aligned with each other, and 97 polymorphic positions were found in the sequences of three loci. According to the results of multiple alignments, Pinus-15 is the most conserved; three polymorphic positions were found in its sequence. The largest number of polymorphic sites was identified in Pinus-12–84 substitutions. The largest numbers of haplotypes (hn) and polymorphic sites (S) in Pinus-11 were found in the PS_Ar and PS_Bl populations in Pinus12–in PS_Rm, and Pinus-15 revealed the largest number of haplotypes and variable sites in the PS_Ln population (Table 4).
The overall haplotype diversity (Hd), a measure of the uniqueness of a particular haplotype in a population, for the three loci studied varied from 0.620 (Pinus-12 locus) to 0.737 (Pinus-11 locus), and the indicator was 0.662 on average (Figure 2).
The nucleotide diversity index (π), defined as the average number of pairwise nucleotide differences per site between two DNA sequences, is higher at the Pinus-12 locus (π= 0.005) and lower at Pinus-15 (π = 0.003), and the average for the three P. sylvestris loci was 0.004 (Table 5).
Watterson’s estimator of nucleotide diversity calculated from the number of mutations (θW) also revealed the highest values at the Pinus-12 locus (θW = 0.032) and the lowest at the Pinus-15 locus (θW = 0.002). Pinus-15 is the most conserved of the studied loci (Table 5).
To test the hypothesis of neutrality of the existing polymorphism, the Tajima D-test (DT) was used. There are three possible interpretations of the test results: (1) DT = 0, with π = θW, means that the observed values of nucleotide diversity are equal to the expected ones, the population is developing at genetic equilibrium, and there is no expected influence of selection; (2) DT < 0 with π < θW indicates an excess of low-frequency polymorphisms, which may be caused by negative selection or an increase in the population size after its recent reduction—the “bottleneck” effect—and perhaps the adaptability of the gene; (3) DT > 0 with π > θW indicates an excess of intermediate-frequency polymorphisms, which may be a result of stabilizing selection or a recent sharp decrease in the population size [41].
It was revealed that for the Pinus-11 and Pinus-12 loci, the Watterson estimator values (θW) exceeded the nucleotide diversity indices π, which indicated an excess of low-frequency alleles and was consistent with the negative values of the Tajima D-test. The closest-to-zero DT value (−0.890) was found at the Pinus-11 locus, so it can be assumed that the polymorphism of this locus is selectively neutral. The greatest deviation from the neutral value (DT = −2.615) was found at the Pinus-12 locus. It exhibits a positive deviation of the Tajima D-test values (0.925), which indicates an excess of polymorphisms with an intermediate frequency (Table 6).
In general, according to the nucleotide diversity data (Table 6), the most genetically heterogeneous populations are PS_Ar (Hd = 0.697; π = 0.003; θW = 0.003), PS_Bl (Hd = 0.692; π = 0.003; θW = 0.003), and PS_Rm (Hd = 0.675; π = 0.003; θW = 0.03), and the least genetically heterogeneous populations are PS_Gn (Hd = 0.472; π = 0.005; θW = 0.005) and PS_Pr (Hd = 0.478; π = 0.004; θW = 0.004).
According to the regression analysis, there is no direct connection between the level of genetic diversity and various climatic indicators, such as average and maximum temperature and precipitation. However, there is a connection with anthropogenic load. Thus, in the Gainsky forest (PS_Gn), the most intensive conifer cutting is carried out, and in the Kasli forest (PS_Ar), on the contrary, the intensity of coniferous harvesting is the lowest.
Thus, the nucleotide polymorphism indices of three loci in P. sylvestris, common in the Urals and potentially adaptive to environmental factors, were studied, and in those loci, 97 polymorphic positions were identified. The studied populations are characterized by an average level of genetic diversity (Hd = 0.662; π = 0.004; θW = 0.013). A similar level of genetic diversity was found in pine populations in Poland, studied using 32 loci and mitochondrial markers [43,44]. A higher level of haplotype diversity was found in P. sylvestris populations from Scotland using 12 loci [45].

