Next Article in Journal
Observation of Genetic Gain with Instrumental Insemination of Honeybee Queens
Previous Article in Journal
Temperature-Dependent Development of Nitidula rufipes (Linnaeus, 1767) (Coleoptera: Nitidulidae) and Its Significance in Estimating Minimum Postmortem Interval
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 14
Issue 3
10.3390/insects14030300
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

An Acyl Carrier Protein Gene Affects Fatty Acid Synthesis and Growth of Hermetia illucens

by
Xiaoyan Peng
†,
Jiawen Liu
†,
Baoling Li
,
Shengyin Wang
,
Bosheng Chen
and
Dayu Zhang
*
The Key Laboratory for Quality Improvement of Agricultural Products of Zhejiang Province, College of Advanced Agriculture, Zhejiang A&F University, Hangzhou 311300, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Insects 2023, 14(3), 300; https://doi.org/10.3390/insects14030300
Submission received: 2 January 2023 / Revised: 10 March 2023 / Accepted: 16 March 2023 / Published: 21 March 2023
(This article belongs to the Section Insect Physiology, Reproduction and Development)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Fatty acids play essential roles in insect growth and development. The key fatty acid synthesis reaction is catalyzed by fatty acid synthase (FAS). As a cofactor of fatty acid synthesis, however, little is known about the functions of acyl carrier protein (ACP) in insects and how it modulates the composition of fatty acids. We isolated an ACP from the black soldier fly Hermetia illucens (Diptera: Stratiomyidae) and investigated the expression patterns as well as functions in fatty acid synthesis and growth of insects. HiACP has a classical conserved region of DSLD. Based on the RNAi approach, we found that HiACP could regulate the fatty acid synthesis, in particular, reducing the composition of saturated fatty acids. Meanwhile, HiACP could also affect the growth and mortality of H. illucens.

Abstract

Acyl carrier protein (ACP) is an acyl carrier in fatty acid synthesis and is an important cofactor of fatty acid synthetase. Little is known about ACP in insects and how this protein may modulate the composition and storage of fatty acids. We used an RNAi-assisted strategy to study the potential function of ACP in Hermetia illucens (Diptera: Stratiomyidae). We identified a HiACP gene with a cDNA length of 501 bp and a classical conserved region of DSLD. This gene was highly expressed in the egg and late larval instars and was most abundant in the midgut and fat bodies of larvae. Injection of dsACP significantly inhibited the expression level of HiACP and further regulated the fatty acid synthesis in treated H. illucens larvae. The composition of saturated fatty acids was reduced, and the percentage of unsaturated fatty acids (UFAs) was increased. After interfering with HiACP, the cumulative mortality of H. illucens increased to 68.00% (p < 0.05). H. illucens growth was greatly influenced. The development duration increased to 5.5 days, the average final body weights of larvae and pupae were decreased by 44.85 mg and 14.59 mg, respectively, and the average body lengths of larvae and pupae were significantly shortened by 3.09 mm and 3.82 mm, respectively. The adult eclosion rate and the oviposition of adult females were also severely influenced. These results demonstrated that HiACP regulates fatty acid content and influences multiple biological processes of H. illucens.

1. Introduction

Fatty acids play essential roles in animal health and development [1]. They can be esterified by glycerol and serve as energy sources (triglycerides) within adipose tissue. Fatty acids are also present in cell membrane phospholipids involved in cell structure and membrane fluidity. They stimulate signaling processes, including immune response or metabolic functions [2,3]. In insects, fatty acids are crucial for embryonic development, metamorphosis, and reproductive processes [4,5,6]. To obtain fatty acids, insects have evolved a system for their de novo synthesis.
De novo synthesis of fatty acids in insects begins with the transformation of acetyl-CoA to malonyl-ACP [7]. This compound further reacts with acetyl-ACP by a chain-extending reaction. Then, a series of reaction steps, including reduction, dehydration, and desaturation, occurs [8]. Repetition of this reaction cycle results in fatty acids with different carbon chain lengths. This key reaction cycle is catalyzed by fatty acid synthase (FAS), which contains multiple catalytic domains. During the chain-extending reaction, nearly all acyl substrates and intermediates are attached to an acyl carrier protein (ACP) and shuttled to different catalytic sites of FAS [7,9,10,11]. With the help of a phosphopantetheinyl transferase, ACPs can bind to the 4′-phosphopantetheine arm of coenzyme A (CoA) and transfer to the “active form” for delivery of acyl substituents to distinct FAS domains [12,13]. ACP is the central element of FAS and fatty acid metabolism [14]. ACP deficiency in animals can cause visible damage. For example, mutations in ACP-related genes in animal lungs can impair FAS function, reduce the number of long-chain fatty acids, and delay growth [15]. Downregulation of the active form of ACP can impair the lipoylation function and lead to the decreased activity of lipoylated proteins [16]. ACP is also a key player in insect development and lipid metabolism. The mitochondrial ACP gene of Drosophila melanogaster is most highly expressed in late embryonic development, and mutations in its ACP isoform can increase mortality [17,18]. However, little is known about the impact of ACPs on the biosynthesis, storage, and composition of the fatty acids of other insect species. Research is needed to evaluate the influence of ACP deficiency on insect growth and development.
Hermetia illucens (Diptera: Stratiomyidae) is a saprophagous species widely used for the bioconversion of organic wastes [19,20,21,22,23]. Similar to other edible insects such as mealworms, silkworms, and crickets, H. illucens larvae can utilize carbon and nitrate sources in waste and produce high-quality protein, fatty acid, and mineral nutrients [24,25,26]. The fatty acids in H. illucens larvae are mainly saturated fatty acids (SFAs), which account for 50% of the total fat [27,28]. Among these, C12:0 has the highest yield, which generally accounts for 40–60% of the crude fat [29]. The SFAs in H. illucens larvae are present at a higher level, which is distinctive compared with other insects such as the mealworm (Tenebrio molitor) [30]. This composition can be altered by the larval diet [31]. Thus, the H. illucens larva is a good source of lauric acid (C12:0), palmitic acid (C16:0), oleic acid (C18:1), linoleic acid (C18:2), and linolenic acid (C18:3) [32,33]. Therefore, uncovering the mechanisms of fatty acid synthesis and storage is required for this beneficial decomposer insect and its associated industry. The conversion efficiency of fatty acids and their composition in H. illucens is mainly governed by FAS, highlighting the need to understand the mechanism of this enzyme and its possible use in the waste disposal and recycling industry.
To investigate the impact of FAS on the fatty acid metabolism of H. illucens, we focused on the functions of ACP, a key cofactor serving as the intermediate carrier during fatty acid biosynthesis. We developed an RNAi system to investigate the influence of downregulating the ACP gene in 3rd instar H. illucens larvae. We also used gas chromatography to assess changes in fatty acid composition in ACP-inhibited individuals. By determining the effect of the downregulation on larval, pupal, and adult biomass, survival rate, and development duration, we could further estimate the functions of HiACP on the survival and growth of H. illucens and explore the possibility of enhancing the fatty acid quality of this economic insect species.

2. Materials and Methods

2.1. Insect Rearing and Sample Collection

Hermetia illucens were reared in an artificial incubator. The temperature was set as 28 ± 1 °C; the relative humidity was 70 ± 5%; the light-dark cycle was 8:16 (L:D) [34], and the light intensity was 4800 lx. Wheat bran was used as the main feed, supplemented with fruits and water. Chicken manure was used to stimulate adults for laying eggs. Larvae of six instar (6th instar larvae are also called pre-pupae) [35,36], pupae, adults (male and female, respectively), and eggs were sampled and stored at −80 °C before use. The head, hemolymph, fat body, cuticle layer, and midgut of the 5th instar larvae were thereafter dissected for RNA isolation. RNA was extracted using the Trizol method following the manufacturer’s instructions. Three biological replicates and three technical replicates were prepared for each test [37].

2.2. Cloning of HiACP cDNAs

The concentration and A260/A280 value of the extracted RNA were measured by a UV/VIS spectrophotometer (biodrop μ Lite, Cambridge, UK). The integrity of RNA was verified by agarose gel electrophoresis. The cDNA synthesis reaction was carried out by hiscript II 1st strand cDNA synthesis Kit (Vazyme, Nanjing, China). The synthesized cDNA was used as the template for PCR reaction as follows: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s; annealing at 60 °C for 15 s; extending at 72 °C for 60 s; extending at 72 °C for 2 min; 35 cycles; holding at 12 °C [38]. Primer sets used for the amplification of HiACP are shown in Table 1. The sequences of PCR products were carried out in Tianke High-tech Development Co., Ltd. (Hangzhou, China).

2.3. Sequence Analysis and Quantification of the HiACP Gene

The nucleotide sequence of cDNA was transformed into an amino acid sequence by the Translate tool implicated in Expasy. HiACP gene sequences of other insect species were downloaded by the NCBI protein database [39]. The physicochemical properties of protein were predicted by Expasy [40]. The signal peptide was predicted using SignalP [41]. Protein transmembrane structure was predicted by TMHMM [42]. Subcellular localization was performed by Euk-multi-2 [43]. Prediction of phosphorylation sites was performed by NetPhos [44]. Protein secondary structure was predicted by Cgi-bin. Multi-sequence alignment was obtained by DNAMAN software [45].
Quantification of the HiACP gene was performed by Real-time PCR method. The cDNA was diluted to 100 ng/μL. PCR reactions were prepared by TB GREENTM premix ex taq (Takara). The reaction conditions were set as follows: pre-denaturation at 95 °C for 30 s; 95 °C, 10 s; 60 °C, 30 s, 39 cycles; 95 °C, 15 s; 65 °C, 5 s; 95 °C, 5 s. We used β-actin as a housekeeping gene [46]. Table 1 shows the primers used for qRT-PCR. Three biological repeats were prepared in total, and each was repeated three times (technical repeats). The relative transcription level was analyzed using the 2−ΔΔCt method [47].

2.4. RNAi Treatment

The DNA of HiACP was amplified from the cDNA of H. illucens larvae using the primer set “HiACP” (Table 1). PCR products were purified by the gel extraction kit (Vazyme, Nanjing, China). The concentration of the final DNA product was greater than 60 ng/μL, and the A260/A280 value ranged from 1.8 to 2.0 [48]. The DNA fragments were further used for dsRNA synthesis. Synthesis of dsRNA was performed using T7 high-yield RNA transcription Kit (Vazyme Biotech Co., Ltd.). Primers used in this step were shown in Table 1 (dsACP and dsGFP). For dsRNA injection, the 3rd-instar larvae were starved for 24 h, then washed, dried, and settled on the ice. Before injection, 75% alcohol was used to disinfect the 10 μL microinjector. Subsequently, the tip of the injector was burned by a burner, and the injection was preceded after the needle was cooled down [49]. A total of 1.5 μL of dsRNA was injected into the membrane of the 7–8th segments of the larvae. The treated insects were reared in an incubator for further tests. Daily cumulative mortality (Daily cumulative mortality (%) = cumulative number of dead worms per day/total number of worms × 100%) [50] of RNAi-treated larvae was noted every day. Body weight was measured daily, and larval body length was measured by Leica M165 C stereo microscope. The eclosion rate was calculated as follows: Adult eclosion rate (%) = adult number/total pupae number × 100%. Oviposition rate (%) = the number of eggs/the number of female adults × 100% [51].

2.5. Fatty Acid Contents in H. illucens

Larvae were ground to powder with liquid nitrogen. Totally 0.2 g of larvae powder was collected into a glass tube, and 1 μg/mL of C17:0 was added as the internal standard. Total Fatty Acids were extracted by chloroform and dried by N2. Methyl esterification was carried out with the methanol-H2SO4 method; n-hexane was used to extract fatty methyl esters (FAME) [52]. The FAME products were measured by an Agilent 6890N Gas Chromatography gas phase analyzer with a DB-23 column (60 m × 250 m × 0.25 m). The sampling parameter was set as follows: detector temperature, 260 °C; inlet temperature, 270 °C. The heating program was started initially at 100 °C for 13 min, then 10 °C/min to 180 °C for 5 min, 1 °C/min to 200 °C for 20 min, and finally heated at 4 °C/min to 240 °C for 10 min [53]. Helium was used as the carrier gas. The C4–C24 FAME mixture (Supelco 37 F. A. M. E. Mix, Sigma-Aldrich, St. Louis, MO, USA) was used as the standard solution.

2.6. Statistical Analysis

All statistical analysis was performed by Prism 9.0. Variations of test groups were calculated by Student’s t-test (for two groups) and One-Way ANOVA followed by Tukey’s post-hoc test (pair-wise analysis of multi-groups).

3. Results

3.1. Sequence Analysis of HiACP

Physicochemical properties and structure analysis of HiACP by NCBI [39] showed that the full-length open reading frame of HiACP (GenBank accession# OP659030) was 501 bp, and it encoded 165 amino acids. The molecular weight was 18.4 kDa. The negatively charged residue (Asp + Glu) was 20. The positively charged residue (Arg + Lys) was 20. The instability index was 43.38. The fat coefficient was 89.34. The total hydrophobic coefficient was −0.156. A blast of the amino acid sequence of HiACP with homologous genes of other species by NCBI showed that it contains a conserved region of DSLD (Figure 1). The cloned HiACP genes were blasted by the NCBI database, where species with high similarity ranking and small e-value included Drosophila innubila (XP-034481180.1) with 61% similarity and an e-value of 5 × 10−55, Scaptodrosophila lebanonensis (XP-030385635.1) with 60% similarity and an e-value of 8 × 10−52 and Rhagoletis zephyria (XP-017477199.1) with 60% similarity and an e-value of 2 × 10−52. The physical and chemical properties of the protein were analyzed by ExPASY [40]. TMHMM2.0 [42] predicted that HiACP had no transmembrane structure. SignalP 5.0 predicted HiACP signal-free peptides. Euk-m PLoc 2.0 [41] predicted that HiACP was localized in the mitochondria. SOMPA [43] predicted that HiACP had 68.07% alpha helix, 3.61% extended chain, 4.82% beta-turn, and 23.49% irregular curl. NetPhos3.1 Server [44] predicted that HiACP had 11 serine phosphorylation sites (10, 12, 20, 37, 41, 59, 81, 87, 112, 122, 143), 10 threonine phosphorylation sites (24, 25, 39, 69, 76, 82, 104, 109, 150, 153), and five tyrosine phosphorylation sites (66, 80, 100, 157, 165).

3.2. Expression at Growth Stages and Tissues

The relative expression levels of HiACP in different developmental stages and tissues of H. illucens were determined by qRT-PCR. The midgut, integument, hemolymph, fat body, head of 5th instar larvae, and the egg, 1st, 2nd, 3rd, 4th, 5th, and 6th instar larvae, pupae, female, and male adults were tested. The relative expression levels of HiACP in the different developmental stages of H. illucens were as follows: The relative transcription level in the egg stage was significantly greater than that in other developmental stages (p < 0.05). The relative transcript levels of HiACP increased as the larval instar increased, but it decreased from the pupal stage to the period after adult eclosion (Figure 2A). The results showed the relative transcript level of HiACP in different tissues. The highest expression level was in the midgut (p < 0.05), followed by the expression in the fat body (p < 0.05) (Figure 2B).

3.3. Effects of RNAi of HiACP

We injected dsRNA into one-day-old 3rd instar larvae to determine the optimal concentration and repression time. When the concentration of dsACP was 2000 μg∙mL−1, the silencing efficiency was greatest at 61.5% (p < 0.05). There was no significant difference when the concentration of dsACP was 500 μg∙mL−1 (Figure 3A). The relative expression of the HiACP gene on different days following the dsACP injection was also analyzed. Silencing efficiency was best on the 3rd day (1.5 μL, 2000 μg·mL−1)) and reached 81.9% (p < 0.05) (Figure 3B).
The changes in fatty acid content in dsACP-injected 3rd instar larvae on the 3rd day after interference were studied using the RNAi method (Table 2). After interference, the total fatty acid content decreased by 13.13% (p < 0.05), and lauric acid (C12:0) decreased by 20.22% (p < 0.05). After interference with dsACP, the percentage of SFA in total fatty acid decreased by 2.44% (p < 0.05), while the percentage of UFA in total fatty acid increased by 4.94% (p < 0.05).
We studied the influence of HiACP interference on the growth of 3rd instar larvae of H. illucens. After injecting dsACP, the 3rd instar larvae were continuously observed for 30 d. The 3rd instar larvae injected with dsACP grew to 5th instar larvae. Compared to the control 5th instar larvae, the treated larvae had an average body weight that was 44.85 mg less and an average body length that was 3.09 mm shorter (Figure 4A). These values were significantly different from the control group (p < 0.05). When the 3rd instar larvae grew to pre-pupae, we observed that the weight of the average pre-pupa was 14.59 mg less, and the average pre-pupa length was 3.82 mm less than the control (Figure 4B). These reductions were significantly less than the control (p < 0.05).
After the 3rd instar larvae interference treatment, individuals grew to the adult stage, the adult male weight was reduced by 34.06 mg, and the adult female weight was reduced by 33.05 mg compared to the control. These changes were significantly different from the control group (p < 0.05) (Figure 5A). The experimental group’s adult male body length was reduced by 5.9 mm, and the adult female body length was reduced by 5.8 mm. These reductions were significantly different from the control group (p < 0.01) (Figure 5B). The adult eclosion rate was reduced by 8.86%, and adult female oviposition was reduced by 18.52% (Figure 5C). These values were significantly less than those in the control (p < 0.05).
On day 40, after injecting dsACP, the treated 3rd instar larvae had developed into adults. The cumulative mortality of the experimental group was 68.00%, which was significantly greater than the control group (p < 0.01) (Figure 6A). We also found that after injecting dsACP into the 3rd larvae, there was a significant increase in instar duration. The duration of 4th instar larvae, pupae, and adults was significantly longer than the control group. The duration of 4th instar larvae increased by 1.3 d, pupal duration increased by 1.5 d, and the adult stage increased by 2.7 d. These increases were significantly different from the control group (p < 0.01) (Figure 6B).

4. Discussion

Fatty acid synthase plays a crucial role in the fatty acid metabolism of insects, and ACP is an important functional cofactor that directs the production of various fatty acids in insect tissues. We studied ACP deficient H. illucens to determine the potential function of this key FAS cofactor. Inhibition of ACP expression during the larva stage directly down-regulated the content of common fatty acids stored in the tissues. This effectively reduced the growth of H. illucens. The effects included a reduced survival rate, reduced body size and mass, increased development duration, and reduced female reproduction. These results indicated that ACP could have a great impact on fat storage and the growth of H. illucens. Advance editing of this gene might help improve fatty acid production and conversion efficiency of organic waste by H. illucens.
The development of H. illucens larvae can be affected by various extrinsic factors such as temperature, gut microbes, food nutrition, and xenobiotics [23,54,55]. Intrinsic factors, such as the expression level of metabolic genes, also perform vital roles during the developmental process. Our result exhibited that HiACP was expressed at the highest level during the egg stage of H. illucens (Figure 2A). During embryogenesis, a large amount of energy is needed to complete the transformation from egg to 1st instar larva. Lipids, consisting of glycerol and fatty acids, are the major fuel source during this development stage [56]. Similar to H. illucens, a large number of fatty acids occur in the oocytes of mosquitos. These have been termed maternal fatty acids [57]. Fatty acid deficiency can reduce the egg lifespan of insects and hence impair the fitness of eggs [57,58]. These results confirm that, in H. illucens, HiACP regulates the biosynthesis of intra-egg fatty acids and is involved in the development of the embryo to larval stages. After the egg hatched, the expression level of the HiACP gene increased during the H. illucens growth. This indicated a gradually increased storage of fatty acids in the gut and fat body of larvae (Figure 2B). This energy source could be used for pupation and subsequent adult eclosion. In adult female Bombyx mori, the ACP gene was highly expressed in the unfertilized egg, flight muscle, and fat body tissues. The adult B. mori midgut had a relatively lower expression level than those found in other tissues [59], which is inconsistent with our results. This could be caused by the degenerated gut tract of the silkworm, which does not participate in food digestion and fatty acid metabolism.
In mammals, fatty acid synthase mainly produces C16 fatty acids, whereas insect fatty acid products are evenly distributed in carbon chain lengths, reaching C18 [60]. Large amounts of C18 fatty acids, such as stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), and linolenic acid (C18:3), have been identified in many insects, including crickets, grasshoppers, mealworms, and houseflies [61,62,63]. H. illucens larvae contain a large amount of lauric acid (C12:0), palmitic acid (C16:0), and oleic acid. Our results demonstrated that SFAs are dominant in the H. illucens larva, which is consistent with previous studies of this species [33,64]. Lauric acid (C12:0) was the most abundant fatty acid in H. illucens larvae, a result that differs from previous data. H. illucens contains high levels of lauric acid and serves as a useful SFA supplier for the food, cosmetics, and poultry industries [65]. Using the H. illucens RNAi system, we found that lauric acid content decreased by 20.22% in the 3rd instar larva after silencing of HiACP. However, other C16 and C18 SFA and MUFA compounds were also simultaneously down-regulated. No fatty acid was observed to decrease significantly compared with its other analogs. This result implies that HiACP mainly participates in the elongation step of fatty acid biosynthesis in H. illucens and might not be involved in the decoration and termination reaction of the hydrocarbon chain. Functional genes that contribute to the composition of specific fatty acid types (e.g., lauric acid) may be uncovered by future RNAi studies.
RNAi treatment had significant effects on the growth and development of 3rd instar H. illucens larvae. Inhibition of HiACP decreased fatty acid storage in tissues and impaired triglyceride synthesis in RNAi-treated individuals. When the energy storage ability of insects was compromised, their body size, duration of development, and fertility were also affected. This result indicated that HiACP is essential for the nutrient digestibility and energy storage of H. illucens. ACPs have exhibited similar functions in other animals. For example, the downregulation of genes related to fatty acid synthesis can induce dysfunctions in adipose tissue and lead to fat loss and weight loss in rats [66]. Similarly, RNAi treatment of the FAS gene disturbed the rate of midgut digestion and caused reduced lipid synthesis in Aedes aegypti [67]. The fatty acid synthesis pathway is a basic biological process, the products of which are widely involved in the physiology of the immune and other cell signaling systems [68]. For example, lauric acid has bactericidal activity [69], so a decrease in lauric acid content triggered by ACP interference, as observed here, might suppress the immune function of H. illucens against bacterial pathogens. The chain extension reaction of the fatty acid synthesis process is also used by the insect hormone biosynthesis process [70,71,72], which indicates that the ACP downregulated induced disturbance of the fatty acid elongation reaction might diminish the hormone homeostasis of H. illucens. We assume that this hormone dysfunction might have a wider influence on insect physiology and ecology.
RNAi treatment of H. illucens demonstrated that HiACP is a core gene involved in the fatty acid synthesis process. This gene cannot precisely govern the production of specific fatty acid content and the composition of fatty acids stored in H. illucens tissues. It appears to act as a “general controller” of the fatty acids that regulate fatty acid composition and storage in H. illucens. This knowledge could be used for expanding the fatty acids produced by the H. illucens rearing industry.

5. Conclusions

We demonstrated that the HiACP gene regulates the biosynthesis of fatty acids. This gene affects the growth of H. illucen larvae, adult eclosion rate, and adult oviposition. These effects helped reveal the molecular mechanism and function of the HiACP gene and the process of fatty acid regulation. Future research should focus on the optimization of the fatty acid regulatory mechanisms and the expression of high-quality fatty acids in vitro.

Author Contributions

Conceptualization, X.P. and D.Z.; Methodology, X.P., J.L. and B.L.; Validation, S.W. and B.C.; Investigation, X.P., J.L., B.L. and B.C.; Resources, S.W., B.C. and D.Z.; Data curation, B.C.; Writing—original draft preparation, X.P. and B.C.; Writing—review and editing, B.C. and D.Z.; Visualization, B.C.; Funding acquisition, B.C. and D.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by grants from National Nutural Science Foundation of China (32100397) and the Development Fund of Zhejiang A&F University (2012FR087).

Data Availability Statement

Data will be available upon reasonable request to authors.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study, in the collection, analysis, or interpretation of data, in the writing of the manuscript, or in the decision to publish the results.

References

  1. Paul, A.; Frederich, M.; Megido, R.C.; Alabi, T.; Malik, P.; Uyttenbroeck, R.; Francis, F.; Blecker, C.; Haubruge, E.; Lognay, G.; et al. Insect fatty acids: A comparison of lipids from three Orthopterans and Tenebrio molitor L. larvae. J. Asia-Pac. Entomol. 2017, 20, 2–38. [Google Scholar] [CrossRef]
  2. Calder, P.C. Functional Roles of Fatty Acids and Their Effects on Human Health. J. Parenter. Enter. Nutr. 2015, 39, 18–32. [Google Scholar] [CrossRef] [PubMed]
  3. Innes, J.K.; Calder, P.C. Omega-6 fatty acids and inflammation. Prostaglandins Leukot. Essent. Fat. Acids (PLEFA) 2018, 132, 41–48. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Cerkowniak, M.; Puckowski, A.; Stepnowski, P.; Gołębiowski, M. The use of chromatographic techniques for the separation and the identification of insect lipids. J. Chromatogr. B 2013, 35, 869–937. [Google Scholar] [CrossRef] [PubMed]
  5. Dennis, G.A.; Oonincx, B.; Laurent, S.; Margot, E.; Veenenbos, J.A. Dietary enrichment of edible insects with omega 3 fatty acids. Insect Sci. 2020, 27, 3–22. [Google Scholar]
  6. Suh, J.M.; Gao, X.; McKay, J.; McKay, R.; Salo, Z.; Graff, J.M. Hedgehog signaling plays a conserved role in inhibiting fat formation. Cell Metab. 2006, 3, 25–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Chan, D.I.; Vogel, H.J. Current understanding of fatty acid biosynthesis and the acyl carrier protein. Biochem. J. 2010, 430, 1–19. [Google Scholar] [CrossRef] [Green Version]
  8. Smith, J.L.; Sherman, D.H. An Enzyme Assembly Line. Science 2008, 321, 1304–1305. [Google Scholar] [CrossRef]
  9. Huang, J.; Xue, C.; Wang, H.; Wang, L.; Schmidt, W.; Shen, R.; Lan, P. Genes of acyl carrier protein Family Show Different Expression Profiles and Overexpression of acyl carrier protein 5 Modulates Fatty Acid Composition and Enhances Salt Stress Tolerance in Arabidopsis. Front. Plant Sci. 2017, 8, 987–988. [Google Scholar] [CrossRef] [Green Version]
  10. Liu, X.; Hicks, W.M.; Silver, P.A.; Way, J.C. Engineering acyl carrier protein to enhance production of shortened fatty acids. Biotechnol. Biofuels 2016, 9, 24–25. [Google Scholar] [CrossRef] [Green Version]
  11. Cronan, J.E. The chain-flipping mechanism of ACP (acyl carrier protein)-dependent enzymes appears universal. Biochem. J. 2014, 460, 157–158. [Google Scholar] [CrossRef] [PubMed]
  12. Sulpizio, A.; Crawford, C.E.; Koweek, R.S.; Charkoudian, L.K. Probing the structure and function of acyl carrier proteins to unlock the strategic redesign of type II polyketide biosynthetic pathways. J. Biol. Chem. 2021, 296, 100328. [Google Scholar] [CrossRef]
  13. Mofid, M.R.; Finking, R.; Marahiel, M.A. Recognition of hybrid peptidyl carrier proteins/acyl carrier proteins in nonribosomal peptide synthetase modules by the 4’-phosphopantetheinyl transferases AcpS and Sfp. J. Biol. Chem. 2002, 277, 17023–17031. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Schweizer, E.; Hofmann, J. Microbial Type I Fatty Acid Synthases (FAS): Major Players in a Network of Cellular FAS Systems. Microbiol. Mol. Biol. 2004, 68, 501–517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Dunphy, K.Y.; Senaratne, R.H.; Masuzawa, M.; Kendall, L.V.; Riley, L.W. Attenuation of Mycobacterium tuberculosis Functionally Disrupted in a Fatty Acyl–Coenzyme A Synthetase Gene fadD5. J. Infect. Dis. 2010, 201, 1232–1239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Lambrechts, R.A.; Schepers, H.; Yu, Y.; van der Zwaag, M.; Autio, K.J.; Vieira-Lara, M.A.; Bakker, B.M.; Tijssen, M.A.; Hayflick, S.J.; Grzeschik, N.A.; et al. CoA-dependent activation of mitochondrial acyl carrier protein links four neurodegenerative diseases. EMBO Mol. Med. 2019, 11, 12–15. [Google Scholar] [CrossRef]
  17. Ragone, G.; Caizzi, R.; Moschetti, R. The Drosophila melanogaster gene for the NADH: Ubiquinone oxidoreductase acyl carrier protein: Developmental expression analysis and evidence for alternatively spliced forms. Mol. Gen. Genet. 1999, 261, 4–5. [Google Scholar] [CrossRef]
  18. Clements, J.; Olson, J.M.; Sanchez-Sedillo, B.; Bradford, B.; Groves, R.L. Changes in emergence phenology, fatty acid composition, and xenobiotic-metabolizing enzyme expression is associated with increased insecticide resistance in the Colorado potato beetle. Arch. Insect Biochem. Physiol. 2020, 103, 3–36. [Google Scholar] [CrossRef] [Green Version]
  19. Siddiqui, S.A.; Ristow, B.; Rahayu, T.; Putra, N.S.; Yuwono, N.W.; Mategeko, B.; Smetana, S.; Saki, M.; Nawaz, A.; Nagdalian, A. Black soldier fly larvae (BSFL) and their affinity for organic waste processing. Waste Manag. 2022, 140, 1–13. [Google Scholar] [CrossRef]
  20. Van Huis, A.; Gasco, L. Insects as feed for livestock production. Science 2023, 379, 138–139. [Google Scholar] [CrossRef]
  21. Liew, C.S.; Mong, G.R.; Abdelfattah, E.A.; Raksasat, R.; Rawindran, H.; Kiatkittipong, W.; Mohamad, M.; Ramli, A.; Yunus, N.M.; Lam, M.K.; et al. Correlating black soldier fly larvae growths with soluble nutrients derived from thermally pre-treated waste activated sludge. Environ. Res. 2022, 210, 112923. [Google Scholar] [CrossRef] [PubMed]
  22. Naser El Deen, S.; van Rozen, K.; Elissen, H.; van Wikselaar, P.; Fodor, I.; van der Weide, R.; Hoek-van den Hil, E.F.; Rezaei Far, A.; Veldkamp, T. Bioconversion of Different Waste Streams of Animal and Vegetal Origin and Manure by Black Soldier Fly Larvae Hermetia illucens L.(Diptera: Stratiomyidae). Insects 2023, 14, 204. [Google Scholar] [CrossRef] [PubMed]
  23. Rehman, K.U.; Hollah, C.; Wiesotzki, K.; Rehman, R.U.; Zhang, J.; Zheng, L.; Nienaber, T.; Heinz, V.; Aganovic, K. Black soldier fly, Hermetia illucens as a potential innovative and environmentally friendly tool for organic waste management: A mini-review. Waste Manag. Res. 2023, 41, 81–97. [Google Scholar] [CrossRef]
  24. Romano, N.; Sinha, A.; Powell, A.; Fischer, H. Mineral composition in black soldier fly (Hermetia illucens) larvae and resulting frass from fruit and their peels. J. Insects Food Feed 2023, 9, 43–53. [Google Scholar] [CrossRef]
  25. Cheng, V.; Shoveller, A.K.; Huber, L.-A.; Kiarie, E.G. Comparative protein quality in black soldier fly larvae meal vs. soybean meal and fish meal using classical protein efficiency ratio (PER) chick growth assay model. Poult. Sci. 2023, 102, 102255. [Google Scholar]
  26. Shah, A.A.; Wanapat, M. Gryllus testaceus walker (crickets) farming management, chemical composition, nutritive profile, and their effect on animal digestibility. Entomol. Res. 2021, 51, 639–649. [Google Scholar] [CrossRef]
  27. Shah, A.A.; Totakul, P.; Matra, M.; Cherdthong, A.; Harnboonsong, Y.; Wanapat, M. Nutritional composition of various insects and potential uses as alternative protein sources in animal diets. Anim. Biosci. 2022, 35, 317. [Google Scholar] [CrossRef]
  28. Boykin, K.; Mitchell, M.A. The Value of Black Soldier Fly Larvae (Hermetia illucens) as a Food Source: A Review. J. Herpetol. Med. Surg. 2021, 31, 3–11. [Google Scholar] [CrossRef]
  29. Anang, D.M.; Rusul, G.; Bakar, J.; Ling, F.H. Effects of lactic acid and lauricidin on the survival of Listeria monocytogenes, Salmonella enteritidis and Escherichia coli O157: H7 in chicken breast stored at 4 °C. Food Control 2006, 18, 8–24. [Google Scholar] [CrossRef]
  30. Lawal, K.G.; Kavle, R.R.; Akanbi, T.O.; Mirosa, M.; Agyei, D. Enrichment in specific fatty acids profile of Tenebrio molitor and Hermetia illucens larvae through feeding. Future Foods 2021, 3, 4–6. [Google Scholar] [CrossRef]
  31. Danieli, P.P.; Lussiana, C.; Gasco, L.; Amici, A.; Ronchi, B. The Effects of Diet Formulation on the Yield, Proximate Composition, and Fatty Acid Profile of the Black Soldier Fly (Hermetia illucens L.) Prepupae Intended for Animal Feed. Animals 2019, 9, 178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Hale, O.M. Dried Hermetia illucens larvae (Diptera: Stratiomy-idae) as a feed additive for poultry. J. Ga. Entomol. Soc. 1973, 173, 16–20. [Google Scholar]
  33. Ewald, N.; Vidakovic, A.; Langeland, M.; Kiessling, A.; Sampels, S.; Lalander, C. Fatty acid composition of black soldier fly larvae (Hermetia illucens)–Possibilities and limitations for modification through diet. Waste Manag. 2020, 102, 40–47. [Google Scholar] [CrossRef] [PubMed]
  34. Van Immerseel, F.; De Buck, J.; Boyen, F.; Bohez, L.; Pasmans, F.; Volf, J.; Sevcik, M.; Rychlik, I.; Haesebrouck, F.; Ducatelle, R. Medium-chain fatty acids decrease colonization and invasion through HILA suppression shortly after infection of chickens with Salmonella enterica serovar Enteritidis. Appl. Environ. Microbiol. 2004, 70, 3582–3587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Alagappan, S.; Hoffman, L.C.; Mantilla, S.M.O.; Mikkelsen, D.; James, P.; Yarger, O.; Cozzolino, D. Near Infrared Spectroscopy as a Traceability Tool to Monitor Black Soldier Fly Larvae (Hermetia illucens) Intended as Animal Feed. Appl. Sci. 2022, 12, 8168. [Google Scholar] [CrossRef]
  36. Barrera, J.; Salinas, E.R.; Rivera, A.R.; Malalis, J.S.; Bagaforo, E.R.O.; Araya, J.P.; Sulay, D.L.D. Productivity and Nutritive Value of Black Soldier Fly (Hermetia illucens) Larvae Fed with Different Waste Substrates. Int. J. Multidiscip. Appl. Bus. Educ. Res. 2023, 4, 588–599. [Google Scholar] [CrossRef]
  37. De Matteis, V.; Cascione, M.; De Giorgi, M.L.; Leporatti, S.; Rinaldi, R. Encapsulation of Thermo-Sensitive Lauric Acid in Silica Shell: A Green Derivate for Chemo-Thermal Therapy in Breast Cancer Cell. Molecules 2019, 24, 2034. [Google Scholar] [CrossRef] [Green Version]
  38. Makkar, H.P.; Tran, G.; Heuzé, V.; Ankers, P. State-of-the-art on use of insects as animal feed. Anim. Feed Sci. Technol. 2014, 197, 146–176. [Google Scholar] [CrossRef]
  39. Mariam, Q.; David, T.L.; Conrad, S. METAGENOTE: A simplified web platform for metadata annotation of genomic samples and streamlined submission to NCBI’s sequence read archive. BMC Bioinform. 2020, 21, 55–67. [Google Scholar]
  40. Gasteiger, E. Protein Identifcation and Analysis Tools on the ExPASy Server. Proteom. Protoc. Handb. 2005, 8, 571–607. [Google Scholar]
  41. Chou, K.C.; Shen, H.B. Euk-mPLoc: A fusion classifer for large-scale eukaryotic protein subcellular location prediction by incorporating multiple sites. J. Proteome Res. 2007, 6, 1728–1734. [Google Scholar] [CrossRef] [PubMed]
  42. Irina, V.U.; Marina, A.K.; Ilya, G.K. New insights into the organisation of the oxidative phosphorylation system in the example of pea shoot mitochondria. Biochim. Biophys. Acta (BBA)-Bioenerg. 2020, 1861, 380–386. [Google Scholar]
  43. Janice, L.M.; Anne, K.G.; Mary, W.M. Use of SOMPA in Identification of Gifted African-American Children. J. Educ. Gift. 1992, 15, 13–21. [Google Scholar]
  44. Rebecca, A.H.; Janet, S.D.; Beverly, S.C. Prolactin induces Jak2 phosphorylation of RUSHY195. Mol. Cell. Endocrinol. 2011, 338, 129–149. [Google Scholar]
  45. Haghighi, M.; Khanahmad, H.; Palizban, A. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX. Molecules 2018, 23, 715. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Yanyan, Z.; Ning, S.; Fei, L. Activation of mitogen-activated protein kinases in satellite glial cells of the trigeminal ganglion contributes to substance P-mediated inflammatory pain. Int. J. Oral Sci. 2019, 11, 213–222. [Google Scholar]
  47. Mazumdar, J.; Wilson, E.; Masek, K. Apicoplast fatty acid synthesis is essential for organelle biogenesis and parasite survival in Toxoplasma gondii. Proc. Natl. Acad. Sci. USA 2006, 103, 13192–13197. [Google Scholar] [CrossRef] [Green Version]
  48. Manchester, K.L. Value of A260/A280 ratios for measurement of purity of nucleic acids. BioTechniques 1995, 19, 25–31. [Google Scholar]
  49. Veronika, U.; Olga, B.; Hanka, V. Photoperiod regulates growth of male accessory glands through juvenile hormone signaling in the linden bug, Pyrrhocoris apterus. Insect Biochem. Mol. Biol. 2016, 70, 118–120. [Google Scholar]
  50. Emílio, C.M.; Simone, S.; Ana, C. Growth, mortality and reproductive traits of diploid and triploid Pacific oysters in Southern Brazil. Aquac. Res. 2020, 51, 65–74. [Google Scholar]
  51. Kelly, V.; Beskin, C.D.; Holcomb, J.A. Larval digestion of different manure types by the black soldier fly (Diptera: Stratiomyidae) impacts associated volatile emissions. Waste Manag. 2018, 74, 141–148. [Google Scholar]
  52. Milad, G.; Sayed, M.G.; Saeed, M. Highly porous nanostructured copper oxide foam fiber as a sorbent for head space solid-phase microextraction of BTEX from aqueous solutions. Microchem. J. 2019, 145, 462–467. [Google Scholar]
  53. Yogesh, M.K.; Mohammad, R.I.; Tracy, J.B. Process development and simulation of glycerol-free biofuel from canola oil and dimethyl carbonate. Fuel Process. Technol. 2013, 114, 143–160. [Google Scholar]
  54. Gorrens, E.; Lecocq, A.; De Smet, J. The Use of Probiotics during Rearing of Hermetia illucens: Potential, Caveats, and Knowledge Gaps. Microorganisms 2023, 11, 245. [Google Scholar] [CrossRef] [PubMed]
  55. Xu, Z.; Wu, X.; Zhang, J.; Cheng, P.; Xu, Z.; Sun, W.; Zhong, Y.; Wang, Y.; Yu, G.; Liu, H. Microplastics existence intensified bloom of antibiotic resistance in livestock feces transformed by black soldier fly. Environ. Pollut. 2023, 317, 120845. [Google Scholar] [CrossRef] [PubMed]
  56. Song, Y.; Park, J.O.; Tanner, L.; Nagano, Y.; Rabinowitz, J.D.; Shvartsman, S.Y. Energy budget of Drosophila embryogenesis. Curr. Biol. 2019, 29, 566–567. [Google Scholar] [CrossRef]
  57. Allman, M.J.; Fraser, J.E.; Ritchie, S.A.; Joubert, D.A.; Simmons, C.P.; Flores, H.A. Wolbachia’s Deleterious Impact on Aedes aegypti Egg Development: The Potential Role of Nutritional Parasitism. Insects 2020, 11, 735. [Google Scholar] [CrossRef]
  58. Atella, G.C.; Shahabuddin, M. Differential partitioning of maternal fatty acid and phospholipid in neonate mosquito larvae. J. Exp. Biol. 2002, 205, 3623–3630. [Google Scholar] [CrossRef]
  59. Ohnishi, A.; Kaji, M.; Hashimoto, K.; Matsumoto, S. Screening for the genes involved in bombykol biosynthesis: Identification and functional characterization of Bombyx mori acyl carrier protein (BmACP). Front. Endocrinol. 2011, 2, 92–93. [Google Scholar] [CrossRef] [Green Version]
  60. Renobales, D.; Woodin, M.; Blomquist, T.S. Drosophila melanogaster fatty acid synthetase. Insect Biochem. 1986, 16, 887–894. [Google Scholar] [CrossRef]
  61. Yang, L.-F.; Siriamornpun, S.; Li, D. Polyunsaturated fatty acid content of edible insects in thailand. J. Food Lipids 2006, 13, 277–285. [Google Scholar] [CrossRef]
  62. Dreassi, E.; Cito, A.; Zanfini, A.; Materozzi, L.; Botta, M.; Francardi, V. Dietary fatty acids influence the growth and fatty acid composition of the yellow mealworm Tenebrio molitor (Coleoptera: Tenebrionidae). Lipids 2017, 52, 285–294. [Google Scholar] [CrossRef] [PubMed]
  63. Sánchez, M.; Gómez, C.; Avendaño, C.; Harmsen, I.; Ortiz, D.; Ceballos, R.; Villamizar-Sarmiento, M.G.; Oyarzun-Ampuero, F.; Wacyk, J.; Valenzuela, C. House fly (Musca domestica) larvae meal as an ingredient with high nutritional value: Microencapsulation and improvement of organoleptic characteristics. Food Res. Int. 2021, 145, 110423. [Google Scholar] [CrossRef] [PubMed]
  64. Ramos-Bueno, R.P.; González-Fernández, M.J.; Sánchez-Muros-Lozano, M.J.; García-Barroso, F.; Guil-Guerrero, J.L. Fatty acid profiles and cholesterol content of seven insect species assessed by several extraction systems. Eur. Food Res. Technol. 2016, 242, 1471–1477. [Google Scholar] [CrossRef]
  65. Bbosa, T.; Tamale Ndagire, C.; Muzira Mukisa, I.; Fiaboe, K.K.; Nakimbugwe, D. Nutritional Characteristics of Selected Insects in Uganda for Use as Alternative Protein Sources in Food and Feed. J. Insect Sci. 2019, 19, 6–9. [Google Scholar] [CrossRef] [PubMed]
  66. Poekes, L.; Legry, V.; Schakman, O. Defective adaptive thermogenesis contributes to metabolic syndrome and liver steatosis in obese mice. Clin. Sci. 2017, 131, 146–152. [Google Scholar] [CrossRef]
  67. Alabaster, A.; Isoe, J.; Zhou, G. Deficiencies in acetyl-CoA carboxylase and fatty acid synthase 1 differentially affect eggshell formation and blood meal digestion in Aedes aegypti. Insect Biochem. Mol. Biol. 2011, 41, 946–955. [Google Scholar] [CrossRef] [Green Version]
  68. Gondim, K.C.; Atella, G.C.; Pontes, E.G.; Majerowicz, D. Lipid metabolism in insect disease vectors. Insect Biochem. Mol. Biol. 2018, 101, 108–123. [Google Scholar] [CrossRef]
  69. Rizvi, S.A.H.; George, J.; Reddy, G.V.; Zeng, X.; Guerrero, A. Latest Developments in Insect Sex Pheromone Research and Its Application in Agricultural Pest Management. Insects 2021, 12, 484. [Google Scholar] [CrossRef]
  70. Pei, X.J.; Fan, Y.L.; Bai, Y.; Bai, T.T.; Schal, C.; Zhang, Z.F.; Chen, N.; Li, S.; Liu, T.X. Modulation of fatty acid elongation in cockroaches sustains sexually dimorphic hydrocarbons and female attractiveness. PLoS Biol. 2021, 19, e3001330. [Google Scholar] [CrossRef]
  71. Loh, T.C.; Fong, L.; Foo, Y.H. Utilisation of Earthworm Meal in Partial Replacement of Soybean and Fish Meals in Diets of Broilers. Appl. Anim. Res. 2009, 36, 363–376. [Google Scholar] [CrossRef]
  72. Hiroto, M.; Motonori, K.; Masafumi, I. Hormonal regulation of the death commitment in programmed cell death of the silkworm anterior silk glands. J. Insect Physiol. 2012, 58, 67–75. [Google Scholar]
Insects 14 00300 g001 550
Figure 1. Multiple sequence alignment of HiACP with Drosophila innubila DiACP (GenBank accession no: XP-034481180.1), Rhagoletis zephyria RzACP (GenBank accession no: XP-017477199.1), Scaptodrosophila lebanonensis SlACP (GenBank accession no: XP-030385635.1), Apis cerana cerana AcACP (GenBank accession no: PBC33684.1), Mus musculus MmACP (GenBank accession no: XP-036009503.1), Lactobacillus reuteri LrACP (GenBank accession no: CUU12525.1), and Brassica rapa BrACP (GenBank accession no: NP-001288921.1). Characters shaded in different colors indicate amino acids with distinct similarity (deep blue, 100%; pink, 75–99%; light blue, 50–74%). The red box indicates strictly conserved motifs in ACPs.
Figure 1. Multiple sequence alignment of HiACP with Drosophila innubila DiACP (GenBank accession no: XP-034481180.1), Rhagoletis zephyria RzACP (GenBank accession no: XP-017477199.1), Scaptodrosophila lebanonensis SlACP (GenBank accession no: XP-030385635.1), Apis cerana cerana AcACP (GenBank accession no: PBC33684.1), Mus musculus MmACP (GenBank accession no: XP-036009503.1), Lactobacillus reuteri LrACP (GenBank accession no: CUU12525.1), and Brassica rapa BrACP (GenBank accession no: NP-001288921.1). Characters shaded in different colors indicate amino acids with distinct similarity (deep blue, 100%; pink, 75–99%; light blue, 50–74%). The red box indicates strictly conserved motifs in ACPs.
Insects 14 00300 g001
Insects 14 00300 g002 550
Figure 2. Relative transcript levels of HiACP at different developmental stages and in different tissues. (A): Relative transcript level of HiACP at different developmental stages. Lowercase letters (a–d) represent significant differences (p < 0.05) according to Tukey’s multiple range test. (B): Relative transcript levels of HiACP in different tissues. Lowercase letters (a–e) represent significant differences (p < 0.05) using Tukey’s multiple range test. The relative transcript levels of HiACP in different developmental stages and different tissues were detected by qRT-PCR (Using β-actin as the reference housekeeping gene). The Y-axis values are mean ± SE of relative expression levels. Different lowercase letters on the bars indicate a significant difference between the treatments.
Figure 2. Relative transcript levels of HiACP at different developmental stages and in different tissues. (A): Relative transcript level of HiACP at different developmental stages. Lowercase letters (a–d) represent significant differences (p < 0.05) according to Tukey’s multiple range test. (B): Relative transcript levels of HiACP in different tissues. Lowercase letters (a–e) represent significant differences (p < 0.05) using Tukey’s multiple range test. The relative transcript levels of HiACP in different developmental stages and different tissues were detected by qRT-PCR (Using β-actin as the reference housekeeping gene). The Y-axis values are mean ± SE of relative expression levels. Different lowercase letters on the bars indicate a significant difference between the treatments.
Insects 14 00300 g002
Insects 14 00300 g003 550
Figure 3. Relative transcript levels of HiACP after injection of 1.5 μL dsACP in one-day-old 3rd instar larvae with different concentrations and different days. (A): Relative transcript levels of HiACP 48 h after injection of 1.5 μL dsACP in one-day-old 3rd instar larvae with different concentrations. The larvae injected with dsACP were collected at 48 h. (B): Relative transcript levels of HiACP after 1.5 μL (2000 μg·mL−1) dsACP injection in 3rd instar larvae. The transcript level of HiACP was analyzed by qRT-PCR. Mean ± SE was calculated from five biological replicates, and each biological replicate contained ten 3rd instar larvae. Bars marked with different letters indicate significant differences between treatment and control (Student’s t-test, p < 0.05).
Figure 3. Relative transcript levels of HiACP after injection of 1.5 μL dsACP in one-day-old 3rd instar larvae with different concentrations and different days. (A): Relative transcript levels of HiACP 48 h after injection of 1.5 μL dsACP in one-day-old 3rd instar larvae with different concentrations. The larvae injected with dsACP were collected at 48 h. (B): Relative transcript levels of HiACP after 1.5 μL (2000 μg·mL−1) dsACP injection in 3rd instar larvae. The transcript level of HiACP was analyzed by qRT-PCR. Mean ± SE was calculated from five biological replicates, and each biological replicate contained ten 3rd instar larvae. Bars marked with different letters indicate significant differences between treatment and control (Student’s t-test, p < 0.05).
Insects 14 00300 g003
Insects 14 00300 g004 550
Figure 4. Changes in body weight, length, and appearance of larvae and pupae with time in one-day-old 3rd instar larvae of H. illucen after dsACP (2000 μg∙mL−1) injection of 1.5 μL. (A): Changes in body weight and length of larvae with time. (B): Changes in body weight and length of pupa with time. The 6th instar larva is also called larval in the pre-pupa stage, so it is also classified as a pupal stage. The left y-axis values are the mean of the average weight of larvae and the right y-axis indicates the length of H. illucnens larvae. (C): Appearance changes of larva and pupa of different instars. The photos of larva and pupa were collected at the 3rd day of the corresponding instar. Mean ± SE was calculated from three biological replicates, and each biological replicate contained 50 3rd instar larvae.
Figure 4. Changes in body weight, length, and appearance of larvae and pupae with time in one-day-old 3rd instar larvae of H. illucen after dsACP (2000 μg∙mL−1) injection of 1.5 μL. (A): Changes in body weight and length of larvae with time. (B): Changes in body weight and length of pupa with time. The 6th instar larva is also called larval in the pre-pupa stage, so it is also classified as a pupal stage. The left y-axis values are the mean of the average weight of larvae and the right y-axis indicates the length of H. illucnens larvae. (C): Appearance changes of larva and pupa of different instars. The photos of larva and pupa were collected at the 3rd day of the corresponding instar. Mean ± SE was calculated from three biological replicates, and each biological replicate contained 50 3rd instar larvae.
Insects 14 00300 g004
Insects 14 00300 g005 550
Figure 5. Changes in the body weight, length, eclosion, oviposition, and appearance in adults after the one-day-old 3rd instar larvae of H. illucen injected with 1.5 μL dsACP (2000 μg∙mL−1) grew to adults. (A): Changes in the weight of female and male adults. Y-axis values are the means of the average weight of adults. (B): Changes in the length of female and male adults. Y-axis values are the mean of the average length of adults. (C): Changes in the proportion of eclosion of adults and oviposition of female adults. Y-axis values are the means of the proportion of eclosion and oviposition. (D): Appearance changes of female and male adults. The pictures of adults were collected on the first day after molting. Every adult grew from a one-day-old 3rd instar larva of H. illucen injected with 1.5 μL dsACP (2000 μg∙mL−1). Mean ± SE was calculated from three biological replicates, and each biological replicate contained 50 one-day-old 3rd first instar larvae that grew to the adult stage. Bars marked with different letters indicate significant differences between treatment and control (Student’s t-test, p < 0.05).
Figure 5. Changes in the body weight, length, eclosion, oviposition, and appearance in adults after the one-day-old 3rd instar larvae of H. illucen injected with 1.5 μL dsACP (2000 μg∙mL−1) grew to adults. (A): Changes in the weight of female and male adults. Y-axis values are the means of the average weight of adults. (B): Changes in the length of female and male adults. Y-axis values are the mean of the average length of adults. (C): Changes in the proportion of eclosion of adults and oviposition of female adults. Y-axis values are the means of the proportion of eclosion and oviposition. (D): Appearance changes of female and male adults. The pictures of adults were collected on the first day after molting. Every adult grew from a one-day-old 3rd instar larva of H. illucen injected with 1.5 μL dsACP (2000 μg∙mL−1). Mean ± SE was calculated from three biological replicates, and each biological replicate contained 50 one-day-old 3rd first instar larvae that grew to the adult stage. Bars marked with different letters indicate significant differences between treatment and control (Student’s t-test, p < 0.05).
Insects 14 00300 g005
Insects 14 00300 g006 550
Figure 6. Cumulative mortality and instar duration of one-day-old 3rd instar larvae of H. illucen after dsACP (2000 μg∙mL−1) injection of 1.5 μL. (A): Cumulative mortality in different instars of 3rd instar larvae injected with dsACP. Y-axis values are the means of cumulative mortality in the different instars. (B): The duration of 3rd, 4th, 5th, 6th instar larvae, pupae, and adults. Y-axis values are the means of duration at different instars. Mean ± SE was calculated from three biological replicates, and each biological replicate contained 50 one-day-old 3rd instar larvae grown to different instars. Bars marked with different letters indicate significant differences between treatment and control (Student’s t-test, p < 0.05).
Figure 6. Cumulative mortality and instar duration of one-day-old 3rd instar larvae of H. illucen after dsACP (2000 μg∙mL−1) injection of 1.5 μL. (A): Cumulative mortality in different instars of 3rd instar larvae injected with dsACP. Y-axis values are the means of cumulative mortality in the different instars. (B): The duration of 3rd, 4th, 5th, 6th instar larvae, pupae, and adults. Y-axis values are the means of duration at different instars. Mean ± SE was calculated from three biological replicates, and each biological replicate contained 50 one-day-old 3rd instar larvae grown to different instars. Bars marked with different letters indicate significant differences between treatment and control (Student’s t-test, p < 0.05).
Insects 14 00300 g006
Table
Table 1. Sequences of primers for DNA cloning, dsRNA synthesis, and qRT-PCR.
Table 1. Sequences of primers for DNA cloning, dsRNA synthesis, and qRT-PCR.
PrimerForward PrimerReverse PrimerProduct Length (bp)Purpose
HiACPAAAAATGTCGCTGTCACAGGGTCAACAAAACGATGAACCCGC501cDNA
dsACPT7-CGCTGTTTATTGAGCCGTGCT7-TTCTCGGCATCTGAATCGGG395RNAi
dsGFPT7-AGATCCGCCACAACATCGAGT7-GTCCATGCCGAGAGTGATCC204
qHiACPGATGCTCCATCGACAATGCGGGACGCGTTCACGAATTTCT137qRT-PCR
β-actinAGGAGACGAAGCACAAAGCAAGTCCAAAGCGACGTAGCAG150
T7: GATCACTAATACGACTCACTATAGGG.
Table
Table 2. Fatty acid composition (g/100 g) of 3rd instar larvae after dsACP injection.
Table 2. Fatty acid composition (g/100 g) of 3rd instar larvae after dsACP injection.
Fatty AciddsGFPdsACP
C10:00.21 ± 0.000.17 ± 0.01 *
C12:09.94 ± 0.087.93 ± 0.06 **
C14:02.31 ± 0.021.91 ± 0.01 **
C15:00.11 ± 0.010.06 ± 0.02
C16:05.24 ± 0.234.94 ± 0.23
C16:11.03 ± 0.040.82 ± 0.01 **
C18:00.94 ± 0.060.88 ± 0.03
C18:15.09 ± 0.044.6 ± 0.14 *
C18:22.84 ± 0.182.76 ± 0.28
C18:30.31 ± 0.030.27 ± 0.05
SFA18.75 ± 0.1515.89 ± 0.25 **
MUFA6.12 ± 0.075.42 ± 0.12 **
PUFA3.15 ± 0.213.03 ± 0.32
Total FA28.02 ± 0.1724.34 ± 0.24 **
Mean ± SE was calculated from three biological replicates and four technology replicates; each biological replicate contained 15 one-day-old 3rd instar larvae. The larvae injected 1.5 μL (2000 μg·mL−1) dsACP were collected on the 3rd day. *: 0.01 < p < 0.05, **: p < 0.01.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Peng, X.; Liu, J.; Li, B.; Wang, S.; Chen, B.; Zhang, D. An Acyl Carrier Protein Gene Affects Fatty Acid Synthesis and Growth of Hermetia illucens. Insects 2023, 14, 300. https://doi.org/10.3390/insects14030300

AMA Style

Peng X, Liu J, Li B, Wang S, Chen B, Zhang D. An Acyl Carrier Protein Gene Affects Fatty Acid Synthesis and Growth of Hermetia illucens. Insects. 2023; 14(3):300. https://doi.org/10.3390/insects14030300

Chicago/Turabian Style

Peng, Xiaoyan, Jiawen Liu, Baoling Li, Shengyin Wang, Bosheng Chen, and Dayu Zhang. 2023. "An Acyl Carrier Protein Gene Affects Fatty Acid Synthesis and Growth of Hermetia illucens" Insects 14, no. 3: 300. https://doi.org/10.3390/insects14030300

APA Style

Peng, X., Liu, J., Li, B., Wang, S., Chen, B., & Zhang, D. (2023). An Acyl Carrier Protein Gene Affects Fatty Acid Synthesis and Growth of Hermetia illucens. Insects, 14(3), 300. https://doi.org/10.3390/insects14030300

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop