Next Article in Journal
Is Intestinal Microbiota Fully Restored After Chickens Have Recovered from Coccidiosis?
Previous Article in Journal
Antibiotic Susceptibility Patterns and Virulence Profiles of Classical and Hypervirulent Klebsiella pneumoniae Strains Isolated from Clinical Samples in Khyber Pakhtunkhwa, Pakistan
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 14
Issue 1
10.3390/pathogens14010080
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Survey and Identification of Fusarium Head Blight Pathogens of Wheat in the Western Cape Region of South Africa

by
Ali Al-Hashimi
1,
Augustine Innalegwu Daniel
1,2,
Omolola Aina
1,
Morné Du Plessis
3,
Marshall Keyster
4 and
Ashwil Klein
1,*
1
Plant Omics Laboratory, Department of Biotechnology, Faculty of Natural Sciences, University of the Western Cape, Robert Sobukwe Road, Bellville 7535, South Africa
2
Department of Biochemistry, School of Life Sciences, Federal University of Technology, P.M.B 65, Minna 920101, Niger State, Nigeria
3
Genetics Department, University of the Free State, Bloemfontein 9301, South Africa
4
Environmental Biotechnology Laboratory, Department of Biotechnology, Faculty of Natural Sciences, University of the Western Cape, Robert Sobukwe Road, Bellville 7535, South Africa
*
Author to whom correspondence should be addressed.
Pathogens 2025, 14(1), 80; https://doi.org/10.3390/pathogens14010080
Submission received: 17 December 2024 / Revised: 9 January 2025 / Accepted: 14 January 2025 / Published: 16 January 2025
(This article belongs to the Section Fungal Pathogens)
Browse Figures
Versions Notes

Abstract

:
Fusarium head blight (FHB) is a major disease affecting wheat production worldwide, caused by multiple Fusarium species. In this study, seven Fusarium strains were isolated from wheat fields across the Western Cape region of South Africa and identified through phylogenetic analysis. The strains were classified into three species complexes: the Fusarium graminearum species complex (FGSC), Fusarium incarnatum-equiseti species complex (FIESC), and Fusarium tricinctum species complex (FTSC). Disease severity was highest in the South coast regions of Swellendam (42.73%) and Caledon (38.00%), with the dough stage of wheat development showing the highest disease rate (0.3 in Swellendam and Caledon). The phylogenetic analysis showed distinct clustering of these isolates with known species from the NCBI database, confirming their classification. F. ipomoeae was uniquely found in Swellendam and Caledon, while F. tricinctum occurred only in Klipheuwel and Caledon, highlighting geographical variation in species distribution. Mycotoxin profiling revealed that F. culmorum and F. pseudograminearum produced zearalenone, F. culmorum and F. tricinctum produced 15-acetyl-deoxynivalenol (15-ADON), while F. pseudograminearum produced nivalenol (NIV). These findings provide significant insights into the distribution of Fusarium species and their associated trichothecene chemotypes in the Western Cape, which is crucial for developing effective FHB management strategies and ensuring food security and safety.

1. Introduction

Fusarium head blight (FHB), also known as head scab, is a major and devastating fungal disease of wheat (Triticum aestivum) globally [1]. The disease is caused by the Fusarium graminearum species complex (FGSC), the fourth-most scientifically and economically significant fungal phytopathogen worldwide [2]. The disease affects farm output, such as yield and grain quality, resulting in a significant loss of grain due to mycotoxin contamination, which can affect human and animal health [3]. Annually, approximately USD 3 billion is invested annually for the control and management of this disease in the USA, and about 7 million hectares of land has been reported to be severely affected by FHB epidemics in China [1,2]. In South Africa, FHB has been a cause of concern for many years, causing a lot of economic loss both to the farmers and the government [2]. In the late 80s, around KwaZulu-Natal, there was a reported case of a disease incidence of over 70% [2]. Since then, there have been efforts both by the government and individual farmers to control this disease. Nevertheless, these efforts have yet to achieve the desired result because resistant wheat varieties, bio-fungicides, and licensed fungicides are not available [3]. Nonetheless, the genomics age has brought about a great deal of advancement, especially in the areas of identifying resistance genes and quantitative trait loci (QTLs), highlighting resistance mechanisms and molecular breeding for enhanced resistance [4]. Despite these achievement and advancement made over the years, overcoming FHB disease still poses serious challenges since resistance to the Fusarium species is complex [5].
Fusarium species associated with FHB produce mycotoxins, and the most common mycotoxins detected in wheat samples from FHB-infected fields were deoxynivalenol (DON), deoxynivalenol-3-glucoside (D3G), enniatin B (ENN B), enniatin B1 (ENN B1), culmorin, 15-hydroxyculmorin, and aurofusarin [6]. Fusarium graminearum, associated with FHB in small grain crops, has been reported to produce deoxynivalenol (DON) [7]. In a study on winter wheat in Slovakia, Fusarium graminearum, F. avenaceum, F. culmorum, F. ipomoea, and Microdochium nivale were isolated from the ears of wheat infected with FHB, with F. graminearum being the most frequently isolated species [8].
Globally, there are no holistic approaches or measures towards controlling FHB disease. Most studies only aim at various aspects of the disease through identifying the causative agents. For example, studies have shown that various mycotoxins/metabolites associated with FHB such as deoxynivalenol (DON), zearalenone (ZEN), and enniatin (ENN) were identified out of 216 wheat samples that were analyzed [6]. In another study carried out by Powell et al. [9], Sphaerodes mycoparasitica, a specific biocontrol, considerably decreased the occurrence of DON in harvested wheat grains [9]. Qiu et al. [10] described the accurate identification of FHB-infected wheat kernels using Raman spectroscopy and deep learning networks, offering a quick and non-invasive diagnostic technique [10]. Additionally, another study by Matić et al. [11] to investigate the effects of Fusarium inoculation and nitrogen fertilization on the defense response in wheat spikes stressed the potential of breeding wheat varieties with enhanced defense mechanisms against FHB. Lastly, Spanic et al. [12] studied the protein components and antioxidant enzymes implicated in the FHB infection process. This study shows that resistant wheat varieties had lower DON accumulation and higher peroxidase activity.
Rain with high temperature during anthesis and an abundance of primary inoculum are risk factors for the occurrence of FHB in wheat, which affects wheat yield in South Africa [2]. Significant precipitation, lower temperature at night, and increased humidity during flowering are important contributors to elevated infection levels [13]. FHB epidemics, which can result in yield losses of up to 80%, are facilitated by these conditions [14]. When seasonal environmental conditions are favorable, there is a significant increase in the rate of the disease, particularly in regions where conservation tillage is practiced and maize is produced in a double cropping system with wheat [15]. Farmers find it difficult to control the disease because flowering is characterized by unpredictable weather [16,17].
There are several factors that affect FHB in wheat. Various Fusarium species, including F. graminearum, F. culmorum, and F. avenaceum, which have different mycotoxin profiles and geographic adaptations, are the sources of the disease [13,18]. In South Africa, several Fusarium species are responsible for FHB in wheat. For instance, 24 species from seven broad species complexes, including F. sambucinum complexes (FSAMSCs), F. incarnatum-equiseti species complexes (FIESCs), F. chlamydosporum (FCSC), F. fujikuroi (FFSC), F. oxysporum (FOSC), F. solani (FSSC), and F. tricinctum species complexes (FTSCs), were identified during a detailed characterization of FHB pathogens in 2008 and 2009 [1]. FGSC, which accounted for 75.7% of the isolates, was the predominant Fusarium species in each of the four irrigation regions [1]. With 16 Fusarium species from all seven species complexes, the Northern Cape has the highest species diversity [19]. Moreover, F. brachygibbosum, F. asiaticum, F. lunulosporum, and F. transvaalense were identified worldwide, and F. acuminatum, F. armeniacum, F. avenaceum, F. temperatum, and F. pseudograminearum were identified for the first time in South Africa [2,20,21].
Fusarium head blight (FHB) epidemics are influenced by several factors, including weather conditions such as stormy days with warm temperatures during anthesis, which promote the abundance of primary inoculum [22]. The type of organic mulch used can also affect the presence of Fusarium species in the soil prior to wheat flowering and the mycotoxin content in mature grain, with higher mycotoxin levels typically associated with nitrogen-poor treatments [23]. Additionally, the types of wheat cultivars can also influence the severity of FHB, with some showing higher resistance to the disease [24]. While fungicide treatments can reduce the frequency of FHB and mycotoxin concentrations in grain, their effectiveness depends on factors such as the temperature and timing of application. Effective management of FHB in wheat requires a comprehensive approach that considers factors such as the diversity of Fusarium species, weather conditions, the use of organic mulch, cultivar resistance, and proper fungicide application [25,26,27,28]. Central to implementing such strategies is the understanding of the specific Fusarium species present, their distribution, and the mycotoxins they produce. Therefore, the aim of this study was to investigate the prevalence, distribution, and species-specific mycotoxin production of Fusarium species associated with FHB in wheat fields across the Western Cape region of South Africa. Specifically, this study’s objectives are to (i) survey and identify Fusarium pathogens associated with wheat head blight in the West and South Coast districts of the Western Cape, (ii) provide an epidemiological report on FHB pathogens in these districts using disease severity and rating scales, (iii) isolate and characterize FHB pathogens through rDNA and species-specific PCR sequencing, and (iv) identify the mycotoxins produced by these FHB pathogens.

