Colletotrichum truncatum—A New Etiological Anthracnose Agent of Sword Bean (Canavalia gladiata) in Southwestern China

Abstract

Anthracnose is a disease caused by Colletotrichum species. They are well known as major plant pathogens, and a black stem disease, specifically caused by Colletotrichum truncatum and primarily infecting sword bean (Canavalia gladiata), was observed in the Yunnan province, China. To aid disease management and to determine pathogenic characteristics, the species causing the leaf spot disease of hairy vetch was verified as C. truncatum. A sequence analysis of the ITS, ACT, GAPDH, and HIS3 genes was conducted, as well as morphological and cultural characteristics, to identify this Colletotrichum species, which has curved conidia. C. truncatum isolates from sword bean formed a distinctive group among Colletotrichum species, including those that infect other forage and field crops. Artificially inoculated sword bean seedlings showed typical symptoms of anthracnose, which were similar to field observations. To the best of our knowledge, this is the first report of C. truncatum causing black stem disease on sword beans in China.

1. Introduction

Sword bean (Canavalia gladiata) is an important annual legume consumed as a vegetable and as a medicine, and is endemic to tropical Asia, Africa, and India [1,2]. It is currently cultivated across 0.065 million hectares in southwestern China [3,4]. All parts of the sword bean are edible, such as the beans, leaves, pods, or roots [5]. Immature sword bean pods are extensively utilized in Asia as a vegetable [6]. It is widely cultivated across the world, but especially so in central and southern China, where it is an important food supply [4]. It can increase soil nutrient levels, improve soil structure, and reduce soil erosion [7]. Sword bean is the third most important medicinal and food crop in southwestern China.

The fungal pathogen Colletotrichum causes anthracnose on legume crops globally [8,9,10]. The genus Colletotrichum includes about 600 species that can destroy many crops [11], and cause typical symptoms such as sunken necrotic lesions, generally known as anthracnose [12]. Anthracnose is an important disease of sword bean, and Colletotrichum capsica and Colletotrichum lindemuthianum have specifically been detected in sword beans in India and China [13,14].

Colletotrichum truncatum is a species commonly reported to cause disease in papaya, lentils, and soybeans [15,16,17,18]. No previous studies have reported any fungi associated with anthracnose disease on sword beans. Therefore, this study aimed to identify the causal agent of anthracnose disease in sword beans by investigating its morphological and molecular properties, as well as to test its pathogenicity.

2. Materials and Methods

2.1. Plant Collection and Fungal Isolation

A total of fifteen diseased stems from five plants (three stems per plant) were excised from the margins of lesions. Stem pieces were sterilized with 75% ethanol for 30 s and 1% NaClO for 75 s, rinsed three times with sterile distilled water, dried three times between sterile filter paper, and plated onto potato dextrose agar (PDA) supplemented with 25 mg/L of penicillin and streptomycin, and incubated at 24 °C for 3 to 21 days [19]. The isolation frequency for each tissue type was determined by examining colony characteristics on the fourth day. Pure colonies were obtained by transferring 1–2 mm emerging hyphal tips onto fresh PDA plates with no supplements. A diseased specimen, as well as three isolates, was deposited at the Mycological Herbarium of the Lanzhou University (MHLZU) with the numbers MHLZU19328, and YN1932501, YN1932502, YN1932503, and YN1932504, respectively.

2.2. Morphological Characterization

Mycelial plugs (5 mm in diameter) were removed from subcultured hyphae colony edges and dark-incubated at 25 °C on PDA. The PDA colony characteristics were recorded after 10 days, and acervuli, setae, and conidia were observed using a stereomicroscope (Nikon ECLIPSE Ti, Tokyo, Japan) and regular microscope and photographed with a Canon DS126391 camera (Canon, Lanzhou, China). Colony diameters and colors were recorded from PDA-grown cultures.

2.3. DNA Extraction, Polymerase Chain Reaction (PCR) Amplification, and Sequencing

Pure culture mycelia were scraped into centrifuge tubes using a sterilized spoon. Total genomic DNA was extracted from representative isolates using a Fungal DNA Kit (D3195; OMEGA Biotech Co. Ltd., Norcross, GA, USA) following the manufacturer’s instructions. DNA samples were stored at −20 °C for further study. The rDNA internal transcribed spacer (ITS), a partial actin sequence (ACT), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and histone3 (HIS3) genes were amplified (PCR amplification and sequencing primers are given in

Table 1. Primers used in this study for PCR and sequencing.

Gene	Product	Primer	Direction	Sequence (5′–3′)	Reference
ITS	Internal transcribed spacer	ITS1	Forward	TCCGTAGGTGAACCTGCGG	[21,22]
		ITS4	Reverse	TCCTCCGCTTATTGATATGC
ACT	Actin	ACT-512F	Forward	ATGTGCAAGGCCGGTTTCGC	[23]
		ACT-783R	Reverse	TACGAGTCCTTCTGGCCCAT
GAPDH	Glyceraldehyde- 3-phosphate dehydrogenase	GDF1	Forward	GCCGTCAACGACCCCTTCATTG	[24]
		GDR1	Reverse	GGGTGGAGTCGTACTTGAGCAT
HIS3	Chitin synthase I	CYLH3F	Forward	AGGTCCACTGGTGGCAAG	[25]
		CYLH3R	Reverse	AGCTGGATGTCCTTGGACTG

). PCR reactions were performed in a 2720 Thermal Cycler (Applied Biosystems, Foster City, CA, USA) in a total volume of 25μLthat contained 1 μL of genomic DNA, 1 μL of forward and reverse primers, 12.5 μL of 2 x High-Fidelity Master Mix, and 9.5 μL of ddH₂O. The PCR conditions were as follows: an initial denaturation step was performed at 94 °C for 3 min, followed by 30 cycles at 94 °C for 10 s, then 30 s of annealing (54 °C, 56 °C, 46 °C, 56 °C, and 52 °C for ITS, ACT, GAPDH, and HIS3, respectively), and 72 °C for 10 s. A final extension step was performed at 72 °C for 10 min [20].

2.4. Phylogenetic Analysis

The sequences obtained from the four isolates, as well as other Colletotrichum spp. reference sequences as described by Damm [26], were downloaded from GenBank (

Table 2. Collection details and GenBank accession numbers of isolates.

Species	Cultural Number	Host	Country	GenBank Accessions
				ITS	ACT	gapdh	His3	Reference
C. anthrisci	CBS 125334	Anthriscus sylvestris	The Netherlands	GU227845	GU227943	GU228237	GU228041	[27]
	CBS 125335	Anthriscus sylvestris	The Netherlands	GU227846	GU227944	GU228238	GU228042	[27]
C. chlorophyti	IMI 103806	Chlorophytum	India	GU227894	GU227992	GU228286	GU228090	[28]
	CBS 142.79	Stylosanthes hamata	Australia	GU227895	GU227993	GU228287	GU228091	[27]
C. circinans	CBS 111.21	Allium cepa	USA	GU227854	GU227952	GU228246	GU228050	[26]
	CBS 221.81	Allium cepa	Serbia	GU227855	GU227953	GU228247	GU228051	[27]
C. dematium	CBS 125.25	Eryngium campestre	France	GU227819	GU227917	GU228211	GU228015	[26]
	CBS 125340	Apiaceae	Czech	GU227820	GU227918	GU228212	GU228016	[27]
C. fructi	CBS 346.37	Malus sylvestris	USA	GU227844	GU227942	GU228236	GU228040	[26]
C. lilii	CBS 109214	Lilium	Japan	GU227810	GU227908	GU228202	GU228006	[26]
C. lineola	CBS 125337	Apiaceae	Czech	GU227829	GU227927	GU228221	GU228025	[27]
	CBS 125339	Apiaceae	Czech	GU227830	GU227928	GU228222	GU228026	[27]
C. liriopes	CBS 119444	Lirope muscari	Mexico	GU227804	GU227902	GU228196	GU228000	[28]
	CBS 122747	Liriope muscari	Mexico	GU227805	GU227903	GU228197	GU228001	[26]
C. phaseolorum	CBS 157.36	Phaseolus radiatus	Japan	GU227896	GU227994	GU228288	GU228092	[26]
	CBS 158.36	Vigna sinensis	Japan	GU227897	GU227995	GU228289	GU228093	[26]
C. rusci	CBS 119206	Ruscus	Italy	GU227818	GU227916	GU228210	GU228014	[28]
C. spaethianum	CBS 167.49	Hosta sieboldiana	Germany	GU227807	GU227905	GU228199	GU228003	[27]
	CBS 100063	Lilium	South Korea	GU227808	GU227906	GU228200	GU228004	[27]
C. spinaciae	CBS 128.57	Spinacia oleracea	The Netherlands	GU227847	GU227945	GU228239	GU228043	[26]
	CBS 108.40	Spinacia oleracea	The Netherlands	GU227848	GU227946	GU228240	GU228044	[26]
C. tofieldiae	CBS 495.85	Tofieldia calyculata	Switzerland	GU227801	GU227899	GU228193	GU227997	[29]
	CBS 168.49	Lupinus polyphyllus	Germany	GU227802	GU227900	GU228194	GU227998	[27]
C. trichellum	CBS 118198	Hedera	Guatemala	GU227813	GU227911	GU228205	GU228009	[26]
	CBS 448.90	Hedera helix	Germany	GU227814	GU227912	GU228206	GU228010	[26]
C. truncatum	CBS 151.35	Phaseolus lunatus	USA	GU227862	GU227960	GU228254	GU228058	[26]
	CBS 119189	Phaseolus lunatus	USA	GU227863	GU227961	GU228255	GU228059	[26]
	CBS 710.70	Phaseolus vulgaris	Brazil	GU227864	GU227962	GU228256	GU228060	[26]
	YN1932501	Camavalia brasiliensis	China	OP616009	OP649740	OP649744	OP649748	This study
	YN1932502	Camavalia brasiliensis	China	OP616010	OP649741	OP649745	OP649749	This study
	YN1932503	Camavalia brasiliensis	China	OP616011	OP649742	OP649746	OP649750	This study
	YN1932504	Camavalia brasiliensis	China	OP616012	OP649743	OP649747	OP649751	This study
C. lindemuthianum (outgroup)	CBS 151.28	Phaseolus vulgaris	UK	GU227800	GU227898	GU228192	GU227996	[26]

).

Single sequences were aligned using ClustalW in MEGA 5.1. The four loci were combined with Sequence Matrix 1.8. The best-fit nucleotide substitution models of each gene were assessed by MrModeltest 2.3 for Bayesian reference (BI) analysis. The best-fit model of each gene was imported into MrBayes v. 3.2.6, and the full dataset was run for 2,000,000 generations, and sampled every 100 generations and four chains. The resulting tree was created in Figtree v1.4.3, Adobe Acrobat DC (Adobe, San Jose, CA, USA), and Microsoft Office PowerPoint 2007 (Microsoft, Redmond, CA, USA).

2.5. Pathogenicity Assay

The pathogenicity of C. truncatum was determined by a spray treatment. A total of 100 sword bean seeds were obtained from sword bean plants during the 2020 harvest season, surface-sterilized with 75% ethanol for 30 s and 1% NaClO for 75 s, rinsed three times with sterile distilled water, and transferred into sterilized Petri dishes that contained a double filter paper layer. A total of 5 mL sterile distilled water was added to the seeds, whereafter they were incubated in the dark at 25 °C for 7 days. The fungal strains were cultivated in the dark at 25 °C for 14 days, and the colony surfaces were gently scraped with a glass spreader. The conidial suspension was adjusted to a concentration of 1.0 × 10⁶ conidia/mL sterile water using a hemocytometer. Fifty sword bean plants were transferred into 10 pots (with five plants per pot) that contained 500 g of sterilized soil. The stems of 50 healthy plants were sprayed with a conidial suspension that contained 1.0 × 10⁶ conidia/mL and 0.01% Tween 80. A total of 50 healthy plants were used as controls and received a sterile water spray. All plants were kept in a greenhouse (days: 22 °C, 18 h light; nights: 18 °C, 6 h dark) and were covered with clear polyethylene bags for three days to maintain a high humidity level.

3. Results

3.1. Symptoms and Fungal Isolation

Severe anthracnose disease symptoms were observed on sword bean plants from 2020 to 2021 between November and December in Yuanmou County (N 25°84′92″, E 101°83′37″), Yunnan Province. Approximately 60% of the stems were infected. Leaf lesions initially appeared on older leaf blade edges, and presented as the round, or nearly round, black spots marked with a red arrow (Figure 1b). Lesions eventually covered entire blades, and brown necrotic spots with a darker border developed on petioles, which had slightly sunken centers. The initial symptoms were characterized by small, chlorotic spots that appeared on the lower stems; stem lesions were spindle-to-fusiform shaped, and brown to dark brown in the middle of the lesions marked with a red arrow (Figure 1a). Finally, the affected stems eventually turned brown, and sunken, brown necrotic spots covered entire stems. Setae were produced from stem pieces on PDA when the humidity reached 100% (Figure 1c). Three isolates were obtained from symptomatic samples, and the average separation rate was 36.27%.

3.2. Morphological Characterization

The PDA plate adaxial fungal colony surfaces were whitish-brown at 7 days and 55–63 mm in diameter, whereafter they became gray to pale gray with sparse white aerial surfaces, whereas the reverse sides were an ash-black color. The PDA colonies subsequently turned black with a flocculous mycelium (Figure 2a,b). Acervuli were produced on the PDA at 13 days and were 124–165 mm in diameter (Figure 2c). Setae were linear and growing on spherical acervuli, were dark brown to black, rigid and straight at their bases, and with rounded tips being 52~54 μm long × 1.8~2.1 μm wide (n = 50). Conidia were crescent-shaped, hyaline, smooth-walled, aseptate, and slightly curved with parallel walls, and were 1.9~2.7 × 10.8~15.9 μm in size (Figure 2d).

3.3. Phylogenetic Analysis

The ITS, ACT, GAPDH, and HIS3 gene sequences were obtained from GenBank. Four representative strains were aligned in MEGA 5.1 for phylogenetic analysis. C. lindemuthianum (CBS 315.28) was used as an outgroup. The sequence contained 1449 characters after sequence alignment (429 for ITS, 358 for ACT, 270 for GAPDH, 392 for HIS3). The following models were selected by MrModeltest 2.3 for the MrBayes analysis: GTR+G for ITS, GTR+G for ACT, GTR+I+G for GAPDH, and GTR+G for HIS3. The combined multigene tree (Figure 3), including ITS, ACT, GAPDH, and HIS3, showed that the YN1932501, YN1932502, YN1932503, and YN1932504 isolates from this study formed a clade with the representative strains of C. truncatum (CBS119189, CBS151.35, and CBS710.70). The corresponding Bayesian posterior probability was 1.0, and the clade was clearly distinct from the other Colletotrichum species (Figure 3).

3.4. Pathogenicity

To confirm Koch’s postulates, four representative isolates were tested on sword bean stems. Inoculations with YN1932501, YN1932502, YN1932503, and YN1932504 (identified as C. truncatum) exhibited spindle to fusiform lesions marked with a red arrow (Figure 4), whereas no symptoms appeared on the control plants. C. truncatum was re-isolated from the inoculated plants and identified by morphology as described above.

4. Discussion

In this study, sword bean was described as a new host for C. truncatum in the Yunnan Province, China. Sunken necrotic lesions were typical symptoms observed on sword bean stems in the field. Koch’s postulates were satisfied since this fungus was (1) isolated from diseased sword bean plants, (2) the successfully inoculated sword bean plants produced the same symptoms, and (3) the fungus was subsequently re-isolated. A combined analysis of the morphological characteristics and multiple gene sequence data further confirmed that all four Colletotrichum isolates were C. truncatum.

Sword bean anthracnose symptoms caused by C. truncatum, as observed in the field, were similar to those caused by C. lentis. The stem lesions were initially dark and linear, but later enlarged and often coalesced with adjacent lesions until large stem areas were involved [20]. However, C. truncatum anthracnose seemed to cause more and more severe lesions on stems than on leaf laminas, whereas C. lentis caused severe lesions on both stems and leaves. Four other plant species grew in the vicinity, namely Canavalia gladiata, Brachiaria eruciformis, Indigofera amblyantha, and Stylosanthes guianensis, and previous studies have reported that C. truncatum can infect Indigofera plants. It is possible that the infection source for C. truncatum on sword bean might be closely related to the presence of Indigofera amblyantha plants, but this must be verified. Furthermore, the climatic conditions of the area, as well as field planting patterns, may also play a role.

Identification based on morphology is a primary step towards classifying fungal pathogens at the genus level [30]. Corda described the genus Colletotrichum in 1831, which was historically based on morphological characteristics such as fusiformed, curved, hyaline conidia with acute ends, and brown, opaque, subulate setae with acute tips [31]. The morphology of C. truncatum found in this study was similar to that of previous reports [26]. However, Colletotrichum species identification based only on morphology is not highly accurate since few morphological characters can distinguish between the species, and the teleomorphic stages are rarely formed [32]. Moreover, morphological species characteristics can change when environmental conditions change, particularly the small morphological differences among C. destructivum, C. linicola, and C. truncatum [33]. The combination of molecular diagnostic tools, along with morphological techniques, is therefore the best approach for studying Colletotrichum species complexes [34].

Doyle and Gaut [35] described that single genes are usually insufficient to resolve interspecific relationships in Colletotrichum, which is why phylogram trees derived from single genes always yield limited information at lower taxonomic ranks. Using single-gene ITS cannot clearly distinguish between C. lentis and C. truncatum [29]. Previous studies have indicated that using a combined dataset analysis of datasets to generate multigene phylogenetic trees could provide a higher overall support than any of the single-locus phylogenies [36,37]. In this study, phylogenetic analyses based on the combination of ITS, ACT, HIS3, and GAPDH sequences clearly distinguished C. truncatum (YN1932501, YN1932502, YN1932503, and YN1932504) from the other closely related Colletotrichum species.

C. truncatum has a broad host range and can reportedly infect numerous plant species, such as Chinese flowering cabbage, soybean, lentil, common vetch, alfalfa, chili, solanaceous crops, and hemp plants [17,29,38,39,40]. To the best of our knowledge, no previous record exists of C. truncatum causing disease in sword bean. This is, therefore, the first report of sword bean anthracnose caused by C. truncatum.

5. Conclusions

Anthracnose disease in sword bean plants, caused by C. truncatum, was first described in China. The fungi was isolated from infected plants and identified based on the morphological characteristics and molecular properties of multiple DNA sequences. A pathogenicity test revealed similar symptoms in a greenhouse. This is the first report of C. truncatum causing anthracnose in sword bean in China. The accurate identification of C. truncatum is important for developing efficient control strategies to better understand the epidemiology of this disease. In fact, breeding for resistance against anthracnose depends on it. Further disease management studies are needed to select efficient fungicides for controlling sword bean anthracnose.