4. Conclusions

After analyzing genetic databases, 16 primer pairs to loci of adaptively significant genes of P. sylvestris were designed and tested in this study, from which three loci, Pinus-11, Pinus-12, and Pinus-15, were selected. Of the loci studied, the Pinus-12 locus was the most polymorphic. It also showed the greatest deviation from neutrality (DT = −2.615). The Pinus-15 locus was the most conserved among the studied loci. It is part of the MYB transcription factor, which is widely involved in plant response to drought. A total of 97 SNPs were detected in the three selected loci.
The selected loci allowed a preliminary analysis of the nucleotide diversity of 13 populations of P. sylvestris located in the Urals and adjacent territories based on SNP polymorphism.
The average level of genetic diversity of P. sylvestris populations in the study region was revealed (Hd = 0.662; π = 0.004; θW = 0.013). The populations from Kaslinskoye (Hd = 0.697; π = 0.003; θW = 0.003), Tchaikovskoye (Hd = 0.692; π = 0.003; θW = 0.003), and Bereznikovskoye forests (Hd = 0.675; π = 0.003; θW = 0.03) showed moderate diversity, and low diversity was observed in the Gainskoye (Hd = 0.472; π = 0.005; θW = 0.005) and Kishertskoye forests (Hd = 0.478; π = 0.004; θW = 0.004) populations.
The studied loci also have a high potential for studying the relationship between polymorphism and the manifestation of adaptability, particularly drought resistance. Since the Pinus-12 locus has the greatest deviation from neutrality, it is the most promising for further study of drought resistance in P. sylvestris. The Pinus-15 locus is part of the MYB transcription factor, which is widely involved in the plant response to drought [46]. In addition, this transcription factor is involved in regulating the expression of the synthesis of biologically active substances, particularly flavonoids [47]. Studying the polymorphism of this locus in combination with loci associated with drought resistance will contribute to the selection of more productive and tolerant trees of Scots Pine. In connection with climate change, research in this area is very promising and can contribute to increasing the adaptive potential of pine forests in conditions of increasing ambient temperatures.
Different genera of the Pinaceae family, including the genus Pinus, have an example of SNP associations with drought tolerance [18,19,20]. Further research on polymorphisms associated with drought tolerance will aim to find combinations of SNP markers characteristic of individual regions of the common pine range.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes15101343/s1, Table S1. Studied populations of P. sylvestris. Figure S1. Electropherogram of amplification products of 16 primer pairs of Scots Pine. Size marker (M): DNA marker Step100 (Biolabmix, Russia), marked on the left in bp (100 bp to 1000 bp).

Author Contributions

Conceptualization, S.B.; Methodology, A.Z. and R.K.; Software, N.C. and R.K.; Validation, Y.S., Y.N., A.Z. and V.P.; Formal analysis, Y.S., S.B., A.Z., V.P. and R.K.; Investigation, N.C., Y.S. and Y.N.; Resources, N.C., Y.S., Y.N., A.Z. and V.P.; Data curation, N.C., Y.S., Y.N. and A.Z.; Writing—original draft, N.C., Y.S., S.B., V.P. and R.K.; Writing—review and editing, S.B. Supervision, S.B. and R.K.; Project administration, S.B.; Funding acquisition, S.B. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded within the framework of state assignment No. FSNF-2023-0004 of the Federal State Autonomous Educational Institution for Higher Education “Perm State National Research University” in science and by the Government of Perm Krai, research project No. C-26/776, dated 31 March 2022. Open access funding provided by University of Helsinki.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Allen, C.D.; Macalady, A.K.; Chenchouni, H.; Bachelet, D.; McDowell, N.; Vennetier, M.; Kitzberger, T.; Rigling, A.; Breshears, D.D.; Hogg, E.H.; et al. A global overview of drought and heat-induced tree mortality reveals emerging climate change risks for forests. For. Ecol. Manag. 2010, 259, 660–684. [Google Scholar] [CrossRef]
  2. Gauthier, S.; Bernier, P.; Kuuluvainen, T.; Shvidenko, A.Z.; Schepaschenko, D.G. Boreal forest health and global change. Science 2015, 349, 819–822. [Google Scholar] [CrossRef] [PubMed]
  3. Kuznetsova, N.F.; Klushevskaya, E.S.; Amineva, E.Y. Highly productive pine forests in a changing climate. Lesn. Zh 2021, 6, 9–23. [Google Scholar] [CrossRef]
  4. Eriksson, G. Evolutionary forces influencing variation among populations of Pinus sylvestris. Silva Fenn. 1998, 32, 694. [Google Scholar] [CrossRef]
  5. Namkoong, G. Forest genetics: Pattern and complexity. Can. J. For. Res. 2001, 31, 623–632. [Google Scholar] [CrossRef]
  6. Gonzalez-Martinez, S.C.; Krutovsky, K.V.; Neale, D.B. Forest-tree population genomics and adaptive evolution. New Phytol. 2006, 170, 227–238. [Google Scholar] [CrossRef]
  7. Sheller, M.; Tóth, E.G.; Ciocîrlan, E.; Mikhaylov, P.; Kulakov, S.; Kulakova, N.; Melnichenko, N.; Ibe, A.; Sukhikh, T.; Curtu, A.L. Genetic diversity and population structure of scots pine (Pinus sylvestris L.) in middle siberia. Forests 2023, 14, 66–71. [Google Scholar] [CrossRef]
  8. Floran, V.; Sestras, R.E.; GarcÍA Gil, M.R. Organelle genetic diversity and phylogeography of scots pine (Pinus sylvestris L.). Not. Bot. Horti Agrobot. Cluj-Napoca 2011, 39, 317–322. [Google Scholar] [CrossRef]
  9. Mirov, N. The Genus Pinus; The Ronald Press Company: New York, NY, USA, 1967; Available online: https://biblio.ie/book/genus-pinus-n-mirov/d/1191675207. (accessed on 18 August 2024).
  10. Hebda, A.; Wójkiewicz, B.; Wachowiak, W. Genetic characteristics of scots pine in poland and reference populations based on nuclear and chloroplast microsatellite markers. Silva Fenn. 2017, 51, 1721. [Google Scholar] [CrossRef]
  11. Tóth, E.G.; Vendramin, G.G.; Bagnoli, F.; Cseke, K.; Höhn, M. High genetic diversity and distinct origin of recently fragmented scots pine (Pinus sylvestris L.) populations along the carpathians and the pannonian basin. Tree Genet. Genomes 2017, 13, 47. [Google Scholar] [CrossRef]
  12. Tyrmi, J.S.; Vuosku, J.; Acosta, J.J.; Li, Z.; Sterck, L.; Cervera, M.T.; Savolainen, O.; Pyhajarvi, T. Genomics of clinal local adaptation in Pinus sylvestris under continuous environmental and spatial genetic setting. G3 2020, 10, 2683–2696. [Google Scholar] [CrossRef] [PubMed]
  13. Shvarts, E.A.; Karpachevskiy, M.L.; Shmatkov, N.M.; Baybar, A.S. Reforming forest policies and management in russia: Problems and challenges. Forests 2023, 14, 100–143. [Google Scholar] [CrossRef]
  14. Hogberg, P.; Nordgren, A.; Buchmann, N.; Taylor, A.F.; Ekblad, A.; Hogberg, M.N.; Nyberg, G.; Ottosson-Lofvenius, M.; Read, D.J. Large-scale forest girdling shows that current photosynthesis drives soil respiration. Nature 2001, 411, 789–792. [Google Scholar] [CrossRef] [PubMed]
  15. Lindén, A.; Heinonsalo, J.; Buchmann, N.; Oinonen, M.; Sonninen, E.; Hilasvuori, E.; Pumpanen, J. Contrasting effects of increased carbon input on boreal som decomposition with and without presence of living root system of Pinus sylvestris L. Plant Soil 2013, 377, 145–158. [Google Scholar] [CrossRef]
  16. Kavaliauskas, D.; Danusevičius, D.; Baliuckas, V. New insight into genetic structure and diversity of scots pine (Pinus sylvestris L.) populations in lithuania based on nuclear, chloroplast and mitochondrial DNA markers. Forests 2022, 13, 1179. [Google Scholar] [CrossRef]
  17. Chertov, N. Analysis of genetic diversity, structure and differentiation of Pinus sylvestris L. Populations inf the urals. Bull. Perm Univ. Biol. 2024, 2, 221–230. [Google Scholar] [CrossRef]
  18. De La Torre, A.R.; Sekhwal, M.K.; Puiu, D.; Salzberg, S.L.; Scott, A.D.; Allen, B.; Neale, D.B.; Chin, A.R.O.; Buckley, T.N. Genome-wide association identifies candidate genes for drought tolerance in coast redwood and giant sequoia. Plant J. 2022, 109, 7–22. [Google Scholar] [CrossRef]
  19. George, J.P.; Schueler, S.; Grabner, M.; Karanitsch-Ackerl, S.; Mayer, K.; Stierschneider, M.; Weissenbacher, L.; van Loo, M. Looking for the needle in a downsized haystack: Whole-exome sequencing unravels genomic signals of climatic adaptation in douglas-fir (Pseudotsuga menziesii). Ecol. Evol. 2021, 11, 8238–8253. [Google Scholar] [CrossRef]
  20. Lu, M.; Seeve, C.M.; Loopstra, C.A.; Krutovsky, K.V. Exploring the genetic basis of gene transcript abundance and metabolite levels in loblolly pine (Pinus taeda L.) using association mapping and network construction. BMC Genet. 2018, 19, 100. [Google Scholar] [CrossRef]
  21. Arif, I.A.; Bakir, M.A.; Khan, H.A.; Al Farhan, A.H.; Al Homaidan, A.A.; Bahkali, A.H.; Sadoon, M.A.; Shobrak, M. A brief review of molecular techniques to assess plant diversity. Int. J. Mol. Sci. 2010, 11, 2079–2096. [Google Scholar] [CrossRef]
  22. Dorogina, O.V.; Zhmud, E.V. Molecular-genetic methods in plant ecology. Contemp. Probl. Ecol. 2020, 13, 333–345. [Google Scholar] [CrossRef]
  23. Wachowiak, W.; Perry, A.; Zaborowska, J.; González-Martínez, S.C.; Cavers, S. Admixture and selection patterns across the european distribution of scots pine, Pinus sylvestris (pinaceae). Bot. J. Linn. Soc. 2022, 200, 416–432. [Google Scholar] [CrossRef]
  24. Bruxaux, J.; Zhao, W.; Hall, D.; Curtu, A.L.; Androsiuk, P.; Drouzas, A.D.; Gailing, O.; Konrad, H.; Sullivan, A.R.; Semerikov, V.; et al. Scots pine—panmixia and the elusive signal of genetic adaptation. New Phytol. 2024, 243, 1231–1246. [Google Scholar] [CrossRef] [PubMed]
  25. Baldi, P.; La Porta, N. Toward the genetic improvement of drought tolerance in conifers: An integrated approach. Forests 2022, 13, 2016. [Google Scholar] [CrossRef]
  26. Amineva, E.Y.; Gureev, A.P.; Tabatskaya, T.M.; Mashkina, O.S.; Popov, V.N. Genotypic variability of Pinus sylvestris L. On the drought-resistance attribute. Vavilov J. Genet. Breed. 2019, 23, 15–23. [Google Scholar] [CrossRef]
  27. Zhou, C.; Bo, W.; El-Kassaby, Y.A.; Li, W. Transcriptome profiles reveal response mechanisms and key role of psnac1 in Pinus sylvestris var. Mongolica to drought stress. BMC Plant Biol. 2024, 24, 343. [Google Scholar] [CrossRef]
  28. Moran, E.; Lauder, J.; Musser, C.; Stathos, A.; Shu, M. The genetics of drought tolerance in conifers. New Phytol. 2017, 216, 1034–1048. [Google Scholar] [CrossRef]
  29. Kalendar, R.; Ivanov, K.I.; Samuilova, O.; Kairov, U.; Zamyatnin, A.A., Jr. Isolation of high-molecular-weight DNA for long-read sequencing using a high-salt gel electroelution trap. Anal. Chem. 2023, 95, 17818–17825. [Google Scholar] [CrossRef]
  30. Kalendar, R.; Ivanov, K.I.; Akhmetollayev, I.; Kairov, U.; Samuilova, O.; Burster, T.; Zamyatnin, A.A., Jr. An improved method and device for nucleic acid isolation using a high-salt gel electroelution trap. Anal. Chem. 2024, 96, 15526–15530. [Google Scholar] [CrossRef]
  31. Kalendar, R.; Boronnikova, S.; Seppanen, M. Isolation and purification of DNA from complicated biological samples. Methods Mol. Biol. 2021, 2222, 57–67. [Google Scholar] [CrossRef]
  32. Kastally, C.; Niskanen, A.K.; Perry, A.; Kujala, S.T.; Avia, K.; Cervantes, S.; Haapanen, M.; Kesalahti, R.; Kumpula, T.A.; Mattila, T.M.; et al. Taming the massive genome of scots pine with pisy50k, a new genotyping array for conifer research. Plant J. 2022, 109, 1337–1350. [Google Scholar] [CrossRef] [PubMed]
  33. Jones, P.; Binns, D.; Chang, H.Y.; Fraser, M.; Li, W.; McAnulla, C.; McWilliam, H.; Maslen, J.; Mitchell, A.; Nuka, G.; et al. Interproscan 5: Genome-scale protein function classification. Bioinformatics 2014, 30, 1236–1240. [Google Scholar] [CrossRef] [PubMed]
  34. Kalendar, R.; Khassenov, B.; Ramankulov, Y.; Samuilova, O.; Ivanov, K.I. Fastpcr: An in silico tool for fast primer and probe design and advanced sequence analysis. Genomics 2017, 109, 312–319. [Google Scholar] [CrossRef] [PubMed]
  35. Kalendar, R.; Shevtsov, A.; Otarbay, Z.; Ismailova, A. In silico pcr analysis: A comprehensive bioinformatics tool for enhancing nucleic acid amplification assays. Front. Bioinform. 2024, 4, 1464197. [Google Scholar] [CrossRef]
  36. Rose, R.; Golosova, O.; Sukhomlinov, D.; Tiunov, A.; Prosperi, M. Flexible design of multiple metagenomics classification pipelines with ugene. Bioinformatics 2019, 35, 1963–1965. [Google Scholar] [CrossRef]
  37. Librado, P.; Rozas, J. Dnasp v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef]
  38. Nei, M. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA 1973, 70, 3321–3323. [Google Scholar] [CrossRef]
  39. Nei, M. Molecular Evolutionary Genetics; Columbia University Press: Chichester, NY, USA, 1987; Volume 1, p. 514. [Google Scholar] [CrossRef]
  40. Watterson, G.A. On the number of segregating sites in genetical models without recombination. Theor. Popul. Biol. 1975, 7, 256–276. [Google Scholar] [CrossRef]
  41. Tajima, F. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 1989, 123, 585–595. [Google Scholar] [CrossRef]
  42. Prishnivskaya, Y.; Nassonova, E.; Vasileva, Y.; Boronnikova, S. Selecting of polymorphic loci of genome for identification of populations of Pinus sylvestris L. On east europe plain. Bull. Sci. Pract. 2019, 5, 25–30. [Google Scholar] [CrossRef]
  43. Wachowiak, W.; Szczepański, S.; Lasek, M.; Maciejewski, Z.; Łabiszak, B. Genetic perspective on forest management of scots pine (Pinus sylvestris L.) in protected areas. For. Ecol. Manag. 2024, 568, 122127. [Google Scholar] [CrossRef]
  44. Wachowiak, W.; Wόjkiewicz, B.; Cavers, S.; Lewandowski, A. High genetic similarity between polish and north european scots pine (Pinus sylvestris L.) populations at nuclear gene loci. Tree Genet. Genomes 2014, 10, 1015–1025. [Google Scholar] [CrossRef]
  45. Wachowiak, W.; Iason, G.R.; Cavers, S. Among population differentiation at nuclear genes in native scots pine (Pinus sylvestris L.) in scotland. Flora-Morphol. Distrib. Funct. Ecol. Plants 2013, 208, 79–86. [Google Scholar] [CrossRef]
  46. Lou, X.; Yao, S.; Chen, P.; Wang, D.; Agassin, R.H.; Hou, Y.; Zhang, C.; Ji, K. Transcriptome identification of r2r3-myb gene family members in pinus massoniana and pmmyb4 response to drought stress. Forests 2023, 14, 410. [Google Scholar] [CrossRef]
  47. Zhao, Q.; Xiong, H.; Yu, H.; Wang, C.; Zhang, S.; Hao, J.; Wang, J.; Zhang, H.; Zhang, L. Function of myb8 in larch under peg simulated drought stress. Sci. Rep. 2024, 14, 11290. [Google Scholar] [CrossRef]
Genes 15 01343 g001
Figure 1. Location diagram of the studied P. sylvestris populations. P. sylvestris populations in the forests of Perm Krai: PS_Ch—Cherdynskoye, PS_Gn—Gaynskoye, PS_Rm—Bereznikovskoye, PS_Ln—Kudymkarskoye, PS_Pr—Kishertskoye, PS_Pl—Dobryanskoye, PS_Kr—Sivinskoye, PS_Bl—Tchaikovskoye, PS_Sk—Oktyabrskoye, PS_Uk—Permskoye; from the Republic of Bashkortostan: PS_Mh—Duvanskoye, PS_Sl—Salavatskoye; from the Chelyabinsk Region: PS_Ar—Kaslinskoye forest.
Figure 1. Location diagram of the studied P. sylvestris populations. P. sylvestris populations in the forests of Perm Krai: PS_Ch—Cherdynskoye, PS_Gn—Gaynskoye, PS_Rm—Bereznikovskoye, PS_Ln—Kudymkarskoye, PS_Pr—Kishertskoye, PS_Pl—Dobryanskoye, PS_Kr—Sivinskoye, PS_Bl—Tchaikovskoye, PS_Sk—Oktyabrskoye, PS_Uk—Permskoye; from the Republic of Bashkortostan: PS_Mh—Duvanskoye, PS_Sl—Salavatskoye; from the Chelyabinsk Region: PS_Ar—Kaslinskoye forest.
Genes 15 01343 g001
Genes 15 01343 g002
Figure 2. Nucleotide substitutions identified during alignment of sequenced sequences of P. sylvestris: (A)—in the Pinus-11 locus; (B)—in the Pinus-12 locus; (C)—in the Pinus-15 locus.
Figure 2. Nucleotide substitutions identified during alignment of sequenced sequences of P. sylvestris: (A)—in the Pinus-11 locus; (B)—in the Pinus-12 locus; (C)—in the Pinus-15 locus.
Genes 15 01343 g002
Table 1. Characteristics of the studied loci of P. sylvestris.
Table 1. Characteristics of the studied loci of P. sylvestris.
LocusPrimer Sequences
(Forward/Reverse)		Gene Ontology IdentificatoryExpected Product Size, bp
Pinus-1AGTTCAAGGGTGGGTTGCAA/
GGTATGTGGTAGGATGGCCG		GO:0009788 negative regulation of abscisic acid-activated signaling pathway601
Pinus-2TTTGGGTGGCTGTCTGTGTT/
TCTGGTGCCAAAAACCCCAT		GO:0009788 negative regulation of abscisic acid-activated signaling pathway587
Pinus-3GCTGGAGCTGTTTGACACAA/
CACCGCACAAACAGTTCCAG		GO:0009415 response to water592
Pinus-4GTCACTCAGCAAGCGCAAAA/
CTTGCCACAGTCTTTGCCAC		GO:0071277 cellular response to calcium ion590
Pinus-5GGCAAAGGACAAGACCCAGA/
GATCCGTCGGCTCACATTCA		GO:0009415 response to water565
Pinus-6GTTCTGCTGCACTCTGGTCT/
GGAGCAGGTGCCTGAAGAAT		GO:0006952 defense response587
Pinus-7CCAGTCCGCGAATCCGATAA/
AACTCCGGCGTAAAGACTCC		GO:0009788 negative regulation of abscisic acid-activated signaling pathway573
Pinus-8TCTGTCGAAATGTGCACCGA/
TCATTGGCCTTCACTGACCC		GO:0009269 response to desiccation518
Pinus-9TCTATGAGCGATTCGGTGGC/
CAAAACCCGGGCTGAAACTG		GO:0009269 response to desiccation533
Pinus-10CCGCGGATAGTTATGCCCAT/
CATGCTCGATACCTGGCAGT		GO:0009788 negative regulation of abscisic acid-activated signaling pathway579
Pinus-11ATTCGACTTGCCCGGACTTT/
GAACGACAGTCTCAGGCCAA		GO:0009408 response to heat504
Pinus-12TCGCGAGTGAAGCTTCTGTT/
TTCCGGTGCATTGCTCTCTT		GO:0009408 response to heat597
Pinus-13TCGAGCGATGAAGAGGAGGA/
AATCACAACCCCACAACACG		GO:0009408 response to heat502
Pinus-14CCCTATCCTGGTTGCCGTTT/
AGCTCGCATTTACCTGTGCT		GO:0009788 negative regulation of abscisic acid-activated signaling pathway575
Pinus-15AGGCATTTGTGGTTTGGTGC/
CCTCCTTTTCTGGGCTCGTT		GO:0009408 response to heat503
Pinus-16TCGCACACAGAGAAGAGAGG/
TGGCAAATCATAACGCGCAG		GO:0009408 response to heat574
Table 2. Primers and PCR conditions for amplification of P. sylvestris three loci.
Table 2. Primers and PCR conditions for amplification of P. sylvestris three loci.
LocusPrimer Sequences
(Forward/Reverse)		PCR Conditions
Pinus-11ATTCGACTTGCCCGGACTTT/
GAACGACAGTCTCAGGCCAA		Denaturation: 94 °C—5 min; 30 cycles: 94 °C—30 s, 60 °C—45 s, 72 °C—2 min, final elongation: 72 °C—10 min
Pinus-12TCGCGAGTGAAGCTTCTGTT/
TTCCGGTGCATTGCTCTCTT		Denaturation: 94 °C—5 min; 30 cycles: 94 °C—30 s, 57 °C—45 s, 72 °C—2 min, final elongation: 72 °C—10 min
Pinus-15AGGCATTTGTGGTTTGGTGC/
CCTCCTTTTCTGGGCTCGTT		Denaturation: 94 °C—5 min; 30 cycles: 94 °C—1 min, 55,7 °C—30 s, 72 °C—2 min, final elongation 72 °C—10 min
Table 3. Genes loci of P. sylvestris selected for nucleotide polymorphism study.
Table 3. Genes loci of P. sylvestris selected for nucleotide polymorphism study.
LocusProductGene Ontology (GO)
Pinus-11Small heat shock proteinGO:0009408 response to heat
Pinus-12α-Crystallin domain of small heat shock proteinGO:0009408 response to heat
Pinus-15MYB transcription factorGO:0009408 response to heat
Table 4. The number of haplotypes and polymorphic sites revealed in the sequences of three P. sylvestris loci.
Table 4. The number of haplotypes and polymorphic sites revealed in the sequences of three P. sylvestris loci.
Locus/Population *GnChRmArBlKrMhPrSlPlUkLnSkTotal
Pinus-11hn444665634443419
S433665423332410
Pinus-12hn279468724776445
S1936361810159168584
Pinus-15hn43232023333526
S22121012222313
* hn—haplotype number; S—polymorphic site number per locus; maximal values of studied indices are highlighted in bold: Gn—the Gainskoe forest, Ch—Cherdynskoye, Rm—Bereznikovskoye, Bl—Tchaikovskoye, Kr—Sivinskoye, Pr—Kishertskoye, Pl—Dobryanskoye, Uk—Permskoye, Ln—Kudymkarskoye, Sk—Oktyabrskoye forestries of the Perm region; Ar—Kaslinskoye forest of the Chelyabinsk region; Mh—Duvanskoye, Sl—Salavatskoye forests of the Republic of Bashkortostan.
Table 5. Total haplotype and nucleotide diversity and neutrality test statistics for the three loci of P. sylvestris.
Table 5. Total haplotype and nucleotide diversity and neutrality test statistics for the three loci of P. sylvestris.
Locus *HdπθWDT
Pinus-110.737 (0.028)0.004 (0.000)0.006−0.890
Pinus-120.630 (0.040)0.005 (0.001)0.032−2.615
Pinus-150.620 (0.025)0.003 (0.000)0.0020.925
Mean0.662 (0.010)0.004 (0.002)0.013-
* Hd—total haplotype diversity; π—nucleotide diversity; θW—Watterson estimator of nucleotide diversity from the number of mutations; DT—Tajima D-test coefficient; standard deviations in brackets.
Table 6. Total haplotype and nucleotide diversity of P. sylvestris populations.
Table 6. Total haplotype and nucleotide diversity of P. sylvestris populations.
Indicators *PS_ChPS_RmPS_KrPS_PlPS_PrPS_SkPS_Sl
Hd0.6610.6750.5330.6530.4780.5890.592
π0.0040.0030.0070.0040.0040.0020.002
θW0.0030.0030.0090.0060.0040.0010.002
Indicators *PS_UkPS_GnPS_LnPR_ArPS_BlPS_MhTotal
Hd0.6590.4720.6140.6970.6920.6500.662
π0.0030.0050.0020.0030.0030.0030.004
θW0.0030.0050.0020.0030.0030.0040.013
* Hd—total haplotype diversity; π—nucleotide diversity; θW—Watterson estimator of nucleotide diversity from the number of mutations.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chertov, N.; Sboeva, Y.; Nechaeva, Y.; Boronnikova, S.; Zhulanov, A.; Pechenkina, V.; Kalendar, R. Polymorphic Loci of Adaptively Significant Genes Selection for Determining Nucleotide Polymorphism of Pinus sylvestris L. Populations in the Urals. Genes 2024, 15, 1343. https://doi.org/10.3390/genes15101343

AMA Style

Chertov N, Sboeva Y, Nechaeva Y, Boronnikova S, Zhulanov A, Pechenkina V, Kalendar R. Polymorphic Loci of Adaptively Significant Genes Selection for Determining Nucleotide Polymorphism of Pinus sylvestris L. Populations in the Urals. Genes. 2024; 15(10):1343. https://doi.org/10.3390/genes15101343

Chicago/Turabian Style

Chertov, Nikita, Yana Sboeva, Yulia Nechaeva, Svetlana Boronnikova, Andrei Zhulanov, Victoria Pechenkina, and Ruslan Kalendar. 2024. "Polymorphic Loci of Adaptively Significant Genes Selection for Determining Nucleotide Polymorphism of Pinus sylvestris L. Populations in the Urals" Genes 15, no. 10: 1343. https://doi.org/10.3390/genes15101343

APA Style

Chertov, N., Sboeva, Y., Nechaeva, Y., Boronnikova, S., Zhulanov, A., Pechenkina, V., & Kalendar, R. (2024). Polymorphic Loci of Adaptively Significant Genes Selection for Determining Nucleotide Polymorphism of Pinus sylvestris L. Populations in the Urals. Genes, 15(10), 1343. https://doi.org/10.3390/genes15101343

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop