Genetic Diversity, Virulence Factors and Antibiotic Resistance of Listeria monocytogenes from Food and Clinical Samples in Southern Poland
Abstract
:1. Introduction
2. Materials and Methods
2.1. Clinical Strains
2.2. Food-Based Strains
2.3. Microbiological Culture
2.4. Species Identification
2.5. Antimicrobial Susceptibility Testing
2.6. DNA Isolation
2.7. Molecular Serotyping
2.8. Detection of Virulence Genes
2.9. Pulsed-Field Gel Electrophoresis (PFGE) Typing
3. Results
3.1. Patient Profile and Characteristics of Clinical Listeria monocytogenes Strains
3.2. Listeria from Food Products
3.3. Antimicrobial Susceptibility Testing, Molecular Serotyping, and Detection of Virulence Genes in Listeria monocytogenes Strains
4. Discussion
Limitation
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Allerberger, F. Listeria: Growth, phenotypic differentiation and molecular microbiology. FEMS Immunol. Med. Microbiol. 2003, 35, 183–189. [Google Scholar] [CrossRef]
- Buchanan, R.L.; Gorris, L.G.M.; Hayman, M.M.; Jackson, T.C.; Whiting, R.C. A review of Listeria monocytogenes: An update on outbreaks, virulence, dose-response, ecology, and risk assessments. Food Control 2017, 75, 1–13. [Google Scholar] [CrossRef]
- World Health Organization. Fact-Sheets: Listeriosis. Available online: https://www.who.int/news-room/fact-sheets/detail/listeriosis (accessed on 10 July 2024).
- Lorber, B. Comment on: Predictors of mortality and impact of aminoglycosides on outcome in listeriosis in a retrospective cohort study. J. Antimicrob. Cheth. 2010, 65, 810. [Google Scholar] [CrossRef] [PubMed]
- Żurawik, A.; Szczesiul-Paszkiewicz, P.; Chmielarczyk, A. Invasive listeriosis in Europe—A case review. Adv. Microbiol. 2024, 63, 43–59. [Google Scholar] [CrossRef]
- Ramaswamy, V.; Cresence, V.M.; Rejitha, J.S.; Lekshmi, M.U.; Dharsana, K.S.; Prasad, S.P.; Villa, H.M. Listeria—Review of epidemiology and pathogenesis. J. Microbiol. Immunol. Infect. 2007, 40, 4–13. [Google Scholar]
- European Food Safety Authority (EFSA); European Centre for Disease Prevention and Control (ECDC). The European Union One Health 2022 Zoonoses Report. EFSA J. 2023, 21, e8442. [Google Scholar]
- European Centre for Disease Prevention and Control (ECDC). Listeriosis. In: ECDC. Annual Epidemiological Report for 2022. Stockholm: ECDC. 2024. Available online: https://www.ecdc.europa.eu/en/publications-data/listeriosis-annual-epidemiological-report-2022 (accessed on 10 July 2024).
- Analysis Infectious Diseases and Poisonings in Poland (Annual Report). National Institute of Public Health NIH- National Research Institute Department of Epidemiology and Surveillance of Infectious Diseases. 2023. Available online: https://wwwold.pzh.gov.pl/oldpage/epimeld/2023/Ch_2023.pdf (accessed on 10 July 2024).
- Olaimat, A.N.; Al-Holy, M.A.; Shahbaz, H.M.; Al-Nabusli, A.A.; Abu Goush, M.H.; Osaili, T.M.; Ayyash, M.M.; Holley, R.A. Emergence of antibiotic resistance in Listeria monocytogenes isolated from food products: A comprehensive review. Comprehen. Rev. Food Sci. Food Saf. 2018, 17, 1277–1292. [Google Scholar] [CrossRef] [PubMed]
- Luque-Sastre, L.; Arroyo, C.; Fox, E.M.; McMahon, B.J.; Bai, L.; Li, F.; Fanning, S. Antimicrobial Resistance in Listeria Species. Microbiol. Spectr. 2018, 6, 237–259. [Google Scholar] [CrossRef]
- Baquero, F.; Lanza, V.F.; Duval, M.; Coque, T.M. Ecogenetics of antibiotic resistance in Listeria monocytogenes. Mol. Microbiol. 2020, 113, 570–579. [Google Scholar] [CrossRef]
- Skowron, K.; Wałecka-Zacharska, E.; Wiktorczyk-Kapischke, N.; Skowron, K.J.; Grudlewska-Buda, K.; Bauza-Kaszewska, J.; Bernaciak, Z.; Borkowski, M.; Gospodarek-Komkowska, E. Assessment of the Prevalence and Drug Susceptibility of Listeria monocytogenes Strains Isolated from Various Types of Meat. Foods 2020, 9, 1293. [Google Scholar] [CrossRef]
- Zakrzewski, A.J.; Gajewska, J.; Chajęcka-Wierzchowska, W.; Załuski, D.; Zadernowska, A. Prevalence of Listeria monocytogenes and Other Listeria Species in Fish, Fish Products and Fish Processing Environment: A Systematic Review and Meta-Analysis. Sci. Total Environ. 2024, 907, 167912. [Google Scholar] [CrossRef]
- Maćkiw, E.; Korsak, D.; Kowalska, J.; Felix, B.; Stasiak, M.; Kucharek, K.; Postupolski, J. Incidence and genetic variability of Listeria monocytogenes isolated from vegetables in Poland. Int. J. Food Microbiol. 2021, 339, 109023. [Google Scholar] [CrossRef]
- Maćkiw, E.; Stasiak, M.; Kowalska, J.; Kucharek, K.; Korsak, D.; Postupolski, J. Occurrence and Characteristics of Listeria monocytogenes in Ready-to-Eat Meat Products in Poland. J. Food Prot. 2020, 83, 1002–1009. [Google Scholar] [CrossRef]
- Speich, C.; Stephan, R.; Dhima, N.; Hollenstein, F.; Horlbog, J.; Delvento, G.; Altpeter, E.; Zuske, M.; Raess, M.; Greter, H. Rapid detection of the source of a Listeria monocytogenes outbreak in Switzerland through routine interviewing of patients and whole-genome sequencing. Swiss Med. Wkly. 2024, 154, 3745. [Google Scholar] [CrossRef]
- Amarasekara, N.R.; Swamy, A.S.; Paudel, S.K.; Jiang, W.; Li, K.; Shen, C.; Zhang, Y. Hypervirulent clonal complex (CC) of Listeria monocytogenes in fresh produce from urban communities. Front. Microbiol. 2024, 15, 1307610. [Google Scholar] [CrossRef]
- Paduro, C.; Montero, D.A.; Chamorro, N.; Carreño, L.J.; Vidal, M.; Vidal, R. Ten years of molecular epidemiology surveillance of Listeria monocytogenes in Chile 2008–2017. Food Microbiol. 2020, 85, 103280. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, F.T.; Vieira, B.S.; Vallim, D.C.; Carvalho, L.A.; Carvalho, R.C.T.; Pereira, R.C.L.; Figueiredo, E.E.S. Genetic similarity, antibiotic resistance and disinfectant susceptibility of Listeria monocytogenes isolated from chicken meat and chicken-meat processing environment in Mato Grosso, Brazil. LWT 2019, 109, 77–82. [Google Scholar] [CrossRef]
- Kuch, A.; Goc, A.; Belkiewicz, K.; Filipello, V.; Ronkiewicz, P.; Golebiewska, A.; Wrobel, I.; Kiedrowska, M.; Wasko, I.; Hryniewicz, W.; et al. Molecular diversity and antimicrobial susceptibility of Listeria monocytogenes isolates from invasive infections in Poland (1997–2013). Sci. Rep. 2018, 8, 14562. [Google Scholar] [CrossRef]
- Liu, D.; Lawrence, M.L.; Austin, F.W.; Ainsworth, A.J. A multiplex PCR for species-and virulence-specific determination of Listeria monocytogenes. J. Microbiol. Methods 2007, 71, 133–140. [Google Scholar] [CrossRef] [PubMed]
- Orsi, R.H.; Bakker, H.C.; de Wiedmann, M. Listeria monocytogenes lineages: Genomics, evolution, ecology, and phenotypic characteristics. Int. J. Med. Microbiol. 2011, 301, 79–96. [Google Scholar] [CrossRef] [PubMed]
- Osek, J.; Wieczorek, K. Listeria monocytogenes—How This Pathogen Uses Its Virulence Mechanisms to Infect the Hosts. Pathogens 2022, 11, 1491. [Google Scholar] [CrossRef] [PubMed]
- Anwar, T.M.; Pan, H.; Chai, W.; Ed-Dra, A.; Fang, W.; Li, Y.; Yue, M. Genetic Diversity, Virulence Factors, and Antimicrobial Resistance of Listeria monocytogenes from Food, Livestock, and Clinical Samples between 2002 and 2019 in China. Int. J. Food Microbiol. 2022, 366, 109572. [Google Scholar] [CrossRef] [PubMed]
- Bonazzi, M.; Lecuit, M.; Cossart, P. Listeria monocytogenes internalin and E-cadherin: From structure to pathogenesis. Cell. Microbiol. 2009, 11, 693–702. [Google Scholar] [CrossRef] [PubMed]
- Kanki, M.; Naruse, H.; Kawatsu, K. Comparison of listeriolysin O and phospholipases PlcA and PlcB activities, and initial intracellular growth capability among food and clinical strains of Listeria monocytogenes. J. Appl. Microbiol. 2018, 124, 899–909. [Google Scholar] [CrossRef]
- Quereda, J.J.; Andersson, C.; Cossart, P.; Johansson, J.; Pizarro-Cerda, J. Role in Virulence of Phospholipases, Listeriolysin O and Listeriolysin S from Epidemic Listeria monocytogenes using the Chicken Embryo Infection Model. Vet. Res. 2018, 49, 13. [Google Scholar] [CrossRef]
- Gray, J.A.; Chandry, P.S.; Kaur, M.; Kocharunchitt, C.; Bowman, J.P.; Fox, E.M. Characterization of Listeria monocytogenes food-associated isolates to assess environmental fitness and virulence potential. Int. J. Food Microbiol. 2021, 350, 109247. [Google Scholar] [CrossRef]
- PN-EN ISO 11290−1:2017-07; Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Detection and Enumeration of Listeria monocytogenes and Others Listeria spp.—Part 1: Detection Method. ISO: Geneva, Switzerland, 2017. Available online: https://www.iso.org/standard/60313.html (accessed on 4 April 2023).
- The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 14.0. 2024. Available online: http://www.eucast.org (accessed on 10 July 2024).
- The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 10.0. 2020. Available online: http://www.eucast.org (accessed on 10 July 2024).
- Doumith, M.; Buchrieser, C.; Glasser, P.; Jacquet, C.; Martin, P. Differentiation of the Major Listeria monocytogenes Serovars by Multiplex PCR. J. Clin. Microbiol. 2004, 42, 3819–3822. [Google Scholar] [CrossRef]
- D’agostino, M.; Wagner, M.; Vazquez-Boland, J.A.; Kuchta, T.; Karpiskova, R.; Hoorfar, J.; Novella, S.; Scortti, M.; Ellison, J.; Murray, A.; et al. A Validated PCR-Based Method to Detect Listeria monocytogenes Using Raw Milk as a Food Model—Towards an International Standard. J. Food Prot. 2004, 67, 1646–1655. [Google Scholar] [CrossRef]
- Liu, D.; Ainsworth, A.J.; Austin, F.W.; Lawrence, M.L. Characterization of virulent and avirulent Listeria monocytogenes strains by PCR amplification of putative transcriptional regulator and internalin genes. J. Med. Microbiol. 2003, 52, 1066–1070. [Google Scholar] [CrossRef]
- Montero, D.; Bodero, M.; Riveros, G.; Lapierre, L.; Gaggero, A.; Vidal, R.M.; Vidal, M. Molecular epidemiology and genetic diversity of Listeria monocytogenes isolates from a wide variety of ready-to-eat foods and their relationship to clinical strains from listeriosis outbreaks in Chile. Front. Microbiol. 2015, 6, 384. [Google Scholar] [CrossRef]
- Zhang, W.; Jayarao, B.M.; Knabel, S.J. Multi-virulence-locus sequence typing of Listeria monocytogenes. Appl. Environ. Microbiol. 2004, 70, 913–920. [Google Scholar] [CrossRef] [PubMed]
- Roussel, S.; Michelon, D.; Lombard, B.; Lailler, R. Molecular typing of Listeria monocytogenes strains isolated from food, feed and animals: State of play and standard operating procedures for pulsed field gel electrophoresis (PFGE) typing, profile interpretation and curation. EFSA Supp. Pub. 2014, 11, 702E. [Google Scholar] [CrossRef]
- Księżak, E.; Sadkowska-Todys, M. Listeriosis in Poland in 2012–2021. Epidemiolog. Rev. 2023, 77, 531–543. [Google Scholar] [CrossRef] [PubMed]
- EFSA Panel on Biological Hazards (BIOHAZ); Koutsoumanis, K.; Allende, A.; Bolton, D.; Bover-Cid, S.; Chemaly, M.; Herman, L.; Hilbert, F.; Lindqvist, R.; Nauta, M.; et al. Evaluation of alternative methods of tunnel composting (submitted by the European Composting Network) II. EFSA J. 2024, 22, e8745. [Google Scholar]
- Hof, H. An update on the medical management of listeriosis. Expert. Opin. Pharmacother. 2004, 5, 1727–1735. [Google Scholar] [CrossRef]
- Benes, J.; Viechova, J.; Kabelkova, M.; Horova, B. Listerial endocarditis in a penicillin-allergic woman successfully treated with a combination of 4 drugs. Scand. J. Infect. Dis. 2002, 34, 383–384. [Google Scholar] [CrossRef]
- Lachtara, B.; Wieczorek, K.; Osek, J. Antimicrobial resistance of Listeria monocytogenes serogroups IIa and IVb from food and food-production environments in Poland. J. Vet. Res. 2023, 67, 373–379. [Google Scholar] [CrossRef]
- Wiśniewski, P.; Zakrzewski, A.J.; Zadernowska, A.; Chajęcka-Wierzchowska, W. Antimicrobial Resistance and Virulence Characterization of Listeria monocytogenes Strains Isolated from Food and Food Processing Environments. Pathogens 2022, 11, 1099. [Google Scholar] [CrossRef]
- Maćkiw, E.; Korsak, D.; Kowalska, J.; Felix, B.; Stasiak, M.; Kucharek, K.; Antoszewska, A.; Postupolski, J. Genetic Diversity of Listeria monocytogenes Isolated from Ready-to-Eat Food Products in Retail in Poland. Int. J. Food Microbiol. 2021, 358, 109397. [Google Scholar] [CrossRef]
- Szymczak, B.; Szymczak, M.; Trafiałek, J. Prevalence of Listeria species and L. monocytogenes in ready-to-eat foods in the West Pomeranian region of Poland: Correlations between the contamination level, serogroups, ingredients, and producers. Food Microbiol. 2020, 91, 103532. [Google Scholar] [CrossRef]
- Wieczorek, K.; Osek, J. Prevalence, genetic diversity and antimicrobial resistance of Listeria monocytogenes isolated from fresh and smoked fish in Poland. Food Microbiol. 2017, 64, 164–171. [Google Scholar] [CrossRef]
- Disson, O.; Moura, A.; Lecuit, M. Making sense of the biodiversity and virulence of Listeria monocytogenes. Trends Microbiol. 2021, 29, 811–822. [Google Scholar] [CrossRef]
- Wiktorczyk-Kapischke, N.; Skowron, K.; Wałecka-Zacharska, E. Genomic and pathogenicity islands of Listeria monocytogenes—Overview of selected aspects. Front. Mol. Biosci. 2023, 10, 1161486. [Google Scholar] [CrossRef]
- Kurpas, M.; Osek, J.; Moura, A.; Leclercq, A.; Lecuit, M.; Wieczorek, K. Genomic characterization of Listeria monocytogenes isolated from ready-to-eat meat and meat processing environments in Poland. Front. Microbiol. 2020, 11, 1412. [Google Scholar] [CrossRef]
- Lomonaco, S.; Patti, R.; Knabel, S.J.; Civera, T. Detection of virulence-associated genes and epidemic clone markers in Listeria monocytogenes isolates from PDO Gorgonzola cheese. Int. J. Food Microbiol. 2012, 160, 76–79. [Google Scholar] [CrossRef] [PubMed]
- Guidi, F.; Lorenzetti, C.; Centrorotola, G.; Torresi, M.; Camma, C.; Chiaverini, A.; Pomillio, F.; Blasi, G. Atypical serogroup IVb-v1 of Listeria monocytogenes assigned to new ST 2801 widely spread and persistent in the environment of a pork-meat producing plant of central Italy. Front. Microbiol. 2022, 13, 930895. [Google Scholar] [CrossRef] [PubMed]
- Varsaki, A.; Ortiz, S.; Santorum, P.; López, P.; López-Alonso, V.; Hernández, M.; Abad, D.; Rodríguez-Grande, J.; Ocampo-Sosa, A.A.; Martínez-Suárez, J.V. Prevalence and Population Diversity of Listeria monocytogenes Isolated from Dairy Cattle Farms in the Cantabria Region of Spain. Animals 2022, 12, 2477. [Google Scholar] [CrossRef]
- Gilmartin, N.; Gião, M.S.; Keevil, C.W.; O’Kennedy, R. Differential internalin A levels in biofilms of Listeria monocytogenes grown on different surfaces and nutrient conditions. Int. J. Microbiol. 2016, 219, 50–55. [Google Scholar] [CrossRef] [PubMed]
- Lourenco, A.; de Las Heras, A.; Scortti, M.; Vazquez-Boland, J.; Frank, J.F.; Brito, L. Comparison of Listeria monocytogenes exoproteomes from biofilm and planktonic state: Lmo2504, a protein associated with biofilms. Appl. Environ. Microbiol. 2013, 79, 6075–6082. [Google Scholar] [CrossRef]
- Mata, M.M.; da Silva, W.P.; Wilson, R.; Lowe, E.; Bowman, J.P. Attached and planktonic Listeria monocytogenes global proteomic responses and associated influence of strain genetics and temperature. J. Prot. Res. 2015, 14, 1161–1173. [Google Scholar] [CrossRef]
- Franciosa, G.; Maugliani, A.; Scalfaro, C.; Floridi, F.; Aureli, P. Expression of internalin A and biofilm formation among Listeria monocytogenes clinical isolates. Int. J. Immunopathol. Pharmacol. 2009, 22, 183–193. [Google Scholar] [CrossRef] [PubMed]
- Lemon, K.P.; Freitag, N.E.; Kolter, R. The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes. J. Bacteriol. 2011, 192, 3969–3976. [Google Scholar] [CrossRef] [PubMed]
- European Centre for Disease Prevention and Control (ECDC). Available online: https://www.ecdc.europa.eu/en/listeriosis/threats-and-outbreaks (accessed on 4 July 2024).
- Centers for Disease Control and Prevention (CDC). Available online: https://www.cdc.gov/listeria/outbreaks/index.html (accessed on 4 July 2024).
- LeJeune, J.T.; Zhou, K.; Kopko, C.; Igarashi, H. FAO/WHO Joint Expert Meeting on Microbiological Risk Assessment (JEMRA): Twenty Years of International Microbiological Risk Assessment. Foods 2021, 10, 1873. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Primer Sequences 5′–3′ | Product Size | Serovar Specificity | Protein Encoded by the Target Gene | Reference |
---|---|---|---|---|---|
lmo0737 | F–AGGGCTTCAAGGACTTACCC R–ACGATTTCTGCTTGCCATTC | 691 bp | L. monocytogenes serovars 1/2a, 1/2c, 3a, and 3c | hypothetical protein belonging to a member of TIM phosphate binding superfamily | [33] |
lmo1118 | F–AGGGGTCTTAAATCCTGGAA R–CGGCTTGTTCGGCATACTTA | 906 bp | L. monocytogenes serovars 1/2c and 3c | domain-containing protein | [33] |
ORF2819 | F–AGCAAAATGCCAAAACTCGT R–CATCACTAAAGCCTCCCATTG | 471 bp | L. monocytogenes serovars 1/2b, 3b, 4b, 4d, and 4e | putative transcriptional regulator | [33] |
ORF2110 | F–AGTGGACAATTGATTGGTGAA R–CATCCATCCCTTACTTTGGAC | 597 bp | L. monocytogenes serovars 4b, 4d, and 4e | putative secreted protein | [33] |
prs | F–GCTGAAGAGATTGCGAAAGAAG R–CAAAGAAACCTTGGATTTGCGG | 370 bp | All Listeria species | putative phosphoribosyl pyrophosphate synthetase | [33] |
prfA | F–GATACAGAAACATCGGTTGGC R–GTGTAACTTGATGCCATCAGG | 274 bp | All L. monocytogenes strains | central virulence gene regulator | [34] |
Target Gene | Primer Sequences 5′–3′ | Annealing Temperature | Product Size | Protein Encoded by the Target Gene | Reference |
---|---|---|---|---|---|
inlA | F–ACGAGTAACGGGACAAATGC R–CCCGACAGTGGTGCTAGATT | 55 °C | 800 bp | internalin A | [22] |
inlC | F–AATTCCCACAGGACACAACC R–CGGGAATGCAATTTTTCACTA | 55 °C | 517 bp | internalin C | [22] |
inlJ | F–TGTAACCCCGCTTACACAGTT R–AGCGGCTTGGCAGTCTAATA | 55 °C | 238 bp | internalin J | [22] |
llsX | F–TTATTGCATCAATTGTTCTAGGG R–TTATTGCATCAATTGTTCTAGGG | 60 °C | 200 bp | listeriolysin S | [25] |
hlyA | F–GTTAATGAACCTACAAGACCTTCC R–ACCGTTCTCCACCATTCCCA | 60 °C | 707 bp | listeriolysin O | [25] |
lmo2672 | F–CGGCACACTTGGATTCTCAT R–AGGGCTAGTGACGGATGCTA | 58 °C | 481 bp | transcriptional regulator | [35] |
plcA | F–TCCCATTAGGTGGAAAAGCA R–CGGGGAAGTCCATGATTAGA | 50 °C | 840 bp | phosphatidyl inositol phospholipase C | [36] |
plcB | F–CAGCTCCGCATGATATTGAC R–CTGCCAAAGTTTGCTGTGAA | 55 °C | 723 bp | phosphatidyl choline phospho-lipase C | [36] |
prfA | F–AACGGGATAAAACCAAAACCA R–TGCGATGCCACTTGAATATC | 50 °C | 469 bp | transcriptional factor | [37] |
Strain Number | Original Number | Clinical Material | Species Identification According to VITEK MS | Patient Age, Sex | Year of Isolation |
---|---|---|---|---|---|
2 | PB9156 | Cerebrospinal fluid | Listeria monocytogenes | 10, M | 2019 |
3 | 185bak21 | Venous blood | Listeria monocytogenes | 58, M | 2021 |
4 | 50322bak22 | Venous blood | Listeria monocytogenes | 53, F | 2022 |
5 | 26560bak22 | Venous blood | Listeria monocytogenes | 52, F | 2022 |
6 | 67648bak21 | Venous blood | Listeria monocytogenes | 91, F | 2021 |
7 | 53453bak21 | Venous blood | Listeria monocytogenes | 82, F | 2021 |
8 | 66589bak21 | Venous blood | Listeria monocytogenes | 83, F | 2021 |
9 | 30340bak22 | Venous blood | Listeria monocytogenes | 73, M | 2022 |
Strain Number | Original Number | Food Products | Species Identification According to VITEK MS | Year of Isolation |
---|---|---|---|---|
Strains isolated from food products in this study (n = 7) | ||||
6a | This study | Meat dumplings | Listeria monocytogenes | 2023 |
11a | This study | Meat dumplings | Listeria monocytogenes | 2023 |
31a | This study | Smoked salmon | Listeria innocua | 2023 |
38a | This study | Smoked salmon | Listeria innocua | 2023 |
73a | This study | Pielmieni | Listeria innocua | 2023 |
94a | This study | Smoked Atlantic salmon | Listeria monocytogenes | 2023 |
96a | This study | Camembert cheese | Listeria monocytogenes | 2023 |
Strains from NIPH-NIH collection (n = 10) | ||||
11b | 6982C | Smoked Atlantic salmon | Listeria monocytogenes | 2022 |
12b | 7045C | Tatar sausage (raw sausage made from ground meat) | Listeria monocytogenes | 2022 |
13b | 7117 | Frozen potato dumplings | Listeria monocytogenes | 2022 |
14b | 7197 | Meat dumplings | Listeria monocytogenes | 2022 |
15b | 6780 | Smoked salmon trout | Listeria monocytogenes | 2022 |
16b | 6797E | Ham sausages | Listeria monocytogenes | 2022 |
17b | 6556C | Mixed salad | Listeria monocytogenes | 2022 |
18b | 6535 | Onion-flavored tatar sausage | Listeria monocytogenes | 2022 |
19b | 6310 | Potato and cheese dumplings | Listeria monocytogenes | 2022 |
20b | 6317 | Cabbage and carrots mix | Listeria monocytogenes | 2022 |
Strains from IAFB collection (n = 2) | ||||
9b | KKP 3270 | Sushi | Listeria monocytogenes | 2020 |
10b | KKP 3271 | Raw salmon | Listeria monocytogenes | 2020 |
Listeria monocytogenes Strain Number | Phenotypic Antibiotic Resistance Pattern |
---|---|
9b | CIP |
10b | CIP |
11b | TE-CIP |
12b | CIP |
14b | CIP |
16b | CIP |
17b | CIP |
20b | CIP |
Strain Number | Serotype (Molecular Group) | Virulence-Associated Genes | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
prfA | hlyA | plcB | plcA | inlA | inlC | inlJ | lmo2672 | llsX | |||
Clinical strains | 2 | 4ab-4b,4d-4e/(IVb) | |||||||||
3 | 4ab-4b,4d-4e/(IVb) | ||||||||||
4 | 1/2a-3a (IIa) | ||||||||||
5 | 4ab-4b,4d-4e/(IVb) | ||||||||||
6 | 1/2a-3a (IIa) | ||||||||||
7 | 1/2a-3a (IIa) | ||||||||||
8 | 1/2a-3a (IIa) | ||||||||||
9 | 1/2a-3a (IIa) | ||||||||||
Total (%) | 100 | 100 | 100 | 87.5 | 100 | 100 | 100 | 100 | 37.5 | ||
Food strains | 6a | 1/2a-3a (IIa) | |||||||||
11a | 4ab-4b,4d-4e/(IVb) | ||||||||||
94a | 1/2a-3a (IIa) | ||||||||||
96a | 1/2a-3a (IIa) | ||||||||||
9b | 1/2a-3a (IIa) | ||||||||||
10b | 1/2a-3a (IIa) | ||||||||||
11b | 4ab-4b,4d-4e/(IVb) | ||||||||||
12b | 1/2a-3a (IIa) | ||||||||||
13b | 1/2a-3a (IIa) | ||||||||||
14b | 1/2a-3a (IIa) | ||||||||||
15b | 1/2a-3a (IIa) | ||||||||||
16b | 1/2a-3a (IIa) | ||||||||||
17b | 1/2a-3a (IIa) | ||||||||||
18b | 1/2a-3a (IIa) | ||||||||||
19b | 1/2a-3a (IIa) | ||||||||||
20b | 1/2a-3a (IIa) | ||||||||||
Total (%) | 100 | 100 | 100 | 93.75 | 100 | 93.75 | 56.25 | 100 | 18.75 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Żurawik, A.; Kasperski, T.; Olechowska-Jarząb, A.; Szczesiul-Paszkiewicz, P.; Żak, I.; Wójcicki, M.; Maćkiw, E.; Chmielarczyk, A. Genetic Diversity, Virulence Factors and Antibiotic Resistance of Listeria monocytogenes from Food and Clinical Samples in Southern Poland. Pathogens 2024, 13, 725. https://doi.org/10.3390/pathogens13090725
Żurawik A, Kasperski T, Olechowska-Jarząb A, Szczesiul-Paszkiewicz P, Żak I, Wójcicki M, Maćkiw E, Chmielarczyk A. Genetic Diversity, Virulence Factors and Antibiotic Resistance of Listeria monocytogenes from Food and Clinical Samples in Southern Poland. Pathogens. 2024; 13(9):725. https://doi.org/10.3390/pathogens13090725
Chicago/Turabian StyleŻurawik, Anna, Tomasz Kasperski, Aldona Olechowska-Jarząb, Paulina Szczesiul-Paszkiewicz, Iwona Żak, Michał Wójcicki, Elżbieta Maćkiw, and Agnieszka Chmielarczyk. 2024. "Genetic Diversity, Virulence Factors and Antibiotic Resistance of Listeria monocytogenes from Food and Clinical Samples in Southern Poland" Pathogens 13, no. 9: 725. https://doi.org/10.3390/pathogens13090725
APA StyleŻurawik, A., Kasperski, T., Olechowska-Jarząb, A., Szczesiul-Paszkiewicz, P., Żak, I., Wójcicki, M., Maćkiw, E., & Chmielarczyk, A. (2024). Genetic Diversity, Virulence Factors and Antibiotic Resistance of Listeria monocytogenes from Food and Clinical Samples in Southern Poland. Pathogens, 13(9), 725. https://doi.org/10.3390/pathogens13090725