2. Materials and Methods

2.1. Field Survey and Sampling of Wheat for FHB Assessment in the Western Cape

A field survey of FHB disease was conducted between September and October 2022, and two fields each were selected in the West and South coast districts of the Western Cape. Darling and Klipheuwel represented the fields in the West coast, while Swellendam and Caledon represented the fields along the South coast (Figure 1). Each location was visited during the anthesis, milk, and dough development stages for sample collection. The pattern of sample collection involves a “W” pattern walk across the field, and 10 wheat heads from 10 sample points were randomly collected into a separate polythene bag for assessment in the laboratory.
Disease severity from the field was calculated using the relationship below:
D i s e a s e   s e v e r i t y = N u m b e r   o f   b l e a c h e d   h e a d   s p i k e l e t s T o t a l   n u m b e r   o f   s p i k e l e t s × 100
Wheat plants infected with head blight were identified based on visible symptoms on the spikelets, such as discoloration (turning pale or a bleached color, instead of the healthy green or yellow) and kernels that appeared shriveled, smaller, and lighter in weight. Wheat heads exhibiting blight symptoms were subsequently screened for FHB. All wheat spikes from each sampling location were counted and visually inspected for the presence or absence of FHB symptoms. Spikes were recorded as diseased when at least a single spikelet showed any signs of FHB, following the severity scale of Stack and McMullen [29] shown below (Figure 2).
The disease rate was calculated from the following relationship:
D i s e a s e   r a t e = N u m b e r   o f   p l a n t s   f r o m   c a t e g o r y   1 × t h e i r   p a t h o l o g i c a l   e v i d e n c e + ⋯ +   n u m b e r   o f   p l a n t s   f r o m   c a t e g o r y   ( 11 ) × t h e i r   p a t h o l o g i c a l   e v i d e n c e T o t a l   n u m b e r   o f   p l a n t s   t h e   h i g h e s t   p a t h o l o g i c a l   i n d e x
To compare the development of wheat FHB over time, a disease regression equation for head blight severity across two months was derived using Microsoft Excel.

2.2. Isolation and Cultivation of Fusarium Isolates from FHB-Infected Wheat Spikelets

Following the identification of spikelets with FHB symptoms from each sample collection point, twenty kernels per spikelet with symptoms such as white or pinkish mold growth, bleached spikes, and scabby or shriveled kernels, were surface-sterilized with a 3% sodium hypochlorite solution for two minutes. The kernels were rinsed with sterile distilled water, placed in sterile tissue paper, and allowed to dry in the laminar flow cabinet. The surface-sanitized kernels were plated onto potato dextrose agar (PDA) amended with 200 mg·L−1 ampicillin and incubated for seven days at 25–28 °C to monitor the growth of any Fusarium species. Fusarium colonies were purified by selecting single spores and sub-cultured on fresh PDA plates to grow mycelium for DNA extraction.

2.3. DNA Extraction from Fusarium Isolates for Molecular Analysis

High-molecular-weight genomic DNA from the mycelia of single-spore Fusarium isolates was extracted using a Zymo Research Fungal/Bacterial DNA Mini Prep Kit (Epigenetics, Hatfield, South Africa) according to the manufacturer’s instructions. The DNA purity and concentration of each isolate were measured using a NanoDrop 2000TM spectrophotometer (Thermo Scientific, Wilmington, NC, USA).

2.4. Polymerase Chain Reaction (PCR) Amplification of Fusarium Isolates

The ITS region of each Fusarium isolate (Table 1) was amplified using ITS1 (5′-TCCGTAGGTGAACCTGCG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) primers [26]. The PCR reactions (25 µL) consist of 1 µL of 1:10 or 1:100 diluted DNA, 1 U RedTaq DNA polymerase (Sigma-Aldrich, Milan, Italy), 2 µL RedTaq buffer, 1.7 µL of 22 mM MgCl2 (final concentration: 3.0 mM), 10 mM dNTPs, and 1.0 µM of each primer (forward and reverse). The PCR amplifications conditions consist of an initial denaturation at 94 °C for 4 min, followed by 35 cycles of 94 °C for 60 s, 57 °C for 60 s, and 72 °C for 60 s, with a final extension at 72 °C for 5 min.
Using multiplex PCR with known species-specific primers (Table 1), Fusarium isolates were amplified using the reaction and amplification conditions previously described [30,31,32,33]. In addition, the genomic DNA of F. ipomoeae was amplified with species-specific primers (Table 1) using the reaction conditions previously described by Wang et al. [34] with slight modifications. The amplification conditions consist of an initial denaturation step at 95 °C for 2 min, followed by 35 cycles of denaturation at 95 °C for 45 s, annealing at 55 °C for 30 s, and extension at 72 °C for 1 min, with a final extension step of 72 °C for 7 min.
All PCR amplicons were electrophoresed on a 1.5% (w/v) agarose gel with a 1 kb DNA ladder (Bioline, Memphis, TN, USA) and visualized under UV light using ethidium bromide staining.
Table 1. Primer names and sequences of Fusarium species associated with wheat head blight.
Table 1. Primer names and sequences of Fusarium species associated with wheat head blight.
TargetPrimerPrimer Sequence (5-3)Ta (°C)Reference
F. pseudograminearumFp1-1CGGGGTAGTTTCACATTTCCG60[30]
Fp1-2GAGAATGTGATGACGACAATA
F. culmorumFc01FATGGTGAACTCGTCG TGG C60[31]
Fc01RCCC TTC TTA CGC CAA TCT CG
F. graminearumFg16FCTC CGG ATA TGT TGC GTC AA60[31]
Fg16RGGT AGG TAT CCG ACA TGG CAA
F. avenaceumFaFCAA GCA TTG TCG CCA CTC TC60[35]
FaRGTT TGG CTC TAC CGG GAC TG
F. equisetiFeF1CATACCTATACGTTGCCTCG60[32]
FeR1TTACCAGTAACGAGGTGTATG
F. tricinctumFtricACL1-fCTG TGT GTT TGG TGG GAT TGG60[33]
FtricACL1-rTGG GAG TAG ACC GGG AAA AC
F. ipomoeaeCL1FGARTWCAAGGAGGCCTTCTC55[34]
CL2RTTTTTGCATCATGAGTTGGAC
Ta = Annealing temperature.

2.5. PCR Amplicon Sequencing and Phylogenetic Analysis

PCR products (ITS and species-specific) for each Fusarium isolate were purified and sequenced at Central Analytical Facilities of Stellenbosch University (Stellenbosch, South Africa). To identify the Fusarium isolates, the DNA sequences were edited and aligned using the Cluster W multiple sequence alignment tool in Molecular Evolutionary Genetics Analysis (MEGA) 11.0.13 software [36] and compared to sequences in the NCBI GenBank database (http://blast.ncbi.nlm.nih.gov, accessed on 12 September 2024). A phylogenetic tree was constructed using 500 bootstrap replicates and the maximum likelihood technique. Based on scores for the Bayesian information criterion, the molecular evolution model that best suited the data was chosen [37].

2.6. Profiling of Mycotoxin Chemotypes in the Fusarium Species

To profile for nivalenol (NIV) and 15-acetyl-deoxynivalenol (15-ADON) chemotypes, the protocol from van Coller et al. [1] was adopted, while for the zearalenone (ZEN) chemotype, the protocol from Neera and Murali [38] was adopted. Fusarium species chemotypes were profiled using multiplex PCR assays to amplify portions of the respective genes for the different mycotoxins.

3. Results

3.1. Identification of Wheat Head Blight Pathogens in Western Cape Region of South Africa

To identify the Fusarium isolates used in this study (Table 2), genetic polymorphism in the DNA sequences were analyzed. The DNA sequences of each Fusarium isolate have been deposited into GenBank and under different accession numbers (Table 2). Phylogenetic analysis revealed that Fusarium culmorum and Fusarium graminearum form a clade with F. culmorum voucher Fc 2 18s, whereas F. equiseti and F. ipomoeae were closely clustered and formed another clade with F. equiseti isolates RT-B2. The remaining three strains, F. pseudograminearum, F. avenaceum, and F. tricinctum formed monophyletic clades (Figure 3a).
The seven Fusarium isolates were grouped into three different complexes (Figure 3b). The first complex, Fusarium graminearum species complex (FGSC), consists of F. culmorum, F. graminearum, and F. pseudograminearum. The second complex, Fusarium incarnatum-equiseti species complex (FIESC), consists of F. equiseti and F. ipomoeae, while the Fusarium tricinctum species complex (FTSC) consists of F. avenaceum and F. tricinctum.
Using species-specific primers, the phylogenetic analysis of the different Fusarium isolates shows clustering with the different Fusarium species from the NCBI database (Figure 4a).
Phylogenetic analysis revealed close relationships among the isolates: F. ipomoeae with strain GZAX 312, F. pseudograminearum with strain LM 214803, F. culmorum with strain FR113 RAPD, F. tricinctum with strain DAOM:235630, and F. equiseti with strain ITC32 (Figure 4a). A comparative phylogenetic analysis between the different Fusarium species (Figure 4b) shows that the isolates differ from one another with the closely related species originating from the same root in the tree.

3.2. Disease Severity and Rate from the Sampling Locations in the Western Cape Region

Swellendam in the South coast recorded the highest disease severity (42.73%), followed by Caledon (38.00%), while Klipheuwel and Darling in the West coast had disease severities of 27.00% and 36.00%, respectively, at the dough development stage (Figure 5a). The disease progression at different stages of wheat development was also measured across the four sampling locations, and the results indicate that the dough stage showed the highest disease rate in all locations (Figure 5b). Swellendam and Caledon in the South Coast region showed the highest disease rate (0.3), followed by Darling (0.25) and Klipheuwel (0.15) in the West Coast region (Figure 5b). In addition, both disease severity and rate were higher in the South Coast of the Western Cape (35.22% and 0.26%, respectively) compared to the West Coast (25.56% and 0.14%, respectively) (Figure 6a,b).

3.3. Frequency and Distribution of Different Fusarium Species Across the Different Sampling Locations

The abundance of individual FHB-related species varied across the different sampling locations (Figure 7a–d), with fewer isolates identified in Swellendam (Figure 7c). F. ipomoeae was identified exclusively in Swellendam and Caledon, in the South coast region, with frequencies of occurrence of 19% and 14%, respectively (Figure 7c,d). On the other hand, F. tricintum was only identified in Klipheuwel and Caledon, with occurrence frequencies of 36% and 46%, respectively (Figure 7b,d). The remaining species including F. culmorum, F. graminearum, F, pseudograminearum, F. equiseti, and F. avenaceum were present in all sampling locations (Figure 7a–d).

3.4. Profiling of Mycotoxin Chemotypes by Fusarium Species Isolated from FHB Diseased Wheat Spikelet

A total of 112 Fusarium isolates were identified from the spikelets of diseased wheat plants (n = 1200) and characterized into seven different Fusarium species across the four sampling locations (Table 3). The seven Fusarium species were further characterized to identify their mycotoxin chemotypes. F. culmorum produced zearalenone (ZEN) and nivalenol (NIV) chemotypes, F. pseudograminearum produced ZEN and 15-acetyl-deoxynivalenol (15-ADON), while F. tricinctum only produced NIV (Table 3). None of the tested mycotoxins were detected in F. graminearum, F. equiseti, F. ipomoea, and F. avenaceum.

4. Discussion

Seven Fusarium species from seven of the major Fusarium species complexes were associated with FHB of wheat from all the sampling locations in the Western Cape region of South Africa (Table 2, Figure 3a,b). Most of the isolates consist of species from FGSC. Furthermore, phylogenetic analysis of the different isolates using specific gene primers shows a perfect clustering of the individual isolates with their corresponding species from the database (Figure 4a). Comparative phylogenetic analysis between the respective isolates shows that they all differ from one another with the closely related species originating from the same branch in the phylogenetic tree (Figure 4b). This analysis was necessary to ensure that the individual species of Fusarium completely differs from one another. The findings from this study agree with the reports of Van Coller et al. [1] and Minnaar-Ontong et al. [14], demonstrating FGSC as major FHB pathogens of wheat in South Africa and one of the major pathogens associated with head blight in the world [14,21,39,40,41,42,43,44]. Over three decade ago, the outbreak of FHB disease associated with FGSC was recorded in South Africa in KwaZulu-Natal and parts of Bushveld in the Eastern region of the Free State [45]. Ten years later, different batches of FHB-infected wheat seeds collected from fields at Prieska (Northern Cape) reported the presence of F. equiseti and F. culmorum as part of the identified pathogens from the seeds [14]. Fusarium avenaceum and F. pseudograminearum identified from in this study were among the first reported FHB pathogens in wheat identified from South Africa in 2022 [1].
The outbreak of FHB disease depends largely on the environmental and weather conditions which can vary between seasons. The disease severity was measured in each field during the different stages of wheat development, and the results show an increase in the severity and rate of the disease from the pollination to dough stage across the four different fields (Figure 5a,b and Figure 6a,b). Increase in the severity and rate of the disease could be attributed to different climatic factors such as temperature and rain, which favor the outbreak of FHB particularly in wheat [46]. Furthermore, increase in the severity of the disease across the different developmental stages could be due to the type of farming practice (types of crops planted on the field in the previous years). For example, a large amount of within-field maize residue is an FHB risk factor. Therefore, rotational practice involving no-host crops is recommended for FHB management [47,48]. Though we did not quantify the surface residue of FHB in this study, it was also reported that no-till systems typically leave about 30% of the soil surface covered with residue [46]. Besides the farming practice method, the severity of the disease could have been influenced by cultivar resistance and management practices such as fungicide application [49,50]. A major challenge in the management of FHB disease in South Africa is the unavailability of resistant wheat varieties, bio-fungicides, and licensed fungicides to the local farmers [3].
Studies have shown that there is a strong correlation between favorable climatic conditions such as temperature and high humidity with FHB epidemics before and during flowering stage [51,52]. At the time of this survey between September and October 2022, the average temperature was between 13 °C (55 °F) and 21 °C (70 °F), with a high humidity of 73% in Cape Town, which may favor the growth of Fusarium species (Figure 7). Another factor that may favor a high occurrence of these pathogens is the stage of the plants (dough stage) when the samples were collected, as FHB symptoms are most pronounced, but kernels are not fully developed. During isolations, it may be difficult to determine which kernels are diseased when they are dry a few days after sampling [1]. An interesting observation from this study is the presence of F. culmorum, F. graminearum, F. pseudograminearum, F. equiseti, and F. avenaceum from all the sampled locations (Figure 7). A recent study conducted in the Western Cape region showed that over 80% of the isolates associated with FHB disease symptoms were identified as F. pseudograminearum, the major pathogen in the study. However, contrary to their report, F. pseudograminearum isolated in this study produces zearalenone and 15-ADON chemotypes, but not the NIV chemotype [1,43,53,54], while F. culmorum produces both the NIV and ZEN chemotypes (Table 3). Surveillance studies should include the determination of Fusarium mycotoxins and their acetylated derivatives, as this can offer valuable information on the distribution of toxigenic strains of the fungus, which may pose significant threats to food safety and security.

5. Conclusions

This study isolated and identified seven distinct strains of Fusarium from wheat samples collected across various wheat-growing regions to assess the prevalence and severity of FHB. Phylogenetic analysis grouped these strains into three major complexes: FGSC, FIESC, and FTSC, demonstrating clear geographical variation in species distribution. The results revealed that FHB development peaked during the dough stage of wheat growth, with the highest disease incidence recorded in Swellendam and Caledon in the southern region of South Africa. Mycotoxin profiling highlighted the production of key toxins, including ZEN, 15-ADON, and NIV by the isolated Fusarium strains, underscoring the significant threat FHB poses to food safety. These mycotoxins are known to contaminate wheat products, posing health risks to consumers and potentially affecting trade and market access. The detection of F. ipomoeae and F. tricinctum in specific locations, along with the high frequency of FGSC members across all sampled areas, underscores the need for targeted and region-specific management strategies. It is worth noting that the detection of F. Ipomoeae in the spikelets of diseased wheat heads represents the first report globally, while the identification of F. tricinctum is the first report in South Africa. The identification of toxigenic strains capable of producing multiple mycotoxins highlights the importance of continuous monitoring to alleviate the risks posed by FHB to both food safety and food security. Further research should focus on the development and use of resistant wheat cultivars, optimizing fungicide application timing, and exploring novel biocontrol measures to manage FHB effectively. Long-term epidemiological studies under varying climatic conditions are also important to better understand disease dynamics and improve control strategies. This study provides a crucial foundation for policy development aimed at safeguarding wheat production, improving food safety, and ensuring sustainable agricultural practices in South Africa.

Author Contributions

Conceptualization, A.K.; methodology, A.A.-H.; software, M.K., M.D.P., A.A.-H., A.I.D. and O.A.; validation, A.A.-H., M.K., A.I.D. and A.K.; formal analysis, A.A.-H., M.K., M.D.P., A.I.D. and O.A.; investigation, A.A.-H., O.A. and A.I.D.; resources, A.K. and M.K.; data curation, A.A.-H. and A.K.; writing—original draft preparation, A.A.-H., O.A. and A.I.D.; writing—review and editing, A.A.-H., O.A., A.I.D., M.D.P., M.K. and A.K.; visualization, A.A.-H. and A.K.; supervision, M.D.P., M.K. and A.K.; project administration, A.K.; funding acquisition, A.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Department of Science and Innovation and Technology Innovation Agency, grant numbers GB0200065 and GB0200090. The APC was partially funded by the University of the Western Cape and the Department of Science and Innovation and Technology Innovation Agency.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors would like to thank the University of the Western Cape for their infrastructure and administrative support.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Van Coller, G.J.; Rose, L.J.; Boutigny, A.-L.; Ward, T.J.; Lamprecht, S.C.; Viljoen, A. The Distribution and Type B Trichothecene Chemotype of Fusarium Species Associated with Head Blight of Wheat in South Africa During 2008 and 2009. PLoS ONE 2022, 17, e0275084. [Google Scholar] [CrossRef]
  2. Shude, S.P.; Yobo, K.S.; Mbili, N.C. Progress in the Management of Fusarium Head Blight of Wheat: An Overview. S. Afr. J. Sci. 2020, 116, 1–7. [Google Scholar] [CrossRef]
  3. Ma, Z.; Xie, Q.; Li, G.; Jia, H.; Zhou, J.; Kong, Z.; Li, N.; Yuan, Y. Germplasms, Genetics and Genomics for Better Control of Disastrous Wheat Fusarium Head Blight. Theor. Appl. Genet. 2020, 133, 1541–1568. [Google Scholar] [CrossRef]
  4. Wang, L.; Wang, D.; Yuan, S.; Feng, X.; Wang, M. Transcriptomic Insights into the Antifungal Effects of Magnolol on the Growth and Mycotoxin Production of Alternaria Alternata. Toxins 2020, 12, 665. [Google Scholar] [CrossRef] [PubMed]
  5. Yu, C.; Liu, X.; Zhang, X.; Zhang, M.; Gu, Y.; Ali, Q.; Mohamed, M.S.R.; Xu, J.; Shi, J.; Gao, X.; et al. Mycosubtilin Produced by Bacillus subtilis ATCC6633 Inhibits Growth and Mycotoxin Biosynthesis of Fusarium graminearum and Fusarium verticillioides. Toxins 2021, 13, 791. [Google Scholar] [CrossRef]
  6. Spanic, V.; Maricevic, M.; Ikic, I.; Sulyok, M.; Sarcevic, H. Three-Year Survey of Fusarium Multi-Metabolites/Mycotoxins Contamination in Wheat Samples in Potentially Epidemic Fhb Conditions. Agronomy 2023, 13, 805. [Google Scholar] [CrossRef]
  7. Paudel, B.; Pedersen, C.; Yen, Y.; Marzano, S.-Y.L. Fusarium graminearum Virus-1 Strain FgV1-SD4 Infection Eliminates Mycotoxin Deoxynivalenol Synthesis by Fusarium graminearum in FHB. Microorganisms 2022, 10, 1484. [Google Scholar] [CrossRef]
  8. Hudec, K.; Kičinová, J.; Mihók, M. Changes of Species Spectrum Associated with Fusarium Head Blight Caused by Fungicides. J. Cent. Eur. Agric. 2019, 20, 376–388. [Google Scholar] [CrossRef]
  9. Powell, A.J.; Kim, S.H.; Cordero, J.; Vujanovic, V. Protocooperative Effect of Sphaerodes Mycoparasitica Biocontrol and Crop Genotypes on Fhb Mycotoxin Reduction in Bread and Durum Wheat Grains Intended for Human and Animal Consumption. Microorganisms 2023, 11, 159. [Google Scholar] [CrossRef]
  10. Qiu, M.; Zheng, S.; Tang, L.; Hu, X.; Xu, Q.; Zheng, L.; Weng, S. Raman Spectroscopy and Improved Inception Network for Determination of Fhb-Infected Wheat Kernels. Foods 2022, 11, 578. [Google Scholar] [CrossRef]
  11. Matić, M.; Vuković, R.; Vrandečić, K.; Štolfa Čamagajevac, I.; Ćosić, J.; Vuković, A.; Dvojković, K.; Novoselović, D. Defense Response to Fusarium Infection in Winter Wheat Varieties, Varying in Fhb Susceptibility, Grown under Different Nitrogen Levels. Agronomy 2022, 12, 1746. [Google Scholar] [CrossRef]
  12. Spanic, V.; Zdunic, Z.; Drezner, G.; Sarkanj, B. The Pressure of Fusarium Disease and Its Relation with Mycotoxins in the Wheat Grain and Malt. Toxins 2019, 11, 198. [Google Scholar] [CrossRef]
  13. Alisaac, E.; Mahlein, A.-K. Fusarium Head Blight on Wheat: Biology, Modern Detection and Diagnosis and Integrated Disease Management. Toxins 2023, 15, 192. [Google Scholar] [CrossRef]
  14. Minnaar-Ontong, A.; Herselman, L.; Kriel, W.-M.; Leslie, J.F. Morphological Characterization and Trichothecene Genotype Analysis of a Fusarium Head Blight Population in South Africa. Eur. J. Plant Pathol. 2017, 148, 261–269. [Google Scholar] [CrossRef]
  15. De Villiers, C.I. Glasshouse Screening of Cimmyt Wheat Germplasm for Fusarium Head Blight Response in South Africa. S. Afr. J. Plant Soil 2014, 31, 49–51. [Google Scholar] [CrossRef]
  16. Shah, L.; Ali, A.; Yahya, M.; Zhu, Y.; Wang, S.; Si, H.; Rahman, H.; Ma, C. Integrated Control of Fusarium Head Blight and Deoxynivalenol Mycotoxin in Wheat. Plant Pathol. 2018, 67, 532–548. [Google Scholar] [CrossRef]
  17. Hong, Y.; Zhang, M.; Yuan, Z.; Zhu, J.; Lv, C.; Guo, B.; Wang, F.; Xu, R. Genome-Wide Association Studies Reveal Stable Loci for Wheat Grain Size under Different Sowing Dates. PeerJ 2024, 12, e16984. [Google Scholar] [CrossRef]
  18. Goncharov, A.A.; Gorbatova, A.S.; Sidorova, A.A.; Tiunov, A.V.; Bocharov, G.A. Mathematical Modelling of the Interaction of Winter Wheat (Triticum aestivum) and Fusarium Species (Fusarium spp.). Ecol. Model. 2022, 465, 109856. [Google Scholar] [CrossRef]
  19. Imane, B.; Hannane, A.; Amor, B.; Noureddine, R. Fusarium Species Associated with Wheat Head Blight Disease in Algeria: Characterization and Effects of Triazole Fungicides. Pestic. Phytomed./Pestic. I Fitomed. 2022, 37, 49–62. [Google Scholar] [CrossRef]
  20. Hadjout, S.; Chéreau, S.; Mekliche, L.; Marchegay, G.; Ducos, C.; Boureghda, H.; Zouidi, M.; Barreau, C.; Bouznad, Z.; Richard-Forget, F. Molecular Identification of Some Fusarium Isolates and Their Chemotypes Involved in Fusarium Head Blight on Durum Wheat in Algeria. Arch. Phytopathol. Plant Prot. 2022, 55, 499–513. [Google Scholar] [CrossRef]
  21. Zhang, J.B.; Wang, J.H.; Gong, A.D.; Chen, F.F.; Song, B.; Li, X.; Li, H.P.; Peng, C.H.; Liao, Y.C. Natural Occurrence of Fusarium Head Blight, Mycotoxins and Mycotoxin-Producing Isolates of Fusarium in Commercial Fields of Wheat in Hubei. Plant Pathol. 2013, 62, 92–102. [Google Scholar] [CrossRef]
  22. Šíp, V.; Chrpová, J.; Leišová, L.; Sýkorová, S.; Kučera, L.; Ovesná, J. Effects of Genotype, Environment and Fungicide Treatment on Development of Fusarium Head Blight and Accumulation of Don in Winter Wheat Grain. Czech J. Genet. Plant Breed. 2007, 43, 16. [Google Scholar] [CrossRef]
  23. Peršić, V.; Božinović, I.; Varnica, I.; Babić, J.; Španić, V. Impact of Fusarium Head Blight on Wheat Flour Quality: Examination of Protease Activity, Technological Quality and Rheological Properties. Agronomy 2023, 13, 662. [Google Scholar] [CrossRef]
  24. Wenda-Piesik, A.; Lemańczyk, G.; Twarużek, M.; Błajet-Kosicka, A.; Kazek, M.; Grajewski, J. Fusarium Head Blight Incidence and Detection of Fusarium Toxins in Wheat in Relation to Agronomic Factors. Eur. J. Plant Pathol. 2017, 149, 515–531. [Google Scholar] [CrossRef]
  25. Kumar, N.; Upadhyay, G.; Chhetri, K.B.; Harsha, B.R.; Malik, G.K.; Kumar, R.; Jasrotia, P.; Samota, S.R.; Kumar, N.; Chhokar, R.S.; et al. Pre-and Post-Harvest Management of Wheat for Improving the Productivity, Quality, and Resource Utilization Efficiency. In Wheat Science; CRC Press: Boca Raton, FL, USA, 2023; pp. 57–106. [Google Scholar]
  26. Asif, M. Effects of Cultivars and Fungicides on Foliar Fungal Diseases and Fusarium Head Blight in Winter Wheat. Ph.D. Thesis, The University of Nebraska-Lincoln, Lincoln, NE, USA, 2024. [Google Scholar]
  27. Tillmann, M.; von Tiedemann, A.; Winter, M. Crop Rotation Effects on Incidence and Diversity of Fusarium Species Colonizing Stem Bases and Grains of Winter Wheat. J. Plant Dis. Prot. 2017, 124, 121–130. [Google Scholar] [CrossRef]
  28. Schöneberg, T.; Martin, C.; Wettstein, F.E.; Bucheli, T.D.; Mascher, F.; Bertossa, M.; Musa, T.; Keller, B.; Vogelgsang, S. Fusarium and Mycotoxin Spectra in Swiss Barley Are Affected by Various Cropping Techniques. Food Addit. Contam. Part A 2016, 33, 1608–1619. [Google Scholar] [CrossRef] [PubMed]
  29. Stack, R.W.; McMullen, M.P. A Visual Scale to Estimate Severity of Fusarium Head Blight in Wheat; North Dakota State University Extension Service: Fargo, ND, USA, 1998; p. 1095. [Google Scholar]
  30. Scott, J.B.; Chakraborty, S. Multilocus Sequence Analysis of Fusarium pseudograminearum Reveals a Single Phylogenetic Species. Mycol. Res. 2006, 110, 1413–1425. [Google Scholar] [CrossRef]
  31. Nicholson, P.; Simpson, D.; Weston, G.; Rezanoor, H.; Lees, A.; Parry, D.; Joyce, D. Detection and Quantification of Fusarium culmorum and Fusarium graminearumin Cereals Using PCR Assays. Physiol. Mol. Plant Pathol. 1998, 53, 17–37. [Google Scholar] [CrossRef]
  32. Mishra, P.K.; Fox, R.T.; Culham, A. Development of a Pcr-Based Assay for Rapid and Reliable Identification of Pathogenic Fusaria. FEMS Microbiol. Lett. 2003, 218, 329–332. [Google Scholar] [CrossRef]
  33. Niessen, L.; Gräfenhan, T.; Vogel, R.F. ATP Citrate Lyase 1 (acl1) Gene-Based Loop-Mediated Amplification Assay for the Detection of the Fusarium tricinctum Species Complex in Pure Cultures and in Cereal Samples. Int. J. Food Microbiol. 2012, 158, 171–185. [Google Scholar] [CrossRef] [PubMed]
  34. Wang, H.; Li, Y.; Li, W.; Cai, L.; Meng, J.; Xia, G.; Yin, J.; Liu, X. Morphological and Molecular Identification of Fusarium ipomoeae as the Causative Agent of Leaf Spot Disease in Tobacco from China. Microorganisms 2022, 10, 1890. [Google Scholar] [CrossRef]
  35. Doohan, F.M.; Parry, D.W.; Jenkinson, P.; Nicholson, P. The Use of Species-Specific Pcr-Based Assays to Analyse Fusarium Ear Blight of Wheat. Plant Pathol. 1998, 47, 197–205. [Google Scholar] [CrossRef]
  36. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  37. Alvarenga, A.A.A.; Ouchi, J.C.M.I.; Martínez, C.C.C.; Mendes, J.M.; Colmán, A.A.; Ríos, D.F.; Arrua, P.D.; Guerreño, C.A.B.; Kohli, M.M.; Ramírez, M.L.; et al. Trichothecene Genotype Profiling of Wheat Fusarium graminearum Species Complex in Paraguay. Toxins 2022, 14, 257. [Google Scholar] [CrossRef]
  38. Neera; Murali, H. Development and Evaluation of Multiplex Pcr for Detection of T-2 and Zearalenone Producing Fusarium spp. Lett. Appl. Microbiol. 2021, 73, 363–371. [Google Scholar] [CrossRef]
  39. McMullen, M.; Bergstrom, G.; De Wolf, E.; Dill-Macky, R.; Hershman, D.; Shaner, G.; Van Sanford, D. A Unified Effort to Fight an Enemy of Wheat and Barley: Fusarium Head Blight. Plant Dis. 2012, 96, 1712–1728. [Google Scholar] [CrossRef] [PubMed]
  40. Reynoso, M.M.; Ramirez, M.L.; Torres, A.M.; Chulze, S.N. Trichothecene Genotypes and Chemotypes in Fusarium graminearum Strains Isolated from Wheat in Argentina. Int. J. Food Microbiol. 2011, 145, 444–448. [Google Scholar] [CrossRef]
  41. Umpiérrez-Failache, M.; Garmendia, G.; Pereyra, S.; Rodríguez-Haralambides, A.; Ward, T.; Vero, S. Regional Differences in Species Composition and Toxigenic Potential among Fusarium Head Blight Isolates from Uruguay Indicate a Risk of Nivalenol Contamination in New Wheat Production Areas. Int. J. Food Microbiol. 2013, 166, 135–140. [Google Scholar] [CrossRef]
  42. Del Ponte, E.M.; Spolti, P.; Ward, T.J.; Gomes, L.B.; Nicolli, C.P.; Kuhnem, P.R.; Silva, C.N.; Tessmann, D.J. Regional and Field-Specific Factors Affect the Composition of Fusarium Head Blight Pathogens in Subtropical No-Till Wheat Agroecosystem of Brazil. Phytopathology 2015, 105, 246–254. [Google Scholar] [CrossRef] [PubMed]
  43. Ji, L.; Li, Q.; Wang, Y.; Burgess, L.W.; Sun, M.; Cao, K.; Kong, L. Monitoring of Fusarium Species and Trichothecene Genotypes Associated with Fusarium Head Blight on Wheat in Hebei Province, China. Toxins 2019, 11, 243. [Google Scholar] [CrossRef]
  44. Bilska, K.; Jurczak, S.; Kulik, T.; Ropelewska, E.; Olszewski, J.; Żelechowski, M.; Zapotoczny, P. Species Composition and Trichothecene Genotype Profiling of Fusarium Field Isolates Recovered from Wheat in Poland. Toxins 2018, 10, 325. [Google Scholar] [CrossRef]
  45. Scott, D.B.; de Jager, J.H.; van Wyk, P.S. Fusarium Blight of Irrigated Wheat in South Africa. Phytophylactica 1988, 20, 317–320. [Google Scholar]
  46. Spolti, P.; Shah, D.A.; Fernandes, J.M.C.; Bergstrom, G.C.; Del Ponte, E.M. Disease Risk, Spatial Patterns, and Incidence-Severity Relationships of Fusarium Head Blight in No-Till Spring Wheat Following Maize or Soybean. Plant Dis. 2015, 99, 1360–1366. [Google Scholar] [CrossRef]
  47. Landschoot, S.; Audenaert, K.; Waegeman, W.; De Baets, B.; Haesaert, G. Influence of Maize–Wheat Rotation Systems on Fusarium Head Blight Infection and Deoxynivalenol Content in Wheat under Low Versus High Disease Pressure. Crop Prot. 2013, 52, 14–21. [Google Scholar] [CrossRef]
  48. Buerstmayr, H.; Lemmens, M. Breeding Healthy Cereals: Genetic Improvement of Fusarium Resistance and Consequences for Mycotoxins. World Mycotoxin J. 2015, 8, 591–602. [Google Scholar] [CrossRef]
  49. Spolti, P.; Guerra, D.S.; Badiale-Furlong, E.; Del Ponte, E.M. Single and Sequential Applications of Metconazole Alone or in Mixture with Pyraclostrobin to Improve Fusarium Head Blight Control and Wheat Yield in Brazil. Trop. Plant Pathol. 2013, 38, 85–96. [Google Scholar] [CrossRef]
  50. Feksa, H.; Couto, H.D.; Garozi, R.; De Almeida, J.; Gardiano, C.; Tessmann, D. Pre-and Postinfection Application of Strobilurin-Triazole Premixes and Single Fungicides for Control of Fusarium Head Blight and Deoxynivalenol Mycotoxin in Wheat. Crop Prot. 2019, 117, 128–134. [Google Scholar] [CrossRef]
  51. Gorczyca, A.; Oleksy, A.; Gala-Czekaj, D.; Urbaniak, M.; Laskowska, M.; Waśkiewicz, A.; Stępień, Ł. Fusarium Head Blight Incidence and Mycotoxin Accumulation in Three Durum Wheat Cultivars in Relation to Sowing Date and Density. Sci. Nat. 2018, 105, 2. [Google Scholar] [CrossRef] [PubMed]
  52. Shah, D.A.; Molineros, J.E.; Paul, P.A.; Willyerd, K.T.; Madden, L.V.; De Wolf, E.D. Predicting Fusarium Head Blight Epidemics with Weather-Driven Pre-and Post-Anthesis Logistic Regression Models. Phytopathology 2013, 103, 906–919. [Google Scholar] [CrossRef]
  53. Obanor, F.; Neate, S.; Simpfendorfer, S.; Sabburg, R.; Wilson, P.; Chakraborty, S. Fusarium graminearum and Fusarium pseudograminearum Caused the 2010 Head Blight Epidemics in Australia. Plant Pathol. 2013, 62, 79–91. [Google Scholar] [CrossRef]
  54. Clear, R.M.; Patrick, S.K.; Gaba, D.; Roscoe, M.; Demeke, T.; Pouleur, S.; Couture, L.; Ward, T.J.; O’Donnell, K.; Turkington, T.K. Trichothecene and Zearalenone Production, in Culture, by Isolates of Fusarium pseudograminearum from Western Canada. Can. J. Plant Pathol. 2006, 28, 131–136. [Google Scholar] [CrossRef]
Pathogens 14 00080 g001
Figure 1. Map showing four sampling locations in the Western Cape region of South Africa.
Figure 1. Map showing four sampling locations in the Western Cape region of South Africa.
Pathogens 14 00080 g001
Pathogens 14 00080 g002
Figure 2. Fusarium head blight (FHB) severity rating scale in wheat showing percentage severity levels [29].
Figure 2. Fusarium head blight (FHB) severity rating scale in wheat showing percentage severity levels [29].
Pathogens 14 00080 g002
Pathogens 14 00080 g003
Figure 3. (a) Maximum likelihood phylogenetic analysis of ITS-rDNA sequences showing the relationship between Fusarium isolates with reference sequences from NCBI. The phylogenetic tree shows the relationships of Fusarium isolates causing FHB disease in wheat. The identified Fusarium isolates used in this study are underlined in red. (b) Phylogenetic tree showing relationship between Fusarium isolates in different species complexes (FGSC, FIESC, FTSC) associated with FHB. The sequence of Alternaria alternata DR-CTS 6-21 was used as an outgroup. Keys: FGSC = Fusarium graminearum species complex; FIESC = Fusarium incarnatum-equiseti species complex; and FTSC = Fusarium tricinctum species complex.
Figure 3. (a) Maximum likelihood phylogenetic analysis of ITS-rDNA sequences showing the relationship between Fusarium isolates with reference sequences from NCBI. The phylogenetic tree shows the relationships of Fusarium isolates causing FHB disease in wheat. The identified Fusarium isolates used in this study are underlined in red. (b) Phylogenetic tree showing relationship between Fusarium isolates in different species complexes (FGSC, FIESC, FTSC) associated with FHB. The sequence of Alternaria alternata DR-CTS 6-21 was used as an outgroup. Keys: FGSC = Fusarium graminearum species complex; FIESC = Fusarium incarnatum-equiseti species complex; and FTSC = Fusarium tricinctum species complex.
Pathogens 14 00080 g003
Pathogens 14 00080 g004
Figure 4. (a) Maximum likelihood phylogenetic analysis of species-specific gene sequences showing the relationship between Fusarium isolates with reference sequences from NCBI. The tree shows the phylogenetic relationships of Fusarium species causing FHB disease in wheat. The identified Fusarium isolates used in this study are underlined in red. (b) Comparative phylogenetic analysis of Fusarium isolates using species-specific gene sequences. The sequence of Clonostacys rosea strain CR-7 was used as an outgroup.
Figure 4. (a) Maximum likelihood phylogenetic analysis of species-specific gene sequences showing the relationship between Fusarium isolates with reference sequences from NCBI. The tree shows the phylogenetic relationships of Fusarium species causing FHB disease in wheat. The identified Fusarium isolates used in this study are underlined in red. (b) Comparative phylogenetic analysis of Fusarium isolates using species-specific gene sequences. The sequence of Clonostacys rosea strain CR-7 was used as an outgroup.
Pathogens 14 00080 g004
Pathogens 14 00080 g005
Figure 5. FHB disease severity (a) and disease rate (b) across different sampling locations.
Figure 5. FHB disease severity (a) and disease rate (b) across different sampling locations.
Pathogens 14 00080 g005
Pathogens 14 00080 g006
Figure 6. FHB disease severity (a) and disease rate (b) across the two sampling regions.
Figure 6. FHB disease severity (a) and disease rate (b) across the two sampling regions.
Pathogens 14 00080 g006
Pathogens 14 00080 g007
Figure 7. Frequencies of all Fusarium species identified from (a) Darling, (b) Klipheuwel, (c) Swellendam, and (d) Calendon.
Figure 7. Frequencies of all Fusarium species identified from (a) Darling, (b) Klipheuwel, (c) Swellendam, and (d) Calendon.
Pathogens 14 00080 g007
Table 2. GenBank accession numbers for Fusarium species used in phylogenetic analysis.
Table 2. GenBank accession numbers for Fusarium species used in phylogenetic analysis.
Fusarium SpeciesGenBank Accession
Fusarium avenaceum DR-CTS M1-7PQ192151
Fusarium culmorum KH-CTS M2(4)OR580986
Fusarium equiseti DR-CTS BOR581616
Fusarium graminearum DR-CTS D1OR582334
Fusarium ipomoeae SW-CTS SWOR582482
Fusarium pseudograminearum SW-CTS S1(1)OR582866
Fusarium tricinctum KH-CTS 16r-a rePQ192641
Table 3. Profiling mycotoxin chemotypes of Fusarium species isolated from FHB diseased wheat spikelet.
Table 3. Profiling mycotoxin chemotypes of Fusarium species isolated from FHB diseased wheat spikelet.
Fusarium SpeciesZEN15-ADONNIV
F. culmorum KH-CTS M2(4)+-+
F. graminearum DR-CTS D1---
F. pseudograminearum SW-CTS S1(1)++-
F. equiseti DR-CTS B---
F. ipomoeae SW-CTS SW---
F. tricinctum KH-CTS 16r-a re--+
F. avenaceum DR-CTS M1-7---
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Al-Hashimi, A.; Daniel, A.I.; Aina, O.; Du Plessis, M.; Keyster, M.; Klein, A. Survey and Identification of Fusarium Head Blight Pathogens of Wheat in the Western Cape Region of South Africa. Pathogens 2025, 14, 80. https://doi.org/10.3390/pathogens14010080

AMA Style

Al-Hashimi A, Daniel AI, Aina O, Du Plessis M, Keyster M, Klein A. Survey and Identification of Fusarium Head Blight Pathogens of Wheat in the Western Cape Region of South Africa. Pathogens. 2025; 14(1):80. https://doi.org/10.3390/pathogens14010080

Chicago/Turabian Style

Al-Hashimi, Ali, Augustine Innalegwu Daniel, Omolola Aina, Morné Du Plessis, Marshall Keyster, and Ashwil Klein. 2025. "Survey and Identification of Fusarium Head Blight Pathogens of Wheat in the Western Cape Region of South Africa" Pathogens 14, no. 1: 80. https://doi.org/10.3390/pathogens14010080

APA Style

Al-Hashimi, A., Daniel, A. I., Aina, O., Du Plessis, M., Keyster, M., & Klein, A. (2025). Survey and Identification of Fusarium Head Blight Pathogens of Wheat in the Western Cape Region of South Africa. Pathogens, 14(1), 80. https://doi.org/10.3390/pathogens14010080

